|
|
||||||||
Animal: RNA Viruses |
Virology Unit, Department of Infectious Diseases and Immunology, Faculty of Veterinary Medicine, Utrecht University, Yalelaan 1, 3584 CL Utrecht, The Netherlands1
Department of Human Retrovirology, Academic Medical Centre, Amsterdam, The Netherlands2
Author for correspondence: Thomas Vahlenkamp. Present address: Institute of Virology, Faculty of Veterinary Medicine, University of Leipzig, An den Tierkliniken 29, D-04103 Leipzig, Germany. Fax +49 341 9738219. e-mail vahlen{at}rz.uni-leipzig.de
| Abstract |
|---|
|
|
|---|
| Introduction |
|---|
|
|
|---|
The envelope glycoprotein plays a key role in the initial viruscell interaction, although other virus proteins may also be involved. The tropism of FIV for CRFK cells has been shown to be affected by the third variable (V3) region of the surface glycoprotein, SU (Siebelink et al., 1995
; Verschoor et al. , 1995
), and by the ectodomain of the transmembrane (TM) glycoprotein (Vahlenkamp et al., 1997
). The V3 region also contains a linear neutralization domain (de Ronde et al., 1994
; Lombardi et al., 1993
). FIV was shown to use CXCR4 for cell fusion and the V3 region was found to be involved in the interaction (Willett et al. , 1997a
, b
). Although having a different sequence, the V3 region of the viral envelope protein of HIV-1 is also important for tropism, cytopathicity and virus neutralization and is involved in the interaction with CCR5 and CXCR4, the main co-receptors used by the macrophage-tropic and T cell-tropic HIV-1 isolates (Cao et al. , 1993
; Deng et al., 1996
; Dragic et al., 1996
; Feng et al., 1996
; Levy, 1993
; Wain-Hobson, 1996
; Wild et al., 1993
).
Macrophages play an important role in the immune system as antigen- presenting cells (Beebe et al., 1994
; Bendinelli et al., 1995
; Levy, 1993
) and they are probably also involved in FIV pathogenesis by harbouring the virus and contributing to its dissemination in the organism. Only a few studies have addressed macrophage tropism (Beebe et al., 1994
; Brunner & Pedersen, 1989
; Power et al., 1998
); FIV was shown to be present in peritoneal macrophages of cats infected with FIV strain Petaluma for 618 months. Cultures of peritoneal macrophages were found to be susceptible to infection with this strain, which had been propagated on CRFK cells (Brunner & Pedersen, 1989
). By using in situ hybridization, Beebe et al. (1994
) showed that the dominant cell type that was infected shifted from T lymphocytes to macrophages during the onset of primary disease. The shift might be due to cytopathic infection of T lymphocytes with subsequent selection of macrophage-tropic variants (Beebe et al., 1994
)).
In an attempt to identify determinants of macrophage tropism, we focused on the FIV envelope glycoprotein. Chimeric infectious molecular clones derived from peripheral blood mononuclear cells (PBMC)-tropic and macrophage-tropic viruses were constructed and progeny virus was examined for replication kinetics in macrophages and PBMC in vitro . The V3 and V4 regions of the FIV SU glycoprotein were indeed found to possess determinants involved in macrophage tropism. In order to get an impression of the phenotype of virus variants present in a persistently viraemic, experimentally infected healthy cat, we constructed infectious molecular clones by using envelope gene sequences derived directly from tissues of different body compartments. By using this approach, the tropism of variants present in vivo can be determined without introducing possible errors due to in vitro selection. Viruses derived from these clones were tested for their ability to replicate in feline PBMC, bone marrow-derived macrophages, primary astrocytes and CRFK cells. Our results indicate that dual tropism for PBMC and macrophages is a common feature of FIV variants present in vivo.
| Methods |
|---|
|
|
|---|
Cell culture.
Tissues and virus isolates.
