J Gen Virol Tips for Better Browsing
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via CrossRef
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Kim, H.-S.
Right arrow Articles by Crow, T. J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Kim, H.-S.
Right arrow Articles by Crow, T. J.
Agricola
Right arrow Articles by Kim, H.-S.
Right arrow Articles by Crow, T. J.
Journal of General Virology (1999), 80, 2613-2619.
© 1999 Society for General Microbiology


Animal: RNA Viruses

Isolation and phylogeny of endogenous retrovirus sequences belonging to the HERV-W family in primates

Heui-Soo Kim1, Osamu Takenaka2 and Timothy J. Crow1

POWIC, Department of Psychiatry, Warneford Hospital, University of Oxford, Oxford OX3 7JX, UK1
Department of Cellular and Molecular Biology, Primate Research Institute, Kyoto University, Inuyama, Aichi 484, Japan 2

Author for correspondence: Timothy J. Crow.Fax +44 1865 244990. e-mail tim.crow{at}psychiatry.oxford.ac.uk


   Abstract
TOP
Abstract
Introduction
Methods
Results and Discussion
References
 
An investigation was undertaken of primate pol gene sequences from a novel endogenous retrovirus family, ERV-W, related to a new human endogenous retrovirus family (HERV-W) that includes multiple sclerosis-associated retrovirus (MSRV) sequences identified in particles recovered from monocyte cultures from patients with multiple sclerosis. The pol gene sequences of the ERV-W family were detected in hominoids and Old World monkeys, but not in New World monkeys, whereas ERV-W long terminal repeat-like elements were detected in all primates (hominoids, Old World monkeys and New World monkeys). Thirty-two pol gene sequences from hominoids and Old World monkeys showed a high degree of sequence identity to MSRV and other HERV-W sequences. Phylogenetic analysis indicated close relationships of pol gene sequences across primate species. The analysis suggests that the ERV-W family has evolved independently but in constrained patterns (`parallel evolution') in different primate species, including man. The ratio of synonymous to non- synonymous substitutions indicated that negative selective pressure is acting on CHW1-1 from chimpanzee, HBW6-6 from baboon and HWX5 from man, sequences that have no disruption by point mutation or insertions/deletions. Therefore, these pol gene sequences could be associated with an active provirus in primates. The findings indicate that the ERV-W family has continued to evolve in the course of the primate radiation and may include members with a capacity to influence gene function and possibly cause disease.


   Introduction
TOP
Abstract
Introduction
Methods
Results and Discussion
References
 
The potential of retroviruses as agents of genomic change and as pathogens became apparent with the discovery of the activity of the enzyme reverse transcriptase by Baltimore (1970)Down and Temin & Mizutani (1970)Down . Approximately 1% of the human genome is represented by human endogenous retroviruses (HERVs) and a much larger proportion by long and short interspersed nucleotide elements (LINE, SINE), some of which have evolved from retrovirus sequences (Sverdlov, 1998Down ). Full-length retrovirus sequences may interact with cellular oncogenes (Varmus, 1982Down ) and retrovirus long terminal repeat (LTR) sequences have the capacity to exert a regulatory influence as promoters and enhancers of cellular genes.

Pathogenic influences of retroviruses may occur as a result of exogenous infection, as in the case of human immunodeficiency virus, but may also occur from activation of endogenous elements as in the case of mouse mammary tumour virus and murine leukaemia virus. Such models in the mouse raise the possibility that endogenous sequences play a role in human disease. A series of different types of HERV has been described (Martin et al., 1981Down ; Mager & Henthorn, 1984Down ; Steele et al., 1986Down ) and classified as HERV-H, HERV-R, ERV-9 and HERV-K on the basis of their homologies (Löwer et al., 1996Down ). In general, there are homologues of these viruses in non-human primates and each class is likely to have a different evolutionary origin (Steinhuber et al., 1995Down ; Zs íros et al., 1998Down ). In the great majority of cases, the sequences are defective, although in a number of instances expression has been detected, e.g. HERV-E in placenta and various tumour cell lines, HERV- H, HERV-K and ERV-9 in teratocarcinoma cell lines and HERV-K in testicular tumours and at low levels in placenta and some normal tissues (for review see Löwer et al. , 1996Down ).

