|
|
||||||||
Animal: RNA Viruses |
Department of Microbiology, Kanazawa Medical University, Uchinada, Kahoku-gun, Ishikawa 920-0293, Japan1
Author for correspondence: Takato Odagiri.Fax +81 76 286 3961. e-mail todagiri{at}kanazawa-med.ac.jp
| Abstract |
|---|
|
|
|---|
BM2 antibody specifically detected the BM2 protein with a molecular mass of 12 kDa and also a polypeptide with a molecular mass of 17 kDa. When infected cells were labelled with 32Pi and immunoprecipitated with the
BM2 antibody, the 32 P-labelled 17 kDa polypeptide was specifically precipitated. In the presence of casein kinase inhibitor CKI-7 the synthesis of the 17 kDa and BM2 proteins was completely suppressed, although other viral proteins, except for the polymerase protein, were synthesized normally. These results suggest that the 17 kDa species is a phosphorylated form of the BM2 protein. These species were substantially synthesized in the late phase of infection and localized in the cytoplasm throughout infection. Moreover, they were transported to the plasma membrane and thereafter were incorporated into virions. These results therefore suggest that the BM2 and the 17 kDa proteins are necessary for the life-cycle of influenza B virus. | Introduction |
|---|
|
|
|---|
Another major difference between influenza A and B viruses is found on RNA segment 7. Influenza A virus RNA segment 7 encodes both the membrane (matrix) protein M1, which is translated from a collinear transcript mRNA (Lamb, 1989
), and the M2 protein, which is translated from a spliced mRNA (Lamb et al., 1981
). The M2 protein, like the NB protein, shows ion channel activity, which is responsible for dissociation of the M1 protein from viral ribonucleoprotein (vRNP) during the uncoating process and for preserving the native conformation of the haemagglutinin (HA) during virion assembly (Holsinger et al., 1994
; Pinto et al., 1992
; Steinhauer et al., 1991
). Similarly, RNA segment 7 of influenza B virus encodes two proteins, M1 and BM2, by a bicistronic mRNA (Briedis et al. , 1982
; Hiebert et al., 1986
). However, the translational strategy of the BM2 protein is quite different from the bicistronic mRNA transcribed from influenza B virus RNA segment 6. In the mRNA transcribed from RNA segment 7, there is a pentanucleotide, residues 769773, in which the AUG initiation codon for the BM2 protein overlaps with the termination codon for the M1 protein (Horvath et al., 1990
). The BM2 protein is synthesized by a coupled translational stopstart mechanism at the pentanucleotide which is dependent upon the initiation and termination of the upstream M1 protein (Horvath et al., 1990
). Since the amino acid alignment in the BM2 ORF has been highly conserved for at least 39 years, from influenza B/Lee/40 virus to B/Singapore/222/79 virus (Hiebert et al., 1986
), the BM2 protein is thought to have an important role(s) in the life-cycle of influenza B virus. Although the BM2 protein (molecular mass of 12 kDa) has been identified in influenza B virus-infected cells (Horvath et al. , 1990
), its function(s) remains unknown.
In this study we developed an antiserum against the hexahistidineBM2 fusion protein expressed in Escherichia coli . Using the antiserum we show the features of the BM2 protein in cells infected with influenza B/Yamagata/1/73 virus and in the virion. In infected cells the BM2 protein was found to be phosphorylated and the product was detected as a 17 kDa polypeptide. These molecules were localized in the cytoplasm and then incorporated into virions, suggesting that they are necessary for the growth of influenza B virus.
| Methods |
|---|
|
|
|---|
Culture cells and virus.
Plasmid construction and antiserum preparation.
The full-length cDNA copy of genome RNA segment 7 of influenza B/Yamagata virus was amplified by PCR using primers 5' GCGCGCGGATCCCTTGAACCATTTCAGATTCTTTCAA and 5' GCGCGCAAGCTTTTAATGCAATTCTTCTACCTCCAAAACT. For construction of the BM2 expression vector, the PCR products containing the BM2 ORF, nucleotide residues 7711100, were inserted into the EcoRI and NheI sites in the expression vector pCAGGS/MCS (Niwa et al. , 1991
). To express the BM2 protein in mammalian cells, the resultant vector, pCAGGS/BM2, was transfected into COS-1 cells after incubation with LipofectAmine Plus reagent (Gibco BRL). For production of the hexahistidine-tagged BM2 fusion protein in E. coli , the PCR products ranging from residues 774 to 1100 and unique restriction enzyme sites were inserted into the BamHI and HindIII sites in pTrcHis A (Invitrogen). The hexahistidine-tagged BM2 protein was expressed in and purified from E. coli strain JM109 according to protocols provided by the manufacturer.