Virus isolates were obtained from the cerebrospinal fluid (CSF) and PBMC of a naturally FIV-infected cat that showed signs of central nervous system involvement by co-cultivation of uninfected feline PBMC. The virus isolates obtained (FIV-UT48), derived from the CSF and PBMC, were stored at -80 °C. Both virus isolates were used to infect feline PBMC and proviral DNA was isolated by using the method described by Boom et al. (1990
).
Tissues [bone marrow, brain (cortex, cerebellum), lymph node (mandibularis)] and PBMC were obtained from an experimentally FIV-UT48- infected cat (no. 330). The cat was infected and kept under specified- pathogen-free conditions for more than 6 years, but did not show any clinical symptoms. Proviral DNA was isolated from the tissues and PBMC by using the method described by Boom et al. (1990
).
Amplification and cloning of envelope gene sequences.
Gene sequences encoding the FIV envelope glycoprotein were amplified by using primers with flanking 5' MluI (ACGCGT) and 3' SalI (GTCGAC) restriction sites (underlined). Primer 217 consisted of the nucleotide sequence 5' TAGACGCGTAAGATTTTTAAGATACTCTGATG 3' (nt 65126543; Talbott et al., 1989
) and primer 259 consisted of the sequence 5' CTTGTCGAC TAAGTCTGAGATACTTCATCATTCCTCC 3' (nt 88618825). PCR was performed for 35 cycles by using the Expand Long Template reaction mixture (Boehringer Mannheim). Each cycle consisted of 1 min at 94 °C, 1 min at 55 °C and 2·5 min at 68 °C. The 50 µl reaction mixture contained 100 ng cellular DNA, 100 ng of each primer, 50 mM TrisHCl (pH 9·2), 1·75 mM MgCl 2, 14 mM (NH4)2SO4, 200 µM of each deoxynucleoside triphosphate and 0·75 µl of the enzyme mixture. Amplification products were analysed on a 1% agarose gel, purified from the gel by using a QIAquick kit (Qiagen) and digested with the restriction enzymes Mlu I and SalI. After preparative gel electrophoresis, the purified amplification products were cloned into pPETENV. This vector is basically identical to Pet-14 (Olmsted et al., 1989
) but lacks flanking DNA sequences. In addition, pPETENV contains unique MluI and SalI restriction sites to allow selective exchange of envelope gene sequences (Verschoor et al., 1995
).
Exchange of envelope gene fragments.
To construct envelope-chimeric clones, the MluISalI fragments were first cloned into vector pSH, a derivative of pSP73 containing MluI and SalI cloning sites (Verschoor et al., 1995
). Construction of chimeric clones 27/8 and 8/27 was performed by exchanging the Mlu INsiI (1293 bp) and NsiISal I (1045 bp) fragments between the parent clones 8 and 27. The resultant chimeric MluISalI fragments were subsequently cloned into pPETENV. Sequence analysis confirmed that the fragment exchanges were performed correctly. Exchange of the V3V4 region was performed similarly, except that the Xba INsiI (602 bp) fragments were exchanged between the parent clones 8 and 27, resulting in clones 8/27/8 and 27/8/27 (Fig. 1
). Sequence analysis of the V3V4 region was performed by generating PCR fragments of the clones by using the primers T7-273 (5' TAATACGACTCACTATAGGG ACCTAATCAAACATGTATGTGG 3'; T7 sequence in italics; FIV-specific part from nt 72657286) and SP6-NsiI (5' ATTTAGGTGACACTATAGCTTTTGTCATATTGAAATGTAC 3'; SP6 sequence in italics; FIV-specific part from nt 78277806). The PCR fragments were sequenced by using SP6 and T7 Taq dye primers (Applied Biosystems) and the ThermoSequenase fluorescence-labelled primer cycle- sequencing kit (Amersham). The sequence products were analysed on an automatic DNA sequencer (model 377; Applied Biosystems). The sequences were aligned manually. Phylogenetic analysis of the V3V4 regions of the clones was performed by the neighbour-joining method of the TREECON program (Van de Peer & De Wachter, 1994
) rooted at the FIV-Petaluma sequence. The distance matrix was generated by Kimura's two-parameter estimation (Kimura, 1980
). Bootstrap analysis was done after 100 replicates.