A retrovirus superantigen has been suggested as a candidate autoimmune gene in type I diabetes (Conrad et al., 1997Down ; although see Lan et al., 1998Down ; L öwer et al., 1998Down ; Murphy et al., 1998Down ), and a general role for endogenous viral proteins in the aetiology of autoimmune disease has been discussed (Perron & Seigneurin, 1999Down ). Retroviral particles have been recovered from monocyte cultures from patients with multiple sclerosis (Perron et al., 1997Down ) and virion-associated RNA of multiple sclerosis-associated retrovirus (MSRV) has been reported in serum of patients with the disease (Garson et al., 1998Down ). Expression of MSRV sequences in normal placenta allowed the reconstruction of a 7·6 kb putative genomic retroviral RNA with RU5–gagpolenv–U3R organization, with a polypurine- binding site (PBS) showing similarity with avian retrovirus PBS used by tRNATrp (Blond et al., 1999Down ). This new family of endogenous retrovirus sequences has been named HERV-W. The gag and pol open reading frames (ORFs) were interrupted by frame-shifts and stop codons, whereas a complete ORF encoding an envelope was found. Homologies within the pol and env genes with murine type C and simian type D retroviruses, respectively, suggest a chimeric genome structure. In terms of its phylogenetic relationships, the HERV-W family is considered to be related to the ERV-9 and RTLV-H families and to belong to endogenous retrovirus class 1 (Boeke & Stoye, 1997Down ). From the sequence divergence of 3' and 5' LTRs, an integration event has been estimated at approximately 6 million years ago (Blond et al., 1999Down ).

The HERV-W family may have relevance to the MSRV particles associated with multiple sclerosis, with which the genomic mRNA sequences so far described share 82–88% identity (Blond et al. , 1999Down ). The possibility that they have relevance to other neuropsychiatric conditions is raised by the finding of sequences homologous to HERV-W in a representational difference analysis of DNA from monozygotic twins discordant for schizophrenia (Deb et al. , 1998Down ), for which an endogenous retrovirus aetiology has previously been proposed (Crow, 1984Down ). Our objective is to identify endogenous virus sequences that have relevance to psychotic illness (including schizophrenia). We hypothesize that, if such sequences have a pathogenic role, they will have been subject to change in recent primate evolution and will be associated with variations between individuals and with gene expression. Here, we report an investigation of endogenous retrovirus W family (ERV-W) from hominoids, Old World monkeys and New World monkeys.


   Methods
TOP
Abstract
Introduction
Methods
Results and Discussion
References
 
{blacksquare} Sample DNA and PCR.
DNA was isolated from heparinized blood samples following a standard protocol (Sambrook et al., 1989Down ) from the following species: the hominoid primates chimpanzee (Pan troglodytes ), gorilla (Gorilla gorilla), orangutan (Pongo pygmaeus) and agile gibbon (Hylobates agilis); the Old World monkeys Japanese monkey (Macaca fuscata), hamadryas baboon (Papio hamadryas), rhesus monkey (Macaca mulatta ) and African green monkey (Cercopithecus aethiops); and the New World monkeys squirrel monkey (Saimiri sciureus), night monkey (Aotus trivirgatus) and common marmoset (Callithrix jacchus). The genomic DNA samples were subjected to PCR amplification. New pol genes of the ERV-W family were amplified by the primer pair HS43 (5' GGCTCTATTACTTGAAGAGCC 3', bases 1679–1699) and DS12 (5' CTAATGGCTTCCTGATGGTTG 3', bases 2129–2149) from MSRV (GenBank accession no. AF009668). ERV-W LTR elements were amplified by the primer pair HS47 (5' TGGTCCATGTTTCTTACGGCT 3', bases 127–147) and DS16 (5' AAGATGGTGGTGAACCACTTC 3', bases 521–541) from HERV-W (GenBank accession no. AF072500). The PCR conditions were those of Kim et al. (1996)Down with an annealing temperature of 58 °C.

{blacksquare} Cloning of PCR products.
PCR products were separated on a 1·8% agarose gel, purified with the QIAEX II gel extraction kit (Qiagen) and cloned into the T- khs307 vector (Kim et al., 1998Down ). The cloned DNA was isolated by the alkaline lysis method by using the High Pure plasmid isolation kit (Boehringer Mannheim).

{blacksquare} DNA sequencing and data analyses.
Individual plasmid DNAs were screened for inserts by PCR. Positive samples were subjected to sequence analyses on both strands with T7 and M13 reverse primers by using an automated DNA sequencer (model 373A) and the Dye Deoxy terminator kit (Applied Biosystems). DNA and deduced amino acid sequence analyses were performed by using the GAP, TRANSLATE, PILEUP and PRETTY programs from the GCG software (Genetics Computer Group, University of Wisconsin). The extents of synonymous and non-synonymous divergence were calculated by the method of Li et al. (1985)Down . A correction for superimposed substitutions at single sites was made by the two-parameter method of Kimura (1980)Down . The neighbour-joining phylogenetic analysis (Saitou & Nei, 1987Down ) was performed with the MEGA program (Kumar et al., 1993Down ). Statistical significance evaluation of the branching pattern was performed with 100 replications. DNA sequences of the HERV-W family were retrieved from the GenBank database with the aid of the BLAST network server (Altschul et al., 1997Down ).