To produce antiserum specific for the BM2 protein, a rabbit was immunized with 1·0 mg of the affinity-purified hexahistidine-tagged BM2 protein in complete Freund's adjuvant, followed by three booster injections of 500 µg each in incomplete Freund's adjuvant at 2-week intervals. Similarly, the antiserum specific for nucleoprotein (NP) was made using the B/Yamagata virus NP purified from the vRNP complex (Parvin et al., 1989
) by SDSPAGE.
Virus infection and treatment with a protein kinase inhibitor.
MDCK cells grown in 8 cm2 dishes were infected with virus at an m.o.i. of 10 p.f.u. per cell and incubated at 34 °C. At various times post-infection (p.i.), the cells were lysed in 50 µl of radioimmunoprecipitation assay (RIPA) buffer (200 mM NaCl, 1% NP-40, 0·5% deoxycholate, 0·1% SDS and 50 mM TrisHCl pH 8·0) and maintained for 30 min on ice. After clarification by centrifugation, the supernatant was mixed with an equal volume of SDS sample buffer as described previously (Peluso et al., 1977
), boiled for 2 min at 95 °C and subjected to SDSPAGE as described below.
To inhibit phosphorylation of viral proteins, virus-infected cells were treated at various times p.i. with Opti-MEM I containing 200 µM CKI-7 [N-(2-aminoethyl)-5-chloro-isoquinoline-8- sulfonamide] (Seikagaku) to inhibit casein kinase I and II (Chijiwa et al., 1989
; Krantz et al., 1997
).
Metabolic labelling of mammalian cells.
32Pi-labelling of virus-infected MDCK cells was carried out by the methods described previously (Whittaker et al., 1995
). Briefly, at 7 h p.i. virus-infected cells were labelled for 3 h with phosphate-free DMEM containing 0·5 mCi/ml 32Pi (Amersham Life Science). At the end of the labelling period, cells were washed twice with PBS and lysed in RIPA buffer. For production of 32Pi-labelled virions, virus-infected cells were labelled for 2 days with phosphate-free DMEM containing 0·1 mCi/ml 32 Pi. The labelled virus in the culture medium was purified through a 3050% sucrose gradient as described previously (Odagiri et al., 1982
).
For production of 35S-labelled virions, virus-infected cells were labelled with DMEM deficient in methionine and cysteine containing 20 mM HEPES pH 7·1 with 70 µCi/ml 35S-methionine/cysteine (Amersham Life Science) and one-quarter volume of Opti-MEM I. After incubation for 2 days, the labelled virions were purified as described above.
Immunoprecipitation, SDSPAGE and Western blotting.
For immunoprecipitation, the samples, lysed in RIPA buffer, were incubated with antiserum
BM2#3,
NP,
M1 (mouse monoclonal antibody against B/Nagasaki/1/87) (Nakagawa et al., 1999
) or pre-immune normal rabbit serum (final dilution of each antibody was 1:20) at 4 °C overnight. The immune complexes were incubated with protein ASepharose for 30 min at room temperature. The samples were washed twice with washing buffer I (50 mM TrisHCl pH 8·0, 150 mM NaCl, 0·1% Triton X-100) and twice with washing buffer II (50 mM TrisHCl pH 8·0, 150 mM NaCl) before resuspension in SDSPAGE sample buffer. Proteins were analysed by SDSPAGE using a 15% polyacrylamide gel as described previously (Odagiri & Tobita, 1990
). Rainbow coloured protein molecular mass standards (Amersham Life Science) were used as markers.
For Western blot analysis, the proteins were resolved by SDSPAGE and electroblotted onto PVDF membrane (Amersham Life Science). After incubation with an antibody, the membrane was treated with horseradish peroxidase-conjugated anti-rabbit Ig and enhanced chemiluminescence (Amersham Life Science) and exposed to RX-U film (Fuji Photo).
Fractionation of purified virions.