|
Transfection and infection experiments.| Results |
|---|
|
|
|---|
|
Progeny of clone 8/27/8 [MluIXbaI (602 bp) and NsiISalI fragments (1045 bp) derived from clone 8 and XbaINsi I fragment (691 bp) derived from clone 27] showed the same replication kinetics as virus from the parent clone, 27. Virus derived from the corresponding clone 27/8/27 showed the same phenotype as virus derived from the parent clone, 8 (Fig. 2
). These results indicated that the envelope gene sequence encoding the V3V4 region is involved in macrophage tropism of FIV.
Sequence analysis of the envelope gene fragment
The MluISalI DNA fragments of clone 27 (lymphotropic and macrophage tropic), 8 (lymphotropic with an impaired capacity to replicate in macrophages) and 46 were sequenced and the deduced amino acid sequences were analysed. Clone 46, which was derived from the CSF, was included because progeny virus replicated only in PBMC. Exchange of envelope fragments derived from this clone did not result in replication competent viruses, however. The amino acid sequences encoded by the XbaINsiI fragments are shown in Fig. 3
. The amino acid changes between clone 27 and clone 8 present within the V3 and V4 regions were lysine to arginine (K
R) at position 395, aspartic acid to glutamic acid (D
E) at position 409, isoleucine to valine (I
V) at position 413, proline to leucine (P
L) at position 423, serine to threonine (S
T) at position 429, asparagine to threonine (N
T) at position 448, phenylalanine to leucine (F
L) at position 452 and lysine to glutamic acid (K
E) at position 478. When comparing clone 46 with clone 8, two amino acid changes were observed within the V3 region: arginine to lysine (R
K) and glycine to arginine (G
R) at positions 395 and 397, respectively. The P
L change at position 423 resulted in the appearance of a potential N- glycosylation site in clones 8 and 46. The T
N change at position 448, introducing an additional potential N-glycosylation site, was present in both clones 27 and 46.
|
|
| Discussion |
|---|
|
|
|---|
The exclusively lymphotropic clone 46 contains potential N- glycosylation sites at both positions 422 and 448, suggesting that glycosylation at position 422 does not favour entry into macrophages. In HIV-1, glycosylation in the V3 region is involved in the binding of neutralizing antibodies, is lost upon prolonged culture in a T cell line and is related to the non-syncytium-inducing (NSI) versus syncytium-inducing (SI) character of the virus isolate; all this suggests a role in HIV-1 entry (Back et al., 1994
). Our lymphotropic clone, 46, also contained a glycine to arginine mutation at position 397, which adds a positively charged amino acid to the V3 region. Within the V3 region of HIV-1, basic amino acid substitutions or a loss of acidic amino acids are correlated with the T cell-tropic phenotype (Chesebro et al., 1992
; De Jong et al., 1992
; Fouchier et al., 1992
; Shioda et al., 1994
; Simmonds et al., 1991
). The overall charge of the V3 region in clone 46 may influence the interaction between the V3 region and a cellular receptor.
The V3 region of the SU envelope glycoprotein and the ectodomain of the TM envelope glycoprotein of FIV have previously been shown to contain virus determinants for CRFK cell tropism (Siebelink et al. , 1995
; Vahlenkamp et al., 1997
; Verschoor et al., 1995
). These cell culture- adapted strains of FIV use the chemokine receptor CXCR4 for cell fusion (Willett et al., 1997a
, b
, 1998
, Poeschla & Looney, 1998
). The same chemokine receptor is used by T cell line-adapted SI HIV-1 strains, while NSI macrophage- tropic strains make use of the chemokine receptor CCR5 as second receptor (Deng et al., 1996
; Dragic et al. , 1996
; Feng et al., 1996
). However, the relationship between receptor usage and virus strains seems to be complex, and several dual-tropic strains of HIV-1 have been described (Doranz et al., 1996
; Simmons et al., 1996
).