{blacksquare} Nucleotide sequence accession numbers.
The accession numbers of HERV-W sequences from human were obtained from the GenBank database by using the BLAST network server (Altschul et al., 1997Down ): MSRV (AF009668), HWX1 (AB021919), HWX3 (AB021920), HWX5 (AB021921), Pi5T (AF072502), 7A16 (AF072501), 45I4 (AL023581), B353C18 (AC004066), B153K6 (AC005187), U134E6 (Z83850), Q11M15 (AF045450), RG083M05 (AC000064) and BAC378 (U85196).


   Results and Discussion
TOP
Abstract
Introduction
Methods
Results and Discussion
References
 
Identification and phylogeny of the HERV-W family
We identified 32 pol gene sequences belonging to the ERV-W family from hominoid primates and Old World monkeys by using a PCR approach. The PCR products gave single bands on agarose gels (see Fig. 3Down). Five colonies from chimpanzee, five from gorilla, six from orangutan, eight from gibbon, two from Japanese monkey and six from baboon were identified as ERV-W sequences when 15 colonies from the cloned products were selected randomly from each species. These sequences are thus likely to represent a larger number in each of these primate species. The ERV-W pol gene sequences from primates had approximately 70% sequence identity to ERV-9 (La Mantia et al., 1991Down ) and were analysed phylogenetically with those of the HERV-W family, MSRV and related sequences (B153K6, B353C18, Q11M15, U134E6, BAC378, RG083M05, 45I4, 7A16, Pi5T, HWX1, HWX3 and HWX5) identified from the GenBank database ( Fig. 1Down). We used the pol gene sequence of ERV-9 as an outgroup.



View larger version (27K):
[in this window]
[in a new window]
 
Fig. 3. PCR analysis of genomic DNA for the presence of the pol gene of the HERV-W family in primates. Lane M, marker ({phi}X174/HaeIII); 1, chimpanzee; 2, gorilla; 3, orangutan; 4, gibbon; 5, Japanese monkey; 6, hamadryas baboon; 7, rhesus monkey; 8, African green monkey; 9, squirrel monkey; 10, night monkey; and 11, common marmoset.

 



View larger version (59K):
[in this window]
[in a new window]
 
Fig. 1. Phylogenetic tree for the pol genes of the ERV-W family in primates obtained by the neighbour-joining method. Species names are abbreviated as follows: CHW, chimpanzee; GOW, gorilla; ORW, orangutan; GIW, gibbon; JMW, Japanese monkey; HBW, hamadryas baboon. The same nomenclature is used in Tables 1 and 2 and Fig. 2Down. Branch lengths are proportional to the distances between the taxa. The values at branch-points indicate the percentage support for a particular node after 100 bootstrap replicates. ERV-9 was used as the outgroup.

 
The salient feature of the phylogeny in Fig. 1Up is that the HERV-W pol sequences form a dense network that is clearly separated from the ERV-9 outgroup but which shows close relationships between sequences that are present in different primate species. Thus, clone GIW4-4 from gibbon is closely related to HWX1 and HWX3, which were identified from the human X chromosome in a previous study (H.-S. Kim & T. J. Crow, unpublished results), MSRV is classified with clone HBW6-2 from baboon and clone GIW4-3 from gibbon, and human clone B153K6 is grouped with CHW1-2 and CHW1-4 from chimpanzee and GOW2-2 and GOW2-3 from gorilla, while the other human clone, Q11M15, is closely related to GIW4-6 from gibbon. Some pairs of neighbouring sequences have come from the same primate (e.g. HWX1 and HWX3 from human, CHW1-2 and CHIW1-4 from chimpanzee and GOW2-2 and GOW2- 3 from gorilla, and RG083M05 is related by 1 bp deletion to PI5T), but the general pattern is one of a spread of sequences that crosses primate species boundaries. The scatter of sequence relationships suggests that some of the separations between branches are old and that, within branches, the ERV-W family has continued to evolve independently in the different primate species, including humans.