Purified B/Yamagata/1/73 virus was fractionated by the method described previously (Odagiri & Tashiro, 1997
; Parvin et al., 1989
) with modifications. Briefly, viruses disrupted by incubation in 1·5% Triton N-101, 10 mg/ml lysolecithin, 0·1 M TrisHCl pH 8·0, 0·1 M KCl, 5 mM MgCl2, 5% glycerol and 1·5 mM DTT were subjected to a step-wise gradient consisting of 1·5 M CsCl and 30% glycerol, 2 M CsCl and 35% glycerol, 2·5 M CsCl and 40% glycerol, and 3 M CsCl and 45% glycerol containing 100 mM NaCl and 50 mM TrisHCl pH 7·6 and centrifuged for 20 h at 45000 r.p.m. in an SW55Ti rotor at 4 °C. Samples (300 µl) of the CsCl gradient were collected from the top to the bottom and pelleted by centrifugation for 120 min at 45000 r.p.m. The pellets were resuspended in 25 µl PBS and an equal volume of each fraction was subjected to SDSPAGE and detected by silver staining and Western blotting.
Indirect immunofluorescence.
MDCK cells on glass coverslips were infected with B/Yamagata virus and incubated for various periods at 34 °C. Cell monolayers were washed three times with PBS, fixed in 4% paraformaldehyde for 10 min at room temperature and permeabilized with 0·2% Triton X-100 in PBS for 2 min. After washing with PBS,
BM2#3 antibody, which had been adsorbed with lysates of uninfected MDCK cells, was added to a final dilution of 1:1000. After incubation for 60 min, the cells were washed with PBS and incubated for 30 min with FITC-conjugated goat anti-rabbit IgG (H+L) (Funakoshi) at a final dilution of 1:150. After washing with PBS, the coverslips were mounted onto glass slides and examined by fluorescence microscopy.
| Results |
|---|
|
|
|---|
|
BM2#3, was shown by Western blot and dot blot analyses to be specific for both the hexahistidineBM2 fusion protein and a synthetic peptide corresponding to amino acid residues 3857 of the BM2 ORF (data not shown).
To examine whether the
BM2#3 antibody specifically detected the BM2 protein of B/Yamagata virus, virus-infected cells were harvested at 9 h and 10 h p.i. and examined by Western blot analysis after SDSPAGE. The
BM2#3 antibody detected two polypeptides with molecular masses of about 12 kDa and 17 kDa (Fig. 1B
, lanes Y-9h and Y-10h). This antibody, however, did not react with any other viral proteins, indicating that it was specific for only those two polypeptides. Interestingly, the amount of 17 kDa species increased with the incubation period. In contrast, no specific reactants were detected in cells infected with A/WSN virus and in uninfected cells (Fig. 1B
, lanes W and M). The results indicated that these two polypeptides were encoded by B/Yamagata virus, and were not host products induced by virus infection. Since the BM2 ORF of B/Yamagata virus was shown to encode a 12·6 kDa maximum polypeptide by computer analysis, the 12 kDa polypeptide was considered to correspond to the BM2 protein of B/Yamagata virus. To demonstrate this, we constructed an expression plasmid, pCAGGS/BM2, containing the BM2 ORF of B/Yamagata virus as described in Methods and examined whether this vector expressed the 12 kDa polypeptide in transfected COS-1 cells. As expected, it expressed the 12 kDa polypeptide by 20 h post-transfection, although an unexpected band was also detected (Fig. 1B
, lane BM220h). In contrast, no specific band was detected in cells transfected with vector without the BM2 ORF (Fig. 1B
, lane Vect). Therefore, we concluded that the 12 kDa polypeptide in infected cells was the BM2 protein of B/Yamagata virus. It should be noted that when the pCAGGS/BM2-transfected cells were incubated for 30 h, a band corresponding to the 17 kDa species in addition to BM2 was also detected (Fig. 1B
, lane BM230h).
