| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
|
|
|
|||||||
|
|||||||||
Institut für Virologie, Justus-Liebig-Universität Giessen, D-6300 Giessen, F.R.G.
Recently we have shown that an open reading frame comprising 10290 nucleotides is present on the infectious, single-stranded genome RNA of the West Nile flavivirus. We have now isolated cloned cDNA representing the 3'-terminal untranslated region of this molecule. The sequence of this region which comprises 571 nucleotides is given in this report. Recently, the nucleotide sequence of the genome RNA of the yellow fever flavivirus has been described. A comparative analysis of the 3'-terminal untranslated nucleotide sequences present in each genome suggests that in flaviviruses this region probably has the following properties. It has a heteropolymeric sequence at the 3' terminus. It contains one or more oligonucleotide sequences that are repeated. An extensive stem and loop structure can be folded from the nucleotide sequences present at the 3' terminus. The stem of this structure contains a conserved region introducing a defined mismatch into the stem. The loop of this structure probably contains short conserved oligonucleotide sequences in analogous positions. In both viruses the oligonucleotide CAUAUUGAC (
)CC(
GGGA( AGAC lies closely in front of the sequence which can be folded into the stem of the 3'-terminal stem and loop structure and the oligonucleotide CUAGAGGUUAGAGGAGACCC is strictly conserved between both viruses. The analyses indicate that the 3'-terminal untranslated region of the genome of flaviviruses probably has rather unique characteristics of primary and secondary structure. Possible implications of these findings are discussed.
Keywords: West Nile virus, genome structure, flaviviruses
Received 19 November 1985;
accepted 26 February 1986.
This article has been cited by other articles:
|
|
 |
|
  B.-H. Song, S.-I. Yun, Y.-J. Choi, J.-M. Kim, C.-H. Lee, and Y.-M. Lee A complex RNA motif defined by three discontinuous 5-nucleotide-long strands is essential for Flavivirus RNA replication RNA, September 1, 2008; 14(9): 1791 - 1813. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 R. Suzuki, R. Fayzulin, I. Frolov, and P. W. Mason Identification of Mutated Cyclization Sequences That Permit Efficient Replication of West Nile Virus Genomes: Use in Safer Propagation of a Novel Vaccine Candidate J. Virol., July 15, 2008; 82(14): 6942 - 6951. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
W. G. Davis, J. L. Blackwell, P.-Y. Shi, and M. A. Brinton Interaction between the Cellular Protein eEF1A and the 3'-Terminal Stem-Loop of West Nile Virus Genomic RNA Facilitates Viral Minus-Strand RNA Synthesis J. Virol., September 15, 2007; 81(18): 10172 - 10187. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 P. A. G. C. Silva, R. Molenkamp, T. J. Dalebout, N. Charlier, J. H. Neyts, W. J. M. Spaan, and P. J. Bredenbeek Conservation of the pentanucleotide motif at the top of the yellow fever virus 17D 3' stem-loop structure is not required for replication J. Gen. Virol., June 1, 2007; 88(6): 1738 - 1747. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
T. S. Deas, I. Binduga-Gajewska, M. Tilgner, P. Ren, D. A. Stein, H. M. Moulton, P. L. Iversen, E. B. Kauffman, L. D. Kramer, and P.-Y. Shi Inhibition of Flavivirus Infections by Antisense Oligomers Specifically Suppressing Viral Translation and RNA Replication J. Virol., April 15, 2005; 79(8): 4599 - 4609. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