Sequence analysis and synonymous/non-synonymous substitutions
Among 32 pol gene sequences of ERV-W from primates, no disruption by point mutations or insertions/deletions that inactivated the ORF by a frame-shift or termination codon appeared in six sequences, CHW1-1 from chimpanzee, GOW2-1 from gorilla, GIW4-1 and GIW4- 2 from gibbon and HBW6-5 and HBW6-6 from baboon, whereas the sequences of each of the clones identified from the pol gene of Japanese monkey and the orangutan were disrupted by several point mutations or insertions/deletions. This kind of phenomenon has been found in other HERV sequences, e.g. HC2, HC2-10, HC2-16, pCRTK1 and pCRTK6 (Haltmeier et al., 1995Down ; Kabá t et al., 1996Down ; Kim & Crow, 1999Down ). We aligned the amino acid sequences of pol genes of ERV-W from the uninterrupted primate clones with human clones (HWX5, MSRV, Q11M15, RG083M05 and BAC378) (Fig. 2Up). They had 87–92% sequence identity with humans. Amongst primates, 88–92% sequence identity has been shown (Table 1Down). Notable substitutions were seen at positions 5 and 68. The variation at position 5 includes a cysteine residue; this is likely to have functional significance. Synonymous and non-synonymous substitutions within the pol gene of the HERV-W family in humans and primates were analysed to discover the evolutionary forces at work. As shown in Table 2Down, the mean synonymous substitutions (K s) ranged from 3·3 to 12·1%, whereas mean non- synonymous substitutions (Ka) ranged from 5·5 to 11·7%, and the value of Ka/Ks ranged from 0·67 to 2·38. In terms of the Ka/Ks ratio, 62% showed higher values for non-synonymous substitutions than for synonymous substitutions in each of the comparisons. We suggest that the sequences of CHW1-1 from chimpanzee, HBW6-6 from baboon and HWX5 from the human X chromosome are under negative selective pressure, since at least 70% of Ka/Ks values in pairwise comparisons were <1·0. These pol gene sequences could therefore be associated with an active provirus in primates.


View this table:
[in this window]
[in a new window]
 
Table 1. Percentage identity of 142-amino-acid sequences of pol fragments

 

View this table:
[in this window]
[in a new window]
 
Table 2. Synonymous and non-synonymous substitutions in pol fragments

 
Evolution of the HERV-W family
The pol gene sequences of the HERV-W family were detected in hominoids and Old World monkeys, but not in New World monkeys, by PCR amplification (Fig. 3Up). HERV-K and S71 sequences have also been detected in hominoids and Old World monkeys, but not in New World monkeys, by Southern blot with conserved regions of the pol or env genes as probes or by PCR analyses of such regions (Brack- Werner et al., 1989Down ; Zhu et al., 1994Down ; Steinhuber et al., 1995Down ). With the S71 HERV-K LTR probe, strong hybridizing bands were detected in DNA from the orangutan but not in DNA from the marmoset. Therefore, it was suggested that HERV-K LTRs have inserted in the primate genome after the split of New World monkeys in the Oligocene era, approximately 33 million years ago (Leib-Mösch et al. , 1993Down ). However, we found HERV-K LTR-like elements in New World monkeys (squirrel monkey and night monkey) by a PCR approach (Kim et al., 1999bDown ). Likewise, HERV-W LTR- like elements were detected in all primates, including hominoids, Old and New World monkeys, as examined by PCR (Fig. 4Down). This finding suggests that HERV-W LTR-like elements exist in humans and other primates, as has already been shown for HERV-K and HERV-H LTRs, although detailed mapping of the HERV-W genome is required to establish this.



View larger version (43K):
[in this window]
[in a new window]
 
Fig. 4. PCR analysis of genomic DNA for the presence of LTR- like elements of the HERV-W family in primates. Lane 1, human; 2, chimpanzee; 3, gorilla; 4, orangutan; 5, gibbon; 6, Japanese monkey; 7, hamadryas baboon; 8, rhesus monkey; 9, African green monkey; 10, squirrel monkey; 11, night monkey; and 12, common marmoset.

 
An endogenous retrovirus element, ERV-9, of low repeat number has been integrated after the split of orangutan from the great apes, but before the divergence of the gorilla lineage, according to library screening and PCR analysis (Di Cristofano et al., 1995Down ). As shown in Fig. 5Down, other HERV families, HC2 (Kim et al., 1999dDown ), HERV-R (Cohen & Larsson, 1988Down ), the HERV-H pol gene (Mager & Freeman, 1995Down ) and HERV-H LTR types Ia and II (Anderssen et al., 1997Down ), have been found in hominoids, Old World monkeys and New World monkeys, whereas HERV-H LTR type I has been found in the even-earlier prosimians by using a PCR approach (Anderssen et al., 1997Down ). A retroposon, SINE-R.C2, has been shown to be a human-specific retroposon by Southern blot analysis (Zhu et al., 1994Down ), and some HERV-K LTR elements (e.g. AC002350, AC002400 and AC002508) have been identified as human-specific by PCR and phylogenetic analyses (Medstrand & Mager, 1998Down ), whereas by PCR analysis, SINE-R-type retroposons have been shown to be hominoid-specific (Kim et al., 1999aDown , cDown ).



View larger version (16K):
[in this window]
[in a new window]
 
Fig. 5. Evolutionary tree for the putative integration times of endogenous retroviruses/retroposons in primates. The branching times of the phylogeny should be considered as approximate, and the tree was modified from Steinhuber et al. (1995)Down , Anderssen et al. (1997)Down and Medstrand & Mager (1998)Down .