BM2 protein is synthesized in the late phase of infection
We next examined the kinetics of viral protein synthesis during the infection cycle. When MDCK cells were infected with B/Yamagata virus and pulse-labelled for 30 min at 10 h p.i. with a mixture of [ 35S]methionine and [35S]cysteine, the viral proteins, polymerase (Ps), HA, NP, nonstructural protein (NS1) and M1, were readily detected (data not shown). However, the BM2 and 17 kDa species were not detected by metabolic labelling, even when the cells were labelled for 1 h (data not shown). Therefore, the viral proteins synthesized every hour were analysed by high-sensitive Western blotting using a mixture of the
BM2#3 antibody and the
B/Yamagata antibody, which was raised to the whole virion of B/Yamagata virus. Before analysis we ensured that the kinetics of major viral protein synthesis, which were detected by Western blotting, corresponded well to that detected by the metabolic labelling and that the
B/Yamagata antibody did not interfere with the reaction between the
BM2#3 antibody and the BM2 and 17 kDa protein (data not shown). As shown in Fig. 2
, the BM2 protein was first detected 4 h p.i. and its amount gradually increased with the incubation period. Synthesis of this protein was shown to occur at least 1 h and 2 h later than that of M1 and NP proteins, respectively. The kinetics of BM2 protein synthesis appeared similar to that of HA protein, which is synthesized in the late phase of infection. On the other hand, the synthesis of the 17 kDa species occurred 6 to 7 h p.i. (Fig. 2
, lanes 6 and 7).
|
BM2#3 antibody (Fig. 3
|
|
Localization of BM2 protein in infected cells
To identify the intracellular localization of the BM2 protein throughout the infection cycle, virus-infected cells were fixed at 2 h intervals from 4 h to 10 h p.i. and examined by indirect immunofluorescence using the
BM2#3 antibody previously adsorbed with lysates of uninfected MDCK cells (Fig. 4
). At 4 h p.i., when BM2 protein became detectable in infected cells (Fig. 2
), weak fluorescent signals were observed around the nuclear membrane, where the ER/Golgi complex is known to be located (Fig. 4A
). The signals became stronger with increased incubation period and a part of the signal was shown to diffuse in the cytoplasm (Fig. 4B
). At 8 h p.i., fluorescence was localized along both the nuclear and plasma membranes and at 10 h p.i. strong signals were seen along the periphery of the plasma membrane (Fig. 4C
, D
). On the other hand, when virus-infected cells were neither fixed nor permeabilized, no specific fluorescent signal was observed, similar to uninfected cells (Fig. 4F
H
), indicating that the BM2 protein was not expressed on the cell surface. Although the
BM2#3 antibody detected both the BM2 and the 17 kDa proteins in infected cells, as shown in Fig. 1(B)
, the quantitative analysis of these polypeptides detected at 9 h p.i. by scanning of an X-ray film using the Diversity Database software (PDI, USA) indicated that the ratio of BM2 to 17 kDa protein was about 40:1. Therefore, the fluorescent signals detected in infected cells were thought to represent the BM2 protein. From these results, it was most likely that the BM2 protein was transported from the site of synthesis along the nuclear membrane to the site of virion budding on the plasma membrane, but not expressed on the cell surface. It should be emphasized that the BM2 protein was not found in the nucleus throughout infection.
|
BM2#3 antibody. In virions two 32P-labelled bands corresponding to the 17 kDa and BM2 species were detected, although the lower molecular mass species appeared as a trace amount (Fig. 5B
|
|
M1 in addition to
NP antibody. The specificity of these antisera was ensured by immunoprecipitation of 35S-labelled virions (Fig. 6C
M1 and
NP). Because the BM2 and 17 kDa species were not detected by autoradiograpy of the 35 S-labelled virion preparation (Fig. 6C
M1 antibody and only a trace amount of the BM2 protein was precipitated by the
NP antibody. These precipitates were evaluated to be less than 3·1% of the BM2 and 17 kDa species present in the intact virion (Fig. 6D
BM2#3 antibody (Fig. 6C
BM2). | Discussion |
|---|
|
|
|---|
In cells infected with B/Yamagata virus, the
BM2 antibody specifically detected two polypeptides with molecular masses of 12 kDa and 17 kDa (Fig. 1B
). Since these polypeptides were not detected in either uninfected cells or A/WSN virus-infected cells (Fig. 1B
), it was apparent that they were the viral products encoded by B/Yamagata virus. Supporting evidence was obtained with the BM2 expression vector which contained the BM2 ORF of B/Yamagata virus. It predominantly synthesized the 12 kDa species in transfected cells and additionally synthesized the 17 kDa species after a long incubation time (Fig. 1B
). These results strongly suggest that both the 12 kDa and the 17 kDa species are translated from the BM2 ORF. However, most influenza B viruses examined so far have shown a single BM2 band (Horvath et al., 1990
). It is therefore interesting to know whether our
BM2 antibody reacted with a degradation product derived from another viral protein(s) that was detected as the 17 kDa species or whether the 17 kDa species was found only with B/Yamagata virus. Since we have confirmed that other viral proteins were not detected with the
BM2 antibody (Fig. 1B
), the former possibility can be excluded. Examination using other influenza B viruses, B/Aichi/2/82 and B/Aichi/5/88, showed that our
BM2 antibody detected only a single BM2 band which had different electrophoretic mobilities (unpublished data), consistent with the previous observation that the mobility of the BM2 protein was variable among virus strains (Horvath et al., 1990
). Therefore, the 17 kDa species was a product specific for B/Yamagata virus.