Our genotypically and phenotypically characterized FIV clones will be useful in the search for additional receptors and in elucidating the mechanisms involved in the broader cell tropism of FIV. The identification of determinants important for macrophage tropism in the V3 and V4 regions indicates evolutionary links between the basic entry mechanisms of FIV and HIV-1. By comparing virus and cellular determinants involved in cell tropism of FIV and HIV-1, factors responsible for the similar pathogenesis of the two lentivirus infections may be identified.
The limited or absent capacity of clones 8 and 46 to replicate in macrophages could have been the result of their previous propagation in and adaptation to PBMC. To exclude this factor as a reason for the absence of macrophage tropism, we decided to clone envelope genes directly from tissues of an infected cat by PCR. We constructed 15 infectious molecular clones with envelope genes derived directly from cat tissues (bone marrow, brain, lymph node) and PBMC.
All viruses containing the envelope gene sequences from PBMC, lymph node and bone marrow replicated in macrophages and PBMC. However, progeny of two (of five) clones derived from the brain showed a different phenotype: they replicated in PBMC only.
The amino acid sequences of the V3V4 region differed between all clones analysed. These clones are likely to differ at positions in the remainder of the envelope as well, which does not allow a direct comparison as could be done between the envelope chimeras of clones 27 and 8 (Fig. 1
). By comparing all V3V4 sequences, including clones 27, 8 and 46 from the first set of experiments, we could not identify amino acid positions or potential glycosylation sites in the V3V4 region that were specific for the exclusively lymphotropic phenotype. This suggests that, rather than an individual amino acid, the conformation of the whole envelope protein and in particular of the V3V4 region is responsible, as evidenced by the chimeric clones 8 and 27.
Although unlikely, we cannot exclude PCR errors as the explanation for the absence of macrophage tropism. The phenotypes of these two clones are probably derived from variants with a tropism for cells of the central nervous system. None of the 15 clones replicated in primary feline astrocyte cultures or CRFK cells. For primary HIV-1 isolates and laboratory strains, tropism for macrophages and microglial cells is highly overlapping (Watkins et al., 1990
), but differences in tropism for microglial cells and macrophages have also been reported for some primary isolates (Strizki et al., 1996
). Our non-macrophage-tropic clones obtained from the brain may therefore represent variants that preferentially infect microglial cells and not macrophages. Interestingly, the envelope gene of the exclusively lymphotropic clone 46 was derived from the CSF isolate of FIV-UT48.
Our observations indicate that, within the FIV quasispecies, variants occur that are exclusively lymphotropic, as also shown in Fig. 4
. The V3V4 region of the envelope glycoprotein contains determinants that influence this difference in cellular tropism. Most variants, however, are dual-tropic and infect both lymphocytes and macrophages.
|
| Acknowledgments |
|---|
| References |
|---|
|
|
|---|
Back, N. K. , Smit, L. , De Jong, J. J. , Keulen, W. , Schutten, M. , Goudsmit, J. & Tersmette, M. (1994). An N-glycan within the human immunodeficiency virus type 1 gp120 V3 loop affects virus neutralization. Virology 199, 431-438.[Medline]
Beebe, A. M. , Dua, N. , Faith, T. G. , Moore, P. F. , Pedersen, N. C. & Dandekar, S. (1994). Primary stage of feline immunodeficiency virus infection: viral dissemination and cellular targets. Journal of Virology 68, 3080-3091 .
Bendinelli, M. , Pistello, M. , Lombardi, S. , Poli, A. , Garzelli, C. , Matteucci, D. , Ceccherini-Nelli, L. , Malvaldi, G. & Tozzini, F. (1995). Feline immunodeficiency virus: an interesting model for AIDS studies and an important cat pathogen. Clinical Microbiological Reviews 8, 87-112.