 
Implications for human disease
LTR elements are implicated in various diseases. For example, a solitary LTR element (DQ-LTR3) of the HERV-K family at the HLA-DQB1 locus has been associated with rheumatoid arthritis (Seidl et al. , 1999Down ). An element described as almost identical to SINE-R.C2 that is derived from the HERV-K LTR element is a cause of Fukuyama-type muscular dystrophy (Kobayashi et al., 1998Down ). Interestingly, HERV-L LTRs bind host-cell nuclear proteins and have the potential to activate neighbouring genes (Akopov et al., 1998Down ). An HERV-K LTR element has inserted in the antisense orientation between the gag and pol genes of the human endogenous retrovirus S71 and has also been found to be co-expressed with cellular sequences (Leib-Mösch et al., 1993Down ). Recently, it has been demonstrated that solitary LTR elements are still being amplified in the human and chimpanzee genomes (Medstrand & Mager, 1998Down ). They are an agent of genome change and a potential source of genetic variation associated with disease. HERV-W was originally found from patients with multiple sclerosis (Perron et al., 1997Down ). A virion-associated MSRV RNA has been detected in serum of patients with the disease (Garson et al., 1998Down ). We consider that the evidence we have presented for activity in the course of primate evolution justifies further investigation of HERV-W sequences as potential pathogens. The next stage in such an investigation will be to identify genome locations of such putative virogenes.

In summary, 32 members of a novel ERV-W family were identified from hominoids and Old World monkeys by PCR amplification. In their pol genes, they showed a high degree of sequence identity to the HERV- W family. In six sequences, CHW1-1 from chimpanzee, GOW2-1 from gorilla, GIW4-1 and GIW4-2 from gibbon and HBW6-5 and HBW6-6 from baboon, as in MSRV and HWX5, there was no disruption of the pol gene by point mutation or insertions/deletions. Phylogenetic analysis by the neighbour-joining method of nucleotide sequences of pol fragments of the ERV-W family from humans and primates showed that MSRV is closely related to GIW4-3 and HBW6-2, suggesting that the ERV-W family has evolved independently in a number of different branches in humans and primates. The ratio of synonymous to non-synonymous substitutions showed that negative selection is acting on CHW1-1, HBW6- 6 and HWX5. This suggests that these sequences may represent an active provirus in primates. Our study of the ERV-W family during primate evolution contributes to the understanding of their biological roles in primate genomes.


   Acknowledgments
 
We thank Rekha V. Wadekar for her technical assistance. This work was supported by grants from the UK Medical Research Council and the Stanley Foundation.


   Footnotes
 
The DDBJ/EMBL/GenBank accession numbers of the ERV-W sequences determined in this study are AB024457AB024461 (chimpanzee), AB024462AB024466 (gorilla), AB024467AB024472 (orangutan), AB024473AB024480 (gibbon), AB024481AB024482 (Japanese monkey) and AB024483AB024488 (hamadryas baboon).


   References
TOP
Abstract
Introduction
Methods
Results and Discussion
References
 
Akopov, S. B. , Nikolaev, L. G. , Khil, P. P. , Lebedev, Y. B. & Sverdlov, E. D. (1998). Long terminal repeats of human endogenous retrovirus K family (HERV-K) specifically bind host cell nuclear proteins. FEBS Letters 421, 229-233.[Medline]

Altschul, S. F. , Madden, T. L. , Schäffer, A. A. , Zhang, J. , Zhang, Z. , Miller, W. & Lipman, D. J. (1997). Gapped BLAST and PSI- BLAST: a new generation of protein database search programs. Nucleic Acids Research 25, 3389-3402 .[Abstract/Free Full Text]

Anderssen, S. , Sjøttem, E. , Svineng, G. & Johansen, T. (1997). Comparative analyses of LTRs of the ERV-H family of primate-specific retrovirus-like elements isolated from marmoset, African green monkey, and man. Virology 234, 14-30.[Medline]

Baltimore, D. (1970). RNA-dependent DNA polymerase in virions of RNA tumour viruses. Nature 226, 1209-1211 .[Medline]

Blond, J.-L. , Beseme, F. , Duret, L. , Bouton, O. , Bedin, F. , Perron, H. , Mandrand, B. & Mallet, F. (1999). Molecular characterization and placental expression of HERV-W, a new human endogenous retrovirus family. Journal of Virology 73, 1175-1185 .[Abstract/Free Full Text]

Boeke, J. D. & Stoye, J. P. (1997). Retrotransposons, endogenous retroviruses, and the evolution of retroelements. In Retroviruses, pp. 343-435. Edited by J. M. Coffin, S. H. Hughes & H. E. Varmus. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory.