To obtain further information regarding the origin of the 17 kDa species, we analysed the nucleotide sequences of B/Yamagata virus RNA segment 7. As reported with B/Lee virus (Briedis et al. , 1982
), there are two ORFs in this segment (Fig. 1A
). The M1 protein is believed to be translated from nucleotide residues 25769 in the +0 frame (Lamb & Krug, 1996
). If a small number of polypeptides was additionally translated from the second and third AUG codons located at residues 280 and 331, respectively, in the +0 frame, the deduced molecular mass of the polypeptides should be 17·8 kDa and 16·0 kDa. However, the amino acid identity of these polypeptides to the BM2 protein was less than 15% and no cluster matched to the amino acid alignment of BM2 was found, indicating that the 17 kDa species was not translated from the +0 frame. On the other hand, the second ORF, nucleotide residues 5131100, in the +2 frame, has a capacity to encode a 195 amino acid polypeptide with a molecular mass of 22·4 kDa. If translation occurred from upstream of the 771AUG initiator codon, the resultant product should possess the same antigenicity as part of the BM2 protein. However, there is no AUG codon between residues 513 and 771. Similarly, there is no GUG triplet, which is known to be used as an initiator codon about one-thirtieth as frequently as the AUG initiator codon in E. coli (Kozak, 1983
), in the upstream region. Consequently, consistent with the observation with the BM2 expression vector, the 17 kDa species was thought to be a product translated from the BM2 ORF, but not a product additionally translated from upstream in the +2 ORF independent of the BM2 protein. This conclusion is also sustained by the result that the synthesis of 17 kDa protein was coupled with that of BM2 protein, because their synthesis did not occur in the presence of a protein kinase inhibitor, CKI-7, when added from the early phase of infection, although other viral proteins except for Ps were normally synthesized (Fig. 3B
).
The NP and M1 proteins of influenza A virus have been shown to occur in two forms both in the infected cells and in the virion, dependent on the difference in phosphorylation residues (Zhirnov & Bukrinskaya, 1981
; Almond & Felsenreich, 1982
; Gregoriades et al., 1984
). The BM2 protein of B/Yamagata virus may be similar, because it contains three motifs for casein kinase II-mediated phosphorylation and one motif for protein kinase C-mediated phosphorylation (Hardie, 1993
; Table 1
). In fact, the 32P-labelled 17 kDa species was detected both in infected cells and in virions (Figs 3A
and 5B
). Similarly, the 32P-labelled BM2 band, in extremely low levels, was also detected in virions, although it was not definitely detected in infected cells (Fig. 5B
). These results may imply that the number and the site of phosphorylated residues are different between the 17 kDa and the BM2 proteins. The precise phosphorylation site(s) in the BM2 molecule remain to be identified.
Synthesis of the BM2 protein of B/Yamagata virus occurred at least 1 h later than that of the M1 protein and was substantial in the late stage of virus infection (Fig. 2
). It has been shown that BM2 protein synthesis is highly controlled by the termination of the upstream M1 protein synthesis (Horvath et al., 1990
). This was confirmed by our expression vector, which contained both the M1 ORF and the BM2 ORF of B/Yamagata virus, in that maximum synthesis of the BM2 protein was delayed until at least 6 h after that of the M1 protein (unpublished data). Taken together, these findings strongly suggest that the BM2 protein mainly functions in the late stage of virus infection. In the viral proteins acting in the late phase of infection, the M1 and the nuclear export protein of influenza A virus have been well characterized. These proteins accumulate in the nucleus and regulate the nucleocytoplasmic transport of the vRNP by direct or indirect binding with the vRNP (Enami et al., 1993
; Martin & Helenius, 1991
; Neumann et al., 1997
; O'Neill et al., 1998
; Ye et al., 1989
; Ward et al., 1995
; Yasuda et al., 1993
). In contrast, the BM2 protein was not detected in the nucleus throughout infection (Fig. 4
). This is consistent with the fact that the BM2 protein did not contain a conventional nuclear localization signal (NLS) like the classical mono and bipartite NLS as found with simian virus 40 T antigen and nucleoplasmin (Nigg, 1997
) or the NLS motifs found with the influenza A virus NP protein (Wang et al., 1997
). Consequently, it is clear that the BM2 protein did not contribute to the processes occurring in the nucleus, i.e. transcription and replication of virus genome RNA and nuclear export of vRNP.