Boom, R. , Sol, C. J. A. , Salimans, M. M. M. , Jansen, C. L. , Wertheim-van Dillen, P. M. E. & van der Noordaa, J. A. (1990). Rapid and simple method for purification of nucleic acids. Journal of Clinical Microbiology 28, 495-503.
Brunner, D. & Pedersen, N. C. (1989). Infection of peritoneal macrophages in vitro and in vivo with feline immunodeficiency virus. Journal of Virology 63, 5483-5488 .
Cao, J. , Bergeron, L. , Helseth, E. , Thali, M. , Repke, H. & Sodroski, J. (1993). Effects of amino acid changes in the extracellular domain of the human immunodeficiency virus type 1 gp41 envelope glycoprotein. Journal of Virology 67, 2747-2755 .
Chesebro, B. , Wehrly, K. , Nishio, J. & Perryman, S. (1992). Macrophage-tropic human immunodeficiency virus isolates from different patients exhibit unusual V3 envelope sequence homogeneity in comparison with T-cell-tropic isolates: definition of critical amino acids involved in cell tropism. Journal of Virology 66, 6547-6554 .
Daniel, S. L. , Legendre, A. M. , Moore, R. N. & Rouse, B. T. (1993). Isolation and functional studies on feline bone marrow derived macrophages. Veterinary Immunology and Immunopathology 36, 107-122.[Medline]
Dean, G. A. , Reubel, G. H. , Moore, P. F. & Pedersen, N. C. (1996). Proviral burden and infection kinetics of feline immunodeficiency virus in lymphocyte subsets of blood and lymph node. Journal of Virology 70, 5165-5169 .
De Jong, J. J. , De Ronde, A. , Keulen, W. , Tersmette, M. & Goudsmit, J. (1992). Minimal requirements for the human immunodeficiency virus type 1 V3 domain to support the syncytium- inducing phenotype: analysis by single amino acid substitution. Journal of Virology 66, 6777-6780 .
Deng, H. , Liu, R. , Ellmeier, W. , Choe, S. , Unutmaz, D. , Burkhart, M. , Di Marzio, P. , Marmon, S. , Sutton, R. E. , Hill, C. M. , Davis, C. B. , Peiper, S. C. , Schall, T. J. , Littman, D. R. & Landau, N. R. (1996). Identification of a major co-receptor for primary isolates of HIV-1. Nature 381, 661-666.[Medline]
de Ronde, A. , Stam, J. G. , Boers, P. , Langedijk, H. , Meloen, R. , Hesselink, W. , Keldermans, C. E. J. M. , van Vliet, A. L. W. , Verschoor, E. J. , Horzinek, M. C. & Egberink, H. F. (1994). Antibody response in cats to the envelope proteins of feline immunodeficiency virus: identification of an immunodominant neutralization domain. Virology 198, 257-264.[Medline]
Doranz, B. J. , Rucker, J. , Yi, Y. , Smythz, R. J. , Samson, M. , Peiper, S. C. , Parmentier, M. , Collman, R. G. & Doms, R. W. (1996). A dual-tropic primary HIV-1 isolate that uses fusin and the beta-chemokine receptors CKR-5, CKR-3, and CKR-2b as fusion cofactors. Cell 85, 1149-1158 .[Medline]
Dow, S. W. , Dreitz, M. J. & Hoover, E. A. (1992). Feline immunodeficiency virus neurotropism: evidence that astrocytes and microglia are the primary target cells. Veterinary Immunology and Immunopathology 35, 23-35.[Medline]
Dragic, T. , Litwin, V. , Allaway, G. P. , Martin, S. R. , Huang, Y. , Nagashima, K. A. , Cayanan, C. , Maddon, P. J. , Koup, R. A. , Moore, J. P. & Paxton, W. A. (1996). HIV-1 entry into CD4 + cells is mediated by the chemokine receptor CC-CKR-5. Nature 381, 667-673.[Medline]
English, R. V. , Johnson, C. M. , Gebhard, D. H. & Tompkins, M. B. (1993). In vivo lymphocyte tropism of feline immunodeficiency virus. Journal of Virology 67, 5175-5186 .
