J Gen Virol Tips for Better Browsing
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via CrossRef
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Hui, E. K.-W.
Right arrow Articles by Lo, S. J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Hui, E. K.-W.
Right arrow Articles by Lo, S. J.
Agricola
Right arrow Articles by Hui, E. K.-W.
Right arrow Articles by Lo, S. J.
Journal of General Virology (1999), 80, 2647-2659.
© 1999 Society for General Microbiology


Animal: DNA Viruses

Hepatitis B viral core proteins with an N-terminal extension can assemble into core-like particles but cannot be enveloped

Eric Ka-Wai Hui1, Yong Shyang Yi1 and Szecheng J. Lo1

Institute of Microbiology and Immunology, School of Life Science, National Yang-Ming University, Taipei, Taiwan 112, Republic of China 1

Author for correspondence: Szecheng J. Lo.Fax +886 2 2821 2880. e-mail losj{at}ym.edu.tw


   Abstract
TOP
Abstract
Introduction
Methods
Results
Discussion
References
 
The structure of hepatitis B virus (HBV) nucleocapsids has been revealed in great detail by cryoelectron microscopy. How nucleocapsids interact with surface antigens to form enveloped virions remains unknown. In this study, core mutants with N-terminal additions were created to address two questions: (1) can these mutant core proteins still form nucleocapsids and (2) if so, can the mutant nucleocapsids interact with surface antigens to form virion-like particles. One plasmid encoding an extra stretch of 23 aa, including six histidine residues, fused to the N terminus of the core protein (designated HisC183) was expressed in Escherichia coli and detected by Western blot. CsCl gradient and electron microscopy analyses indicated that HisC183 could self-assemble into nucleocapsids. When HisC183 or another similar N-terminal fusion core protein (designated FlagC183) was co-expressed with a core-negative plasmid in human hepatoma cells, both mutant core proteins self-assembled into nucleocapsids. These particles also retained kinase activity. Using an endogenous polymerase assay, a fill-in HBV DNA labelled with isotope was obtained from intracellular nucleocapsids formed by mutant cores. In contrast, no such signal was detected from the transfection medium, which was consistent with PCR and Southern blot analyses. Results indicate that core mutants with N-terminal extensions can form nucleocapsids, but are blocked during the envelopment process and cannot form secreted virions. The mutant nucleocapsids generated from this work should facilitate further study on how nucleocapsids interact with surface antigens.


   Introduction
TOP
Abstract
Introduction
Methods
Results
Discussion
References
 
Human hepatitis B virus (HBV) has been a focus of clinical and basic studies due to its infection being a worldwide health problem and its unique structure and life-cycle among animal DNA viruses (Szmuness, 1978Down ; Beasley et al., 1981Down ; Tiollais et al., 1981Down ; Ganem & Varmus, 1987Down ). HBV DNA is partially double-stranded and about 3·2 kb long. Although its genome is DNA, it replicates through an RNA intermediate (Summers & Mason, 1982Down ), the so-called `pregenomic RNA'. The pregenomic RNA (pregenome) and viral polymerase, together with cellular kinase and heat shock proteins, are encapsidated by viral core proteins, which have 183 or 185 aa residues depending on sero-subtypes, to form nucleocapsids (Nassal & Schaller, 1993Down ; Kann & Gerlich, 1994Down ; Nassal, 1996Down ; Hu & Seeger, 1997Down ; Kau & Ting, 1998Down ). Inside the nucleocapsids, the first strand of DNA is synthesized by reverse transcription (see review by Nassal, 1996Down ). Thereafter, nucleocapsids interact with viral surface antigens that are embedded in a lipid bilayer of endoplasmic reticulum (ER) and bud into the ER lumen to form mature virions, termed Dane particles (Bruss & Ganem, 1991Down ; Huovila et al., 1992Down ; Wei et al., 1996Down ). Recently, the interaction domains of capsid proteins and surface antigens were characterized and mapped (Dyson & Murray, 1995Down ; Poisson et al., 1997Down ; Bruss, 1997Down ). However, the interaction mechanism between nucleocapsid proteins and surface antigens remains poorly understood.