It was demonstrated that B/Yamagata virions contained both the BM2 and the 17 kDa proteins (Fig. 5
). It was also deduced from the immunofluorescence study that in the late phase of infection the BM2 protein was transported to the virion budding site on the plasma membrane (Fig. 4
). However, it is unlikely that the packaging of the BM2 and the 17 kDa proteins was caused by direct association with other viral protein(s) in the cytoplasm. By the fractionation and immunoprecipitation of virion with the antibodies to NP, M1 and BM2 proteins, we could not precisely identify a viral protein which firmly bound to the BM2 protein, although a small amount of the BM2 protein coprecipitated with the M1 and NP (Fig. 6
). Similarly, no BM2-interactive viral protein was identified by a proteinprotein interaction assay using the GSTBM2 fusion protein and the yeast two-hybrid system (unpublished data). Presumably, the BM2 and the 17 kDa proteins may move to the virion budding site independently of other viral protein(s) and thereafter be incorporated into virions as free molecules.
The role of the BM2 protein in the life-cycle of influenza B virus is not known at present. However, a number of the BM2 molecules were phosphorylated to become the 17 kDa species and these species were present in virions. Although no counterpart to these species has been found so far in influenza A virus, analysis of the function of the BM2 protein and the role of phosphorylation of the BM2 protein should be clarified for understanding and possible identification of such protein(s) in influenza A virus.
| Acknowledgments |
|---|
| Footnotes |
|---|
| References |
|---|
|
|
|---|
Betakova, T. , Nermut, M. V. & Hay, A. J. (1996). The NB protein is an integral component of the membrane of influenza B virus. Journal of General Virology 77, 2689-2694 .
Brassard, D. L. , Leser, G. P. & Lamb, R. A. (1996). Influenza B virus NB glycoprotein is a component of the virion. Virology 220, 350-360.[Medline]
Briedis, D. J. , Lamb, R. A. & Choppin, P. W. (1982). Sequence of RNA segment 7 of the influenza B virus genome: partial amino acid identity between the membrane proteins (M1) of influenza A and B viruses and conservation of a second open reading frame. Virology 116, 581-588.[Medline]
Chijiwa, T. , Hagiwara, M. & Hidaka, H. (1989). A newly synthesized selective casein kinase I inhibitor, N-(2-aminoethyl)-5-chloroisoquinoline-8- sulfonamide, and affinity purification of casein kinase I from bovine testis. Journal of Biological Chemistry 264, 4924-4927 .
Enami, K. , Qiao, Y. , Fukuda, R. & Enami, M. (1993). An influenza virus temperature- sensitive mutant defective in the nuclearcytoplasmic transport of the negative-sense viral RNAs. Virology 194, 822-827.[Medline]
Gregoriades, A. , Christie, T. & Markarian, K. (1984). The membrane (M1) protein of influenza virus occurs in two forms and is a phosphoprotein. Journal of Virology 49, 229-235.
Hardie, D. G. (1993). Protein Phosphorylation: A Practical Approach, 1st edn. Edited by D. G. Hardie. Oxford: Oxford University Press.
Hiebert, S. W. , Williams, M. A. & Lamb, R. A. (1986). Nucleotide sequence of RNA segment 7 of influenza B/Singapore/222/79: maintenance of a second large open reading frame. Virology 155, 747-751.[Medline]
Holsinger, L. J. , Nichani, D. , Pinto, L. H. & Lamb, R. A. (1994). Influenza A virus M2 ion channel protein: a structurefunction analysis. Journal of Virology 68, 1551-1563 .