Feng, Y. , Broder, C. C. , Kennedy, P. E. & Berger, E. A. (1996). HIV-1 entry cofactor: functional cDNA cloning of a seven-transmembrane, G protein-coupled receptor. Science 272, 872-877.[Abstract]
Fouchier, R. A. M. , Groenink, M. , Kootstra, N. A. , Tersmette, M. , Huisman, H. G. , Miedema, F. & Schuitemaker, H. (1992). Phenotype-associated sequence variation in the third variable domain of the human immunodeficiency virus type 1 gp120 molecule. Journal of Virology 66, 3183-3187 .
Kimura, M. (1980). A simple method for estimating evolutionary rates of base substitutions through comparative studies of nucleotide sequences. Journal of Molecular Evolution 16, 111-120.[Medline]
Levy, J. A. (1993). Pathogenesis of human immunodeficiency virus infection. Microbiological Reviews 57, 183-289.
Lombardi, S. , Garzelli, C. , La Rosa, C. , Zaccaro, L. , Specter, S. , Malvaldi, G. , Tozzini, F. , Esposito, F. & Bendinelli, M. (1993). Identification of a linear neutralization site within the third variable region of feline immunodeficiency virus envelope. Journal of Virology 67, 4742-4749 .
Miyazawa, T. , Furuya, T. , Itagaki, S. I. , Tohya, Y. , Nakano, K. , Takahashi, E. & Mikami, T. (1989). Preliminary comparisons of the biological properties of two strains of feline immunodeficiency virus (FIV) isolated in Japan with FIV Petaluma strain isolated in the United States. Archives of Virology 108, 59-68.[Medline]
Nishimura, Y. , Nakamura, S. , Goto, N. , Hasegawa, T. , Pang, H. , Goto, Y. , Kato, H. , Youn, H. Y. , Endo, Y. , Mizuno, T. , Momoi, Y. , Ohno, K. , Watari, T. , Tsujimoto, H. & Hasegawa, A. (1996). Molecular characterization of feline immunodeficiency virus genome obtained directly from organs of a naturally infected cat with marked neurological symptoms and encephalitis. Archives of Virology 141, 1933-1948 .[Medline]
Olmsted, R. A. , Barnes, A. K. , Yamamoto, J. K. , Hirsch, V. M. , Purcell, R. H. & Johnson, P. R. (1989). Molecular cloning of feline immunodeficiency virus. Proceedings of the National Academy of Sciences, USA 86, 2448-2452 .
Pedersen, N. C. , Ho, E. W. , Brown, M. L. & Yamamoto, J. K. (1987). Isolation of a T- lymphotropic virus from domestic cats with an immunodeficiency-like syndrome. Science 235, 790-793.
Phillips, T. R. , Talbott, R. L. , Lamont, C. , Muir, S. , Lovelace, K. & Elder, J. H. (1990). Comparison of two host cell range variants of feline immunodeficiency virus. Journal of Virology 64, 4605-4613 .
Poeschla, E. M. & Looney, D. J. (1998). CXCR4 is required by a nonprimate lentivirus: heterologous expression of feline immunodeficiency virus in human, rodent, and feline cells. Journal of Virology 72, 6858-6866 .
Power, C. , Buist, R. , Johnston, J. B. , Del Bigio, M. R. , Ni, W. , Dawood, M. R. & Peeling, J. (1998). Neurovirulence in feline immunodeficiency virus-infected neonatal cats is viral strain specific and dependent on systemic immune suppression. Journal of Virology 72, 9109-9115 .