A model of the three-dimensional structure of HBV nucleocapsid has been revealed to a resolution of 35·0–7·4  by cryoelectron microscopy (Crowther et al., 1994Down ; Conway et al., 1997Down , 1998aDown ; Zlotnick et al., 1996Down , 1997Down ; Bottcher et al., 1997Down , 1998Down ). The proposed models agree that three regions of core protein, aa 78–82, 127–130 and 145–153, are exposed on the shell of nucleocapsids. Neither the N nor the C terminus of the core protein is on the external surface. The N-terminal portion (aa 1–150) of core protein is capable of self- assembling into nucleocapsids even in the absence of the C terminus (Birnbaum & Nassal, 1990Down ; Nassal, 1992Down ; Halton et al., 1992Down ). In contrast, core mutants bearing a small insertion, substitution or deletion in the N-terminal domain of HBV core protein (Beames & Lanford, 1995Down ; Metzger & Bringas, 1998Down ; Konig et al., 1998Down ) or woodchuck hepatitis virus (WHV) core protein (Yu et al., 1996Down ) fail to form nucleocapsids. However, studies on duck HBV show that the core protein N-terminal additions have various effects on capsid formation depending on the nature of the extension peptides (von Weizsacker et al., 1996Down ; Kock et al., 1998Down ). Therefore, the influence of the core protein N terminus on nucleocapsid assembly needs to be further investigated.

Conway et al. (1998b)Down used an extraneous octapeptide to demonstrate that the core protein N terminus is localized at the spike near the entrance of the shell. In this study, we constructed and expressed N-terminal extension core proteins which were either rich in a positive charge of histidine (designated HisC183) or rich in a negative charge of glutamic acid (designated FlagC183) to test their effect on nucleocapsid assembly in either a prokaryotic or a eukaryotic system. We also tested similar constructs for their influence on virion formation by trans-supplementing a core- negative HBV clone in HuH-7 hepatoma cells. We have demonstrated that the N-terminal extension of core proteins does not interfere with core protein dimerization (Zheng et al., 1992Down ; Zhou & Standring, 1992Down ) and nucleocapsid assembly. Since protein kinase activity has been demonstrated in the HBV nucleocapsid (Albin & Robinson, 1980Down ; Gerlich et al., 1982Down ), in which the serine residues located at the C terminus of core protein are the substrate of the HBV-associated kinase (Roossinck & Siddiqui, 1987Down ; Yeh & Ou, 1991Down ), we have also shown that the N-terminal core mutants do not interfere with kinase encapsidation. However, the result of blocking nucleocapsids from envelopment by surface antigens supported the hypothesis that the N terminus of the core protein is localized near the surface of the capsid shell.


   Methods
TOP
Abstract
Introduction
Methods
Results
Discussion
References
 
{blacksquare} Plasmids and construction of mutants.
Standard techniques were used for DNA manipulation (Sambrook et al., 1989Down ). Plasmids pMH 3/3097 (Junker et al. , 1987Down ) and pMH 3/3097mC (Lin & Lo, 1992Down ) were used as described previously. pHisC183 (Fig. 1aDown, line 2) is a prokaryotic expression plasmid which encodes an N-terminal His-tagged core protein. The vector pET-15b (Novagen), containing a His-tag, was cleaved with XhoI (filled- in) and BamHI and then ligated with the 1 kb Nco I (filled-in)/BamHI fragment from pMH 3/3097mC to generate pHisC183. pHBVHisC183 (Fig. 1aDown, line 3) is a eukaryotic expression plasmid which, like pHisC183, encodes an N- terminal His-tagged core protein. The NcoI/EcoRI fragment of pHisC183, containing the His-tag fused C gene, was ligated with the EcoRI/NcoI-digested pMH 3/3097mC to give pHBVHisC183. pHBVFlagC183 (Fig. 1aDown, line 4) is another eukaryotic expression plasmid which encodes an N-terminal Flag-tagged core protein and was obtained from the insertion of Nco I (filled-in)/BamHI fragment from pMH 3/3097mC into the HindIII (filled-in) and BamHI sites of pFLAG-CMV2 vector (Eastman Kodak). The junctions of newly created plasmids were ascertained by the dideoxy termination method of DNA sequencing (Sanger et al., 1977Down ). All plasmids used in this study are shown in Fig. 1(a)Down and the characteristics of the N-terminal extensions of the core protein are listed in Fig. 1(b )Down.



View larger version (21K):
[in this window]
[in a new window]
 
Fig. 1. Diagrammatic representation of plasmids used in this study and characteristics of the N termini of core proteins. (a ) Plasmid designations are shown at the left of lines 1–7. Plasmids are shown by a partial sequence which contains the HBV DNA and the metallothionein or cytomegalovirus promoter (arrows marked MT and CMV, respectively). The boxes above the restriction enzyme map represent the HBV genes in a linear form, in which the shaded box marks the redundant core gene. Common restriction enzyme cutting sites used for cloning have also been indicated. The thick line on plasmids represents the HBV DNA sequence; {epsilon} indicates the packaging signal of HBV pregenome; the diamond symbol indicates the HBV polyadenylation signal. The thin line shown by an inverted V-shape is the region of HBV DNA deletion. The filled-in circle indicates the fusion epitope. (b ) Comparison between the N-terminal amino acid sequences of the wild-type (C183) and mutants (HisC183 and FlagC183). The numbers indicate the positions of amino acids; the `1' marks the first methionine residue of the core protein. Charged amino acid residues are indicated by `+' and `-'.