Horvath, C. M. , Williams, M. A. & Lamb, R. A. (1990). Eukaryotic coupled translation of tandem cistrons: identification of the influenza B virus BM2 polypeptide. EMBO Journal 9, 2639-2647.[Medline]
Kozak, M. (1983). Comparison of initiation of protein synthesis in procaryotes, eucaryotes, and organelles. Microbiological Review 47, 1-45.
Krantz, D. E. , Peter, D. , Liu, Y. & Edwards, R. H. (1997). Phosphorylation of a vesicular monoamine transporter by casein kinase II. Journal of Biological Chemistry 272, 6752-6759 .
Lamb, R. A. (1989). The influenza viruses. In Genes and Proteins of the Influenza Viruses, pp. 1-87. Edited by R. M. Krug. NY: Plenum Press.
Lamb, R. A. & Krug, R. M. (1996). Orthomyxoviridae: the viruses and their replication. Fields Virology, 3rd edn, pp. 13531395. Edited by B. N. Fields, D. M. Knipe & P. M. Howley. Philadelphia & New York: LippincottRaven.
Lamb, R. A. , Lai, C. J. & Choppin, P. W. (1981). Sequences of mRNAs derived from genome RNA segment 7 of influenza virus: colinear and interrupted mRNAs code for overlapping proteins. Proceedings of the National Academy of Sciences, USA 78, 4170-4174 .
Martin, K. & Helenius, A. (1991). Nuclear transport of influenza virus ribonucleoproteins: the viral matrix protein (M1) promotes export and inhibits import. Cell 67, 117-130.[Medline]
Nakagawa, N. , Maeda, A. , Kase, T. , Kubota, R. & Okuno, Y. (1999). Rapid detection and identification of two lineages of influenza B strains with monoclonal antibodies. Journal of Virological Methods 79, 113-120.[Medline]
Neumann, G. , Castrucci, M. R. & Kawaoka, Y. (1997). Nuclear import and export of influenza virus nucleoprotein. Journal of Virology 71, 9690-9700 .[Abstract]
Nigg, E. A. (1997). Nucleocytoplasmic transport: signals, mechanisms and regulation. Nature 386, 779-787.[Medline]
Niwa, H. , Yamamura, K. & Miyazaki, J. (1991). Efficient selection for high- expression transfectants with a novel eukaryotic vector. Gene 108, 193-199.[Medline]
Odagiri, T. & Tashiro, M. (1997). Segment-specific noncoding sequences of the influenza virus genome RNA are involved in the specific competition between defective interfering RNA and its progenitor RNA segment at the virion assembly step. Journal of Virology 71, 2138-2145 .[Abstract]
Odagiri, T. & Tobita, K. (1990). Mutation in NS2, a nonstructural protein of influenza A virus, extragenically causes aberrant replication and expression of the PA gene and leads to generation of defective interfering particles. Proceedings of the National Academy of Sciences, USA 87, 5988-5992 .
Odagiri, T. , DeBorde, D. C. & Maassab, H. F. (1982). Cold-adapted recombinants of influenza A virus in MDCK cells. I. Development and characterization of A/Ann Arbor/6/60xA/Alaska/6/77 recombinant viruses. Virology 119, 82-95.[Medline]
O'Neill, R. E. , Talon, J. & Palese, P. (1998). The influenza virus NEP (NS2 protein) mediates the nuclear export of viral ribonucleoproteins. EMBO Journal 17, 288-296.[Medline]
Parvin, J. D. , Palese, P. , Honda, A. , Ishihama, A. & Krystal, M. (1989). Promoter analysis of influenza virus RNA polymerase. Journal of Virology 63, 5142-5152 .
Peluso, R. W. , Lamb, R. A. & Choppin, P. W. (1977). Polypeptide synthesis in simian virus 5-infected cells. Journal of Virology 23, 177-187.
Pinto, L. H. , Holsinger, L. J. & Lamb, R. A. (1992). Influenza virus M2 protein has ion channel activity. Cell 69, 517-528.[Medline]
Shaw, M. W. , Choppin, P. W. & Lamb, R. A. (1983). A previously unrecognized influenza B virus glycoprotein from a bicistronic mRNA that also encodes the viral neuraminidase. Proceedings of the National Academy of Sciences, USA 80, 4879-4883 .