Shioda, T. , Oka, S. , Ida, S. , Nokihara, K. , Toriyoshi, H. , Mori, S. , Takebe, Y. , Kimura, S. , Shimada, K. & Nagai, Y. (1994). A naturally occurring single basic amino acid substitution in the V3 region of the human immunodeficiency virus type 1 env protein alters the cellular host range and antigenic structure of the virus. Journal of Virology 68, 7689-7696 .
Siebelink, K. H. J. , Hai Chu, I. , Rimmelzwaan, G. F. , Weijer, K. , van Herwijnen, R. , Knell, P. , Egberink, H. F. , Bosch, M. L. & Osterhaus, A. D. M. E. (1990). Feline immunodeficiency virus (FIV) infection in the cat as a model for HIV infection in man: FIV-induced impairment of immune function. AIDS Research and Human Retroviruses 6, 1373-1378.[Medline]
Siebelink, K. H. J. , Hai Chu, I. , Rimmelzwaan, G. F. , Weijer, K. , Osterhaus, A. D. M. E. & Bosch, M. L. (1992). Isolation and partial characterization of infectious molecular clones of feline immunodeficiency virus obtained directly from bone marrow DNA of a naturally infected cat. Journal of Virology 66, 1091-1097 .
Siebelink, K. H. J. , Karlas, J. A. , Rimmelzwaan, G. F. , Osterhaus, A. D. M. E. & Bosch, M. L. (1995). A determinant of feline immunodeficiency virus involved in Crandell feline kidney cell tropism . Veterinary Immunology and Immunopathology 46, 61-69.[Medline]
Simmonds, P. , Zhang, L. Q. , McOmish, F. , Balfe, P. , Ludlam, C. A. & Brown, A. J. L. (1991). Discontinuous sequence change of human immunodeficiency virus (HIV) type 1 env sequence in plasma viral and lymphocyte-associated proviral populations in vivo: implications for models of HIV pathogenesis. Journal of Virology 65, 6266-6276 .
Simmons, G. , Wilkinson, D. , Reeves, J. D. , Dittmar, M. T. , Beddows, S. , Weber, J. , Carnegie, G. , Desselberger, U. , Gray, P. W. , Weiss, R. A. & Clapham, P. R. (1996). Primary, syncytium- inducing human immunodeficiency virus type 1 isolates are dual-tropic and most can use either Lestr or CCR5 as coreceptors for virus entry. Journal of Virology 70, 8355-8360 .
Strizki, J. M. , Albright, A. V. , Sheng, H. , O'Connor, M. , Perrin, L. & Gonzalez-Scarano, F. (1996). Infection of primary human microglia and monocyte-derived macrophages with human immunodeficiency virus type 1 isolates: evidence of differential tropism. Journal of Virology 70, 7654-7662 .
Talbott, R. L. , Sparger, E. E. , Lovelace, K. M. , Fitch, W. M. , Pedersen, N. C. , Luciw, P. A. & Elder, J. H. (1989). Nucleotide sequence and genomic organization of feline immunodeficiency virus. Proceedings of the National Academy of Sciences, USA 86, 5743-5747 .
Tersmette, M., Lange, J. M., de Goede, R. E. Y., de Wolf, F., Eeftink- Schattenkerk, J. K., Schellekens, P. T., Coutinho, R. A., Huisman, J. G., Goudsmit, J. & Miedema, F. (1989). Association between biological properties of human immunodeficiency virus variants and risk for AIDS and AIDS mortality. Lancet i, 983985.
Vahlenkamp, T. W. , Verschoor, E. J. , Schuurman, N. N. M. P. , van Vliet, A. L. W. , Horzinek, M. C. , Egberink, H. F. & de Ronde, A. (1997). A single amino acid substitution in the transmembrane glycoprotein of feline immunodeficiency virus alters cellular tropism. Journal of Virology 71, 7132-7135 .