 
{blacksquare} Core protein expression in Escherichia coli.
E. coli strains BL21(DE3) or JM109(DE3) harbouring various plasmids were grown to an OD600 of 1·0 in 800 ml LB medium containing 50 µg/ml ampicillin, followed by the addition of 1 mM IPTG; the culture was then shaken at 37 °C for another 3 h. Bacteria were lysed in a French press (800 psi) and the cellular debris was removed by centrifugation at 18000 g for 15 min. The supernatant was collected and passed through a 0·45 µm filter.

{blacksquare} Purification of core protein.
E. coli lysates from the 800 ml culture described above were incubated with Ni2+-chelated His•Bind resin (Novagen) in binding buffer (20 mM Tris–HCl, pH 7·9, 0·5 M NaCl and 5 mM imidazole) at room temperature for 1 h. After three washes with binding buffer and washing buffer (20 mM Tris–HCl, pH 7·9, 0·5 M NaCl and 60 mM imidazole), the proteins were eluted with elute buffer (20 mM Tris–HCl, pH 7·9, 0·5 M NaCl and 1 M imidazole) at room temperature for 30 min. The eluate (5 ml) was collected (concentration 0·17 mg/ml) and aliquots (10 µl) were run on 15% SDS–PAGE (Laemmli, 1970Down ) and stained with Coomassie brilliant blue for analysis of protein purity.

{blacksquare} CsCl gradient centrifugation.
E. coli lysates or nucleocapsids from media or cell lysate (see below) were resuspended in a high-salt TNE buffer (10 mM Tris–HCl, pH 7·4, 150 mM NaCl, 1 mM EDTA and 0·1% sodium azide) and subjected to CsCl centrifugation (average density 1·24 g/ml) at 35000 r.p.m. in an SW41 rotor for 44 h. The gradients (final density 1·1–1·5 g/ml) were fractionated into 0·5 ml samples from the top to bottom and each fraction was subjected to ELISA for detection of core antigen and/or surface antigen (General Biologicals). The density of individual fractions was determined by the refractive index using a refractometer.

{blacksquare} Electron microscopy.
Core particles prepared from Ni2+-chelated His•Bind resin and CsCl fractions were collected and spotted onto Formvar-coated grids, then negatively stained with saturated uranyl acetate and visualized in a JEOL JEM-2000ExII transmission electron microscope as described previously (Chang et al., 1987Down ).

{blacksquare} Cell culture and transfection.
Human hepatoma cells (HuH-7) were grown in Dulbecco's modified Eagle's medium supplemented with 10 % foetal bovine serum, 1 mM glutamine, 10 U/ml penicillin and 100 µg/ml streptomycin. HuH-7 cells were transfected with an appropriate amount of plasmid, either singly or in combinations, using the calcium phosphate co-precipitation procedure (Graham & van der Eb, 1973Down ; Sambrook et al., 1989Down ). At 3, 6 and 9 days post-transfection, media were harvested for viral particle analysis. At 9 days post-transfection, cells were harvested for analysis of nucleocapsid and viral DNA.

{blacksquare} Viral nucleocapsid isolation.
To collect nucleocapsids from intracellular extracts, transfected cells were detached from plates and incubated in PBS with 1% NP-40 at 4 °C overnight (Beames & Lanford, 1995Down ). After a low-speed centrifugation to remove nuclei and NP-40-insoluble cell debris, the cellular lysate was ready for a further isolation step. To collect nucleocapsids and virion-like particles from culture fluids, the media were incubated with or without detergent (NP-40 to a final concentration of 1%) at room temperature for 2 h before centrifugation. Both samples were clarified by centrifugation at 13000 r.p.m. for 30 min in a JA-20 rotor (Beckman Instruments). The nucleocapsids were then concentrated by further centrifugation at 45000 r.p.m. in a Ti55.2 rotor for 2·5 h while the Dane-like particles were enriched under the same conditions for 5 h. The isolated viral particles were subsequently resuspended in a low-salt TNE buffer (10 mM Tris–HCl, pH 7·5, 100 mM NaCl and 1 mM EDTA).