Brack-Werner, R. , Barton, D. E. , Werner, T. , Foellmer, B. E. , Leib-Mösch, C. , Francke, U. , Erfle, V. & Hehlmann, R. (1989). Human SSAV-related endogenous retroviral element: LTR-like sequence and chromosomal localization to 18q21. Genomics 4, 68-75.[Medline]

Cohen, M. & Larsson, E. (1988). Human endogenous retroviruses. Bioessays 9, 191-196.[Medline]

Conrad, B. , Weissmahr, R. N. , Boni, J. , Arcari, R. , Schupbach, J. & Mach, B. (1997). A human endogenous retroviral superantigen as candidate autoimmune gene in type I diabetes. Cell 90, 303-313.[Medline]

Crow, T. J. (1984). A re-evaluation of the viral hypothesis: is psychosis the result of retroviral integration at a site close to the cerebral dominance gene? British Journal of Psychiatry 145, 243-253.[Abstract/Free Full Text]

Deb, P., Klempan, T. A., O'Reilly, R. L., Torrey, E. F. & Singh, S. M. (1998). Studies on MS-related sequences identified by amplicon-based RDA from affected members of monozygotic twin pairs discordant for schizophrenia. Abstract from Fourth Annual Stanley Foundation Symposium on the Neurovirology and Neuroimmunology of Schizophrenia and Bipolar Disorder. Washington, DC, USA.

Di Cristofano, A. , Strazzullo, M. , Parisi, T. & La Mantia, G. (1995). Mobilization of an ERV9 human endogenous retroviral element during primate evolution. Virology 213, 271-275.[Medline]

Garson, J. A. , Tuke, P. W. , Giraud, P. , Paranhos-Baccala, G. & Perron, H. (1998). Detection of virion-associated MSRV- RNA in serum of patients with multiple sclerosis. Lancet 351, 33.[Medline]

Haltmeier, M. , Seifarth, W. , Blusch, J. , Erfle, V. , Hehlmann, R. & Leib-Mösch, C. (1995). Identification of S71-related human endogenous retroviral sequences with full-length pol genes. Virology 209, 550-560.[Medline]

Kabát, P. , Tristem, M. , Opavsky, R. & Pastorek, J. (1996). Human endogenous retrovirus HC2 is a new member of the S71 retroviral subgroup with a full-length pol gene. Virology 226, 83-94.[Medline]

Kim, H.-S. & Crow, T. J. (1999). Isolation of novel human endogenous retrovirus HC2-like elements in human chromosomes. AIDS Research and Human Retroviruses 15, 299-302.[Medline]

Kim, H.-S. , Hirai, H. & Takenaka, O. (1996). Molecular features of the TSPY gene of gibbons and Old World monkeys. Chromosome Research 4, 500-506.[Medline]

Kim, H.-S. , Chen, Y. & Lonai, P. (1998). Complex regulation of multiple cytohesin-like genes in murine tissues and cells. FEBS Letters 433, 312-316.[Medline]

Kim, H.-S. , Takenaka, O. & Crow, T. J. (1999a). Cloning and nucleotide sequence of retroposons specific to hominoid primates derived from an endogenous retrovirus (HERV-K). AIDS Research and Human Retroviruses 15, 595 -601.[Medline]

Kim, H.-S., Wadekar, R. V., Takenaka, O., Hyun, B.-H. & Crow, T. J. (1999b). Phylogenetic analysis of HERV-K LTR-like elements in primates: presence in some New World monkeys and evidence of recent parallel evolution in these species and in Homo sapiens. Archives of Virology (in press).

Kim, H.-S., Wadekar, R. V., Takenaka, O., Winstanley, C., Mitsunaga, F., Kageyama, T., Hyun, B.-H. & Crow, T. J. (1999c). SINE-R.C2 (a Homo sapiens specific retroposon) is homologous to cDNA from post-mortem brain in schizophrenia and to two loci in the Xq21·3/Yp block linked to handedness and psychosis. American Journal of Medical Genetics (Neuropsychiatric Genetics) (in press).

Kim, H.-S., Takenaka, O. & Crow, T. J. (1999d). Identification of human endogenous retrovirus HC2-like elements in primates. Folia Primatologica (in press).

Kimura, M. (1980). A simple method for estimating evolutionary rates of base substitutions through comparative studies of nucleotide sequences. Journal of Molecular Evolution 16, 111-120.[Medline]

Kobayashi, K. , Nakahori, Y. , Miyake, M. , Matsumura, K. , Kondo-lida, E. , Nomura, Y. , Segawa, M. , Yoshioka, M. , Saito, K. , Osawa, M. , Hamano, K. , Sakakihara, Y. , Nonaka, I. , Nakagome, Y. , Kanazawa, I. , Nakamura, Y. , Tokunaga, K. & Toda, T. (1998). An ancient retrotransposal insertion causes Fukuyama-type congenital muscular dystrophy. Nature 394, 388-392.[Medline]

Kumar, S., Tamura, K. & Nei, M. (1993). MEGA: molecular evolutionary genetics analysis, version 1.01. Pennsylvania State University, University Park, PA 16802, USA.