Van de Peer, Y. & De Wachter, R. (1994). TREECON for Windows: a software package for the construction and drawing of evolutionary trees for the Microsoft Windows environment. Computer Applications in the Biosciences 10, 569-570.
Verschoor, E. J. , Boven, L. A. , Blaak, H. , van Vliet, A. L. W. , Horzinek, M. C. & de Ronde, A. (1995). A single mutation within the V3 envelope neutralization domain of feline immunodeficiency virus determines its tropism for CRFK cells. Journal of Virology 69, 4752-4757 .
Wain-Hobson, S. (1996). HIV. One on one meets two. Nature 384, 117-118.[Medline]
Watkins, B. A. , Dorn, H. H. , Kelly, W. B. , Armstrong, R. C. , Potts, B. J. , Michaels, F. , Kufta, C. V. & Dubois-Dalcq, M. (1990). Specific tropism of HIV-1 for microglial cells in primary human brain cultures. Science 249, 549-553.
Wild, C. , Greenwell, T. & Matthews, T. (1993). A synthetic peptide from HIV-1 gp41 is a potent inhibitor of virus-mediated cellcell fusion. AIDS Research and Human Retroviruses 9, 1051-1053.[Medline]
Willett, B. J. , Picard, L. , Hosie, M. J. , Turner, J. D. , Adema, K. & Clapham, P. R. (1997a). Shared usage of the chemokine receptor CXCR4 by the feline and human immunodeficiency viruses. Journal of Virology 71, 6407 -6415.
Willett, B. J. , Hosie, M. J. , Neil, J. C. , Turner, J. D. & Hoxie, J. A. (1997b). Common mechanism of infection by lentiviruses. Nature 385, 587.[Medline]
Willett, B. J. , Adema, K. , Heveker, N. , Brelot, A. , Picard, L. , Alizon, M. , Turner, J. D. , Hoxie, J. A. , Peiper, S. , Neil, J. C. & Hosie, M. J. (1998). The second extracellular loop of CXCR4 determines its function as a receptor for feline immunodeficiency virus. Journal of Virology 72, 6475-6481 .
Yamamoto, J. K. , Sparger, E. , Ho, E. W. , Andersen, P. R. , O'Connor, T. P. , Mandell, C. P. , Lowenstine, L. , Munn, R. & Pedersen, N. C. (1988). Pathogenesis of experimentally induced feline immunodeficiency virus infection in cats. American Journal of Veterinary Research 49, 1246-1258 .[Medline]
Received 9 March 1999;
accepted 14 June 1999.
This article has been cited by other articles:
![]() |
B. J. Willett, E. L. McMonagle, N. Logan, O. B. Spiller, P. Schneider, and M. J. Hosie Probing the Interaction between Feline Immunodeficiency Virus and CD134 by Using the Novel Monoclonal Antibody 7D6 and the CD134 (Ox40) Ligand J. Virol., September 15, 2007; 81(18): 9665 - 9679. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. de Rozieres, C. K. Mathiason, M. R. Rolston, U. Chatterji, E. A. Hoover, and J. H. Elder Characterization of a Highly Pathogenic Molecular Clone of Feline Immunodeficiency Virus Clade C J. Virol., September 1, 2004; 78(17): 8971 - 8982. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. B. Johnston and C. Power Feline Immunodeficiency Virus Xenoinfection: the Role of Chemokine Receptors and Envelope Diversity J. Virol., April 15, 2002; 76(8): 3626 - 3636. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. B. Johnston, C. Silva, and C. Power Envelope Gene-Mediated Neurovirulence in Feline Immunodeficiency Virus Infection: Induction of Matrix Metalloproteinases and Neuronal Injury J. Virol., March 15, 2002; 76(6): 2622 - 2633. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| INT J SYST EVOL MICROBIOL | MICROBIOLOGY | J GEN VIROL |
| J MED MICROBIOL | ALL SGM JOURNALS | |