L. Yu and L. Markoff The Topology of Bulges in the Long Stem of the Flavivirus 3' Stem-Loop Is a Major Determinant of RNA Replication Competence J. Virol., February 15, 2005; 79(4): 2309 - 2324. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J.-P. Mutebi, R. C. A. Rijnbrand, H. Wang, K. D. Ryman, E. Wang, L. D. Fulop, R. Titball, and A. D. T. Barrett Genetic Relationships and Evolution of Genotypes of Yellow Fever Virus and Other Members of the Yellow Fever Virus Group within the Flavivirus Genus Based on the 3' Noncoding Region J. Virol., September 15, 2004; 78(18): 9652 - 9665. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. Tilgner and P.-Y. Shi Structure and Function of the 3' Terminal Six Nucleotides of the West Nile Virus Genome in Viral Replication J. Virol., August 1, 2004; 78(15): 8159 - 8171. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. A Khromykh, N. Kondratieva, J.-Y. Sgro, A. Palmenberg, and E. G Westaway Significance in Replication of the Terminal Nucleotides of the Flavivirus Genome J. Virol., October 1, 2003; 77(19): 10623 - 10629. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
P. J. Bredenbeek, E. A. Kooi, B. Lindenbach, N. Huijkman, C. M. Rice, and W. J. M. Spaan A stable full-length yellow fever virus cDNA clone and the role of conserved RNA elements in flavivirus replication J. Gen. Virol., May 1, 2003; 84(5): 1261 - 1268. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
N. Charlier, P. Leyssen, C. W. A. Pleij, P. Lemey, F. Billoir, K. Van Laethem, A.-M. Vandamme, E. De Clercq, X. de Lamballerie, and J. Neyts Complete genome sequence of Montana Myotis leukoencephalitis virus, phylogenetic analysis and comparative study of the 3' untranslated region of flaviviruses with no known vector J. Gen. Virol., August 1, 2002; 83(8): 1875 - 1885. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
L. Markoff, X. Pang, H.-s. Houng, B. Falgout, R. Olsen, E. Jones, and S. Polo Derivation and Characterization of a Dengue Type 1 Host Range-Restricted Mutant Virus That Is Attenuated and Highly Immunogenic in Monkeys J. Virol., March 7, 2002; 76(7): 3318 - 3328. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. A. Khromykh, H. Meka, K. J. Guyatt, and E. G. Westaway Essential Role of Cyclization Sequences in Flavivirus RNA Replication J. Virol., July 15, 2001; 75(14): 6719 - 6728. [Abstract] [Full Text]
|
|
|
|
|
|
S. Steffens, H.-J. Thiel, and S.-E. Behrens The RNA-dependent RNA polymerases of different members of the family Flaviviridae exhibit similar properties in vitro J. Gen. Virol., October 1, 1999; 80(10): 2583 - 2590. [Abstract] [Full Text]
|
|
|
|
|
|
K. C. Leitmeyer, D. W. Vaughn, D. M. Watts, R. Salas, I. Villalobos, de Chacon, C. Ramos, and R. Rico-Hesse Dengue Virus Structural Differences That Correlate with Pathogenesis J. Virol., June 1, 1999; 73(6): 4738 - 4747. [Abstract] [Full Text]
|
|
|
|
|
|
H. Yu, C. W. Grassmann, and S.-E. Behrens Sequence and Structural Elements at the 3' Terminus of Bovine Viral Diarrhea Virus Genomic RNA: Functional Role during RNA Replication J. Virol., May 1, 1999; 73(5): 3638 - 3648. [Abstract] [Full Text]
|
|
|
|
|
|
L. Zeng, B. Falgout, and L. Markoff Identification of Specific Nucleotide Sequences within the Conserved 3'-SL in the Dengue Type 2 Virus Genome Required for Replication J. Virol., September 1, 1998; 72(9): 7510 - 7522. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 R. L. Tanguay and D. R. Gallie Isolation and Characterization of the 102-Kilodalton RNA-binding Protein That Binds to the 5' and 3' Translational Enhancers of Tobacco Mosaic Virus RNA J. Biol. Chem., June 14, 1996; 271(24): 14316 - 14322. [Abstract] [Full Text] [PDF]
|
|
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| INT J SYST EVOL MICROBIOL | MICROBIOLOGY | J GEN VIROL |
| J MED MICROBIOL | ALL SGM JOURNALS | |