{blacksquare} Immunoprecipitation and Western blotting analysis.
The precleared cell lysate was incubated with primary antibodies bound with Sepharose–protein A or G. Antibodies of rabbit polyclonal anti-core (Dako), mouse monoclonal anti-6xHis (Clontech) and anti-Flag (Kodak) were used. The antigen–antibody complexes were precipitated and washed three times with NET buffer (50 mM Tris, pH 7·5, 150 mM NaCl, 0·5 mM EDTA and 0·5% NP-40) and then boiled in sample buffer (Laemmli, 1970Down ) and analysed by 15% SDS–PAGE under reducing (with DTT) or non-reducing (without DTT) conditions. Western blotting was performed by reacting with anti-core, anti-6xHis or anti-Flag antibodies following by reacting with secondary antibodies, conjugated with horseradish peroxidase (Organ Teknika). The blot was developed with an enhanced chemiluminescence (ECL) detection system (Amersham Pharmacia).

{blacksquare} In vitro kinase assay.
The immunoprecipitated nucleocapsids were washed three times and then incubated in a kinase reaction buffer (50 mM Tris–HCl, pH 7·4, 10 mM MgCl2 and 0·4% NP-40) containing 10 pmol [{gamma}-32P]ATP (7000 Ci/mmol; Amersham) as described previously (Jeng et al., 1991Down ; Lin & Lo, 1992Down ). After incubation at 37 °C for 1 h, the complex was washed five times with NET buffer and then subjected to 15% SDS–PAGE separation and autoradiographed.

{blacksquare} Endogenous DNA polymerase assay.
Endogenous DNA polymerase activity was assayed as described previously (Junker et al., 1987Down ) with some modification (Chiang et al., 1990Down ; Lin & Lo, 1992Down ). Briefly, one-fifth of the partially purified viral particle samples was incubated with a pol-mix buffer (50 mM Tris–HCl pH 7·4, 40 mM NH4Cl, 5 mM MgCl2, 0·5% NP-40, 0·2% 2- mercaptoethanol and 25 µM each of dATP, dGTP and dTTP) at 37 °C for 2 h in the presence of [{alpha}-32 P]dCTP (5000 mCi/mmol; Amersham). Subsequently, a chase was performed for 2 h by adding unlabelled dCTP (25 µM final concentration) at 37 °C. Unwanted nucleic acids present outside of particles were digested by micrococcal nuclease (5 U) for 1 h at 37 °C. Particles were then digested by 50 µg/ml proteinase K treatment in the presence of 1% SDS for 1 h at 37 °C. Glycogen was added (0·8 mg/ml final concentration) and samples were extracted with an equal volume of phenol/chloroform. The labelled DNAs were precipitated with 2·5 vol. ethanol which contained 0·3 M sodium acetate (pH 4·8), separated on 1% agarose gels by electrophoresis, and then autoradiographed.

{blacksquare} PCR and Southern hybridization.
In addition to using an endogenous DNA polymerase assay to analyse HBV nucleic acids in secreted viral particles, Dane-like particles collected from CsCl density gradients were subjected to PCR amplification followed by Southern hybridization. Particles were first digested with DNase (10 U) in a DNA buffer (10 mM Tris–HCl, pH 8·3, 50 mM KCl and 1·5 mM MgCl2 ) at 37 °C for 1 h and then disrupted by boiling for 10 min (Bottcher et al., 1998Down ). Viral DNAs were amplified by PCR using the forward primer C401F (5' ATGGACATCGACCCTTATAAAG 3') and the reverse primer S1764R (5' TGTTCCTGAACTGGAGCCACCAGCA 3') for 40 cycles of 96 °C for 1 min, 57 °C for 1 min and 74 °C for 20 s and an additional extension period at 72 °C for 5 min. The amplified DNA products were resolved by electrophoresis on 2% agarose gel and subjected to Southern blot analysis (Southern, 1975Down ) using a probe containing the 279 bp HBV BamHI/EcoRI fragment (see also Fig. 7 aDown).