Steinhauer, D. A. , Wharton, S. A. , Skehel, J. J. , Wiley, D. C. & Hay, A. J. (1991). Amantadine selection of a mutant influenza virus containing an acid-stable hemagglutinin glycoprotein: evidence for virus-specific regulation of the pH of glycoprotein transport vesicles. Proceedings of the National Academy of Sciences, USA 88, 11525-11529 .
Sunstrom, N. A. , Premkumar, L. S. , Premkumar, A. , Ewart, G. , Cox, G. B. & Gage, P. W. (1996). Ion channels formed by NB, an influenza B virus protein. Journal of Membrane Biology 150, 127-132.[Medline]
Wang, P. , Palese, P. & O'Neill, R. E. (1997). The NPI-1/NPI- 3 (karyopherin alpha) binding site on the influenza A virus nucleoprotein NP is a nonconventional nuclear localization signal. Journal of Virology 71, 1850-1856 .[Abstract]
Ward, A. C. , Castelli, L. A. , Lucantoni, A. C. , White, J. F. , Azad, A. A. & Macreadie, I. G. (1995). Expression and analysis of the NS2 protein of influenza A virus. Archives of Virology 140, 2067-2073 .[Medline]
Whittaker, G. , Kemler, I. & Helenius, A. (1995). Hyperphosphorylation of mutant influenza virus matrix protein, M1, causes its retention in the nucleus. Journal of Virology 69, 439-445.[Abstract]
Williams, M. A. & Lamb, R. A. (1989). Effect of mutations and deletions in a bicistronic mRNA on the synthesis of influenza B virus NB and NA glycoproteins. Journal of Virology 63, 28-35.
Yasuda, J. , Nakada, S. , Kato, A. , Toyoda, T. & Ishihama, A. (1993). Molecular assembly of influenza virus: association of the NS2 protein with virion matrix. Virology 196, 249-255.[Medline]
Ye, Z. , Baylor, N. W. & Wagner, R. R. (1989). Transcription- inhibition and RNA-binding domains of influenza A virus matrix protein mapped with anti-idiotypic antibodies and synthetic peptides. Journal of Virology 63, 3586-3594 .
Zhirnov, O. P. & Bukrinskaya, A. G. (1981). Two forms of influenza virus nucleoprotein in infected cells and virions. Virology 109, 174-179.[Medline]
Received 16 March 1999;
accepted 29 June 1999.
This article has been cited by other articles:
![]() |
K. Otomo, A. Toyama, T. Miura, and H. Takeuchi Interactions Between Histidine and Tryptophan Residues in the BM2 Proton Channel from Influenza B Virus J. Biochem., April 1, 2009; 145(4): 543 - 554. [Abstract] [Full Text] [PDF] |
||||
![]() |
V. Balannik, R. A. Lamb, and L. H. Pinto The Oligomeric State of the Active BM2 Ion Channel Protein of Influenza B Virus J. Biol. Chem., February 22, 2008; 283(8): 4895 - 4904. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Imai, K. Kawasaki, and T. Odagiri Cytoplasmic Domain of Influenza B Virus BM2 Protein Plays Critical Roles in Production of Infectious Virus J. Virol., January 15, 2008; 82(2): 728 - 739. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Imai, S. Watanabe, A. Ninomiya, M. Obuchi, and T. Odagiri Influenza B Virus BM2 Protein Is a Crucial Component for Incorporation of Viral Ribonucleoprotein Complex into Virions during Virus Assembly J. Virol., October 15, 2004; 78(20): 11007 - 11015. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Hatta, H. Goto, and Y. Kawaoka Influenza B Virus Requires BM2 Protein for Replication J. Virol., June 1, 2004; 78(11): 5576 - 5583. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Watanabe, M. Imai, Y. Ohara, and T. Odagiri Influenza B Virus BM2 Protein Is Transported through the trans-Golgi Network as an Integral Membrane Protein J. Virol., October 1, 2003; 77(19): 10630 - 10637. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. Hoffmann, K. Mahmood, C.-F. Yang, R. G. Webster, H. B. Greenberg, and G. Kemble Rescue of influenza B virus from eight plasmids PNAS, August 20, 2002; 99(17): 11411 - 11416. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| INT J SYST EVOL MICROBIOL | MICROBIOLOGY | J GEN VIROL |
| J MED MICROBIOL | ALL SGM JOURNALS | |