La Mantia, G. , Maglione, D. , Pengue, G. , Di Cristofano, A. , Simeone, A. , Lanfrancone, L. & Lania, L. (1991). Identification and characterization of novel human endogenous retroviral sequences preferentially expressed in undifferentiated embryonal carcinoma cells. Nucleic Acids Research 19, 1513-1520 .[Abstract/Free Full Text]

Lan, M. S. , Mason, A. , Coutant, R. , Chen, Q. Y. , Vargas, A. , Rao, J. S. , Gomez, R. , Chalew, S. , Garry, R. & Maclaren, N. K. (1998). HERV-K10s and immune- mediated (type 1) diabetes. Cell 95, 14-16.[Medline]

Leib-Mösch, C. , Haltmeier, M. , Werner, T. , Geigl, E.-M. , Brack-Werner, R. , Francke, U. , Erfle, V. & Hehlmann, R. (1993). Genomic distribution and transcription of solitary HERV-K LTRs. Genomics 18, 261-269.[Medline]

Li, W.-H. , Wu, C.-I. & Luo, C.-C. (1985). A new method for estimating synonymous and nonsynonymous rates of nucleotide substitution considering the relative likelihood of nucleotide and codon changes. Molecular Biology and Evolution 2, 150-174.[Abstract]

Löwer, R. , Löwer, J. & Kurth, R. (1996). The viruses in all of us: characteristics and biological significance of human endogenous retrovirus sequences. Proceedings of the National Academy of Sciences, USA 93, 5177-5184 .[Abstract/Free Full Text]

Löwer, R. , Tonjes, R. R. , Boller, K. , Denner, J. , Kaiser, B. , Phelps, R. C. , Löwer, J. , Kurth, R. , Badenhoop, K. , Donner, H. , Usadel, K. H. , Miethke, T. , Lapatschek, M. & Wagner, H. (1998). Development of insulin-dependent diabetes mellitus does not depend on specific expression of the human endogenous retrovirus HERV-K. Cell 95, 11-14.[Medline]

Mager, D. L. & Freeman, J. D. (1995). HERV-H endogenous retroviruses: presence in the New World branch but amplification in the Old World primate lineage. Virology 213, 395-404.[Medline]

Mager, D. L. & Henthorn, P. S. (1984). Identification of a retrovirus-like repetitive element in human DNA. Proceedings of the National Academy of Sciences, USA 81, 7510-7514 .[Abstract/Free Full Text]

Martin, M. A. , Bryan, T. , Rasheed, S. & Khan, A. S. (1981). Identification and cloning of endogenous retroviral sequences present in human DNA. Proceedings of the National Academy of Sciences, USA 78, 4892-4896 .[Abstract/Free Full Text]

Medstrand, P. & Mager, D. L. (1998). Human-specific integrations of the HERV-K endogenous retrovirus family. Journal of Virology 72, 9782-9787 .[Abstract/Free Full Text]

Murphy, V. J. , Harrison, L. C. , Rudert, W. A. , Luppi, P. , Trucco, M. , Fierabracci, A. , Biro, P. A. & Bottazzo, G. F. (1998). Retroviral superantigens and type 1 diabetes mellitus. Cell 95, 9-11.[Medline]

Perron, H. & Seigneurin, J. M. (1999). Human retroviral sequences associated with extracellular particles in auto-immune diseases: epiphenomenon or possible role in aetiopathogenesis? Microbes and Infection (in press).

Perron, H. , Firouzi, R. , Tuke, P. , Garson, J. A. , Michel, M. , Beseme, F. , Bedin, F. , Mallet, F. , Marcel, E. , Seigneurin, J. M. & Mandrand, B. (1997). Cell cultures and associated retroviruses in multiple sclerosis. Collaborative Research Group on MS. Acta Neurologica Scandinavica Supplementum 169, 22-31.[Medline]

Saitou, N. & Nei, M. (1987). The neighbor-joining method: a new method for reconstructing phylogenetic trees. Molecular Biology and Evolution 4, 406-425.[Abstract]

Sambrook, J., Fritsch, E. F. & Maniatis, T. (1989). Molecular Cloning: A Laboratory Manual, 2nd edn. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory .

Seidl, C. , Donner, H. , Petershofen, E. , Usadel, K. H. , Seifried, E. , Kaltwasser, J. P. & Badenhoop, K. (1999). An endogenous retroviral long terminal repeat at the HLA-DQB1 gene locus confers susceptibility to rheumatoid arthritis. Human Immunology 60, 63-68.[Medline]

Steele, P. E. , Martin, M. A. , Rabson, A. B. , Bryan, T. & O'Brien, S. J. (1986). Amplification and chromosomal dispersion of human endogenous retroviral sequences. Journal of Virology 59, 545-550.[Abstract/Free Full Text]

Steinhuber, S. , Brack, M. , Hunsmann, G. , Schwelberger, H. , Dierich, M. P. & Vogetseder, W. (1995). Distribution of human endogenous retrovirus HERV-K genomes in humans and different primates. Human Genetics 96, 188-192.[Medline]

Sverdlov, E. D. (1998). Perpetually mobile footprints of ancient infections in the human genome. FEBS Letters 428, 1-6.[Medline]

Temin, H. M. & Mizutani, S. (1970). RNA-dependent DNA polymerase in virions of Rous sarcoma virus. Nature 226, 1211-1213 .[Medline]

Varmus, H. E. (1982). Form and function of retroviral proviruses. Science 216, 812-820.[Abstract/Free Full Text]

Zhu, Z.-B. , Jian, B. & Volanakis, J. E. (1994). Ancestry of SINE- R.C2 a human-specific retroposon. Human Genetics 93, 545-551.[Medline]

Zsíros, J. , Jebbink, M. F. , Lukashov, V. V. , Voûte, P. A. & Berkhout, B. (1998). Evolutionary relationships within a subgroup of HERV-K-related human endogenous retroviruses. Journal of General Virology 79, 61-70.[Abstract]

Received 8 April 1999; accepted 15 June 1999.


This article has been cited by other articles:


Home page
J. Virol.Home page
S. Ohkura, M. W. Yap, T. Sheldon, and J. P. Stoye
All Three Variable Regions of the TRIM5{alpha} B30.2 Domain Can Contribute to the Specificity of Retrovirus Restriction.
J. Virol., September 1, 2006; 80(17): 8554 - 8565.
[Abstract] [Full Text] [PDF]


Home page
J HeredHome page
M. Caceres, NISC Comparative Sequencing Program, and J. W. Thomas
The Gene of Retroviral Origin Syncytin 1 is Specific to Hominoids and is Inactive in Old World Monkeys
J. Hered., March 1, 2006; 97(2): 100 - 106.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
B. Song, B. Gold, C. O'hUigin, H. Javanbakht, X. Li, M. Stremlau, C. Winkler, M. Dean, and J. Sodroski
The B30.2(SPRY) Domain of the Retroviral Restriction Factor TRIM5{alpha} Exhibits Lineage-Specific Length and Sequence Variation in Primates
J. Virol., May 15, 2005; 79(10): 6111 - 6121.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
B. Song, H. Javanbakht, M. Perron, D. H. Park, M. Stremlau, and J. Sodroski
Retrovirus Restriction by TRIM5{alpha} Variants from Old World and New World Primates
J. Virol., April 1, 2005; 79(7): 3930 - 3937.
[Abstract] [Full Text] [PDF]


Home page
Mol Biol EvolHome page
B. Bonnaud, O. Bouton, G. Oriol, V. Cheynet, L. Duret, and F. Mallet
Evidence of Selection on the Domesticated ERVWE1 env Retroviral Element Involved in Placentation
Mol. Biol. Evol., October 1, 2004; 21(10): 1895 - 1901.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
R. R. Tonjes and M. Niebert
Relative Age of Proviral Porcine Endogenous Retrovirus Sequences in Sus scrofa Based on the Molecular Clock Hypothesis
J. Virol., November 15, 2003; 77(22): 12363 - 12368.
[Abstract] [Full Text] [PDF]


Home page
Mol. Pathol.Home page
P N Nelson, P R Carnegie, J Martin, H Davari Ejtehadi, P Hooley, D Roden, S Rowland-Jones, P Warren, J Astley, and P G Murray
Demystified . . . Human endogenous retroviruses
Mol. Pathol., February 1, 2003; 56(1): 11 - 18.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
D. Lavillette, M. Marin, A. Ruggieri, F. Mallet, F.-L. Cosset, and D. Kabat
The Envelope Glycoprotein of Human Endogenous Retrovirus Type W Uses a Divergent Family of Amino Acid Transporters/Cell Surface Receptors
J. Virol., June 5, 2002; 76(13): 6442 - 6452.
[Abstract] [Full Text] [PDF]


Home page
Mol Biol EvolHome page
J. Costas
Characterization of the Intragenomic Spread of the Human Endogenous Retrovirus Family HERV-W
Mol. Biol. Evol., April 1, 2002; 19(4): 526 - 533.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via CrossRef
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Kim, H.-S.
Right arrow Articles by Crow, T. J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Kim, H.-S.
Right arrow Articles by Crow, T. J.
Agricola
Right arrow Articles by Kim, H.-S.
Right arrow Articles by Crow, T. J.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
INT J SYST EVOL MICROBIOL MICROBIOLOGY J GEN VIROL
J MED MICROBIOL ALL SGM JOURNALS