View larger version (30K):
[in this window]
[in a new window]
 
Fig. 7. Detection of HBV DNA from secreted Dane-like particles by PCR and Southern blot. (a) The expected sizes of PCR product from pregenomes are given on the left. The pregenomes derived from plasmids are shown by thick lines. The boxes shown above the thick lines are as described in Fig. 1(a)Up. Locations of primers, C401F and S1764R, for PCR amplification are indicated by arrowheads. The BamHI/EcoRI fragment, indicated by arrows, was used as a probe for Southern hybridization. (b) HuH-7 cells were transfected with various plasmids as specified at the top of each graph. Extracellular media were precleared with anti-core antibodies and subjected to CsCl gradient density sedimentation. Twenty fractions (500 µl each) were collected and analysed for the presence of HBsAg and core protein by ELISA. The density (g/ml) of individual fractions is shown by dotted lines. Filled-in (HBcAg) and open (HBsAg) circles show the OD490 in the ELISA of each fraction. Fractions were pooled into <D, D and >>D tubes and subjected to PCR amplification. PCR products from tubes 1–12 were separated on a 1% agarose gel and probed by the HBV fragment as indicted in (a). Lane numbers on the gel correspond to the tube numbers collected from the CsCl fractions. Lane 13 is the negative control for PCR. Arrows on the left of the gel indicate the expected sizes of fragments (1363 and 1046 bp, respectively). Numbers on the right are the DNA markers in bp.

 

   Results
TOP
Abstract
Introduction
Methods
Results
Discussion
References
 
Expression of HBV core proteins with an N-terminal extension in E. coli
In this study, pHisC183 was constructed for the expression of HBV core proteins with an N-terminal extension, designated HisC183. HisC183 has 23 extra amino acids at the N terminus, including a stretch of six histidine residues (Fig. 1bUp). Expression of HisC183 was examined in two different strains of E. coli, BL21(DE3) and JM109(DE3), by SDS–PAGE and Western blot analyses. The Coomassie brilliant blue-stained gel showed no extra band (Fig. 2 aDown , upper panel); however, numerous bands were detected by anti-core antibodies in Western blots (Fig. 2aDown , lower panel) when plasmid-harbouring bacteria were treated with IPTG. Although a few core-positive bands were also detected in the same plasmid-harbouring bacteria without IPTG treatment, this was most likely due to leaky transcription of the T7 promoter. Nevertheless, the molecular mass of the highest and dominant band is as expected, suggesting that fusion core proteins were expressed and some of them were degraded into small fragments.



View larger version (54K):
[in this window]
[in a new window]
 
Fig. 2. Detection of HisC183 expression and nucleocapsid formation in E. coli. (a) E. coli strains BL21(DE3) (lanes 1–4) or JM109(DE3) (lanes 5–8) were transfected with plasmid pHisC183. After incubation with IPTG (lanes 2, 4, 6 and 8) or without IPTG (lanes 1, 3, 5 and 7), the total cell lysates were analysed by 15% SDS–PAGE and then stained by Coomassie brilliant blue (upper panel) or probed with anti-core antibody (lower panel). Numbers on the right indicate the positions of the protein molecular mass markers (lane M) in kDa. (b) Density gradient analysis of nucleocapsids in soluble fractions from E. coli harbouring pHisC183 after IPTG induction. Lysates were obtained in a French press and subjected to CsCl gradient density centrifugation. Twenty fractions (500 µl each) were collected and analysed for the presence of core protein by ELISA. The density (g/ml) of individual fractions is shown by a dotted line. The filled-in circles show the OD490 in the ELISA of each fraction. The inset shows the particle-like structure from the HBcAg-positive fraction (fractions 5–8); bar, 50 nm. (c) Cell lysates were passed through an Ni2+ affinity chromatography column, the eluate was analysed by 15% SDS–PAGE and stained by Coomassie brilliant blue. Numbers on the left (lane 1) indicate the position of the protein molecular mass markers in kDa. The arrow on the right indicates core protein. (d) Electron micrograph showing core-like particles from the eluate sample; bar, 50 nm.

 
Mutant core with an N-terminal His-tag can self-assemble in E. coli
Since HisC183 was expressed in E. coli and easily extracted, it was of great interest to know whether HisC183 could self- assemble into nucleocapsids spontaneously as previous reports have suggested (Pasek et al., 1979Down ; Cohen & Richmond, 1982Down ; Stahl et al., 1982Down ). Soluble lysates from bacteria expressing HisC183 were centrifuged through CsCl density gradients and each fraction was subjected to ELISA for the presence of HBV core antigen (HBcAg). Several fractions of cell lysates from IPTG-induced bacteria exhibited a positive signal for HBcAg, i.e. peaks at densities of 1·18–1·20 and 1·26–1·31 g/ml (Fig. 2bUp ). This result strongly indicated that HisC183 could self-assemble into nucleocapsids. Electron microscopic examination of negatively stained samples from the CsCl density peak (fractions 5–8) further confirmed that the nucleocapsids indeed formed in E. coli (inset of Fig. 2bUp).

To clarify whether or not the His-tag of HisC183 is exposed at the surface of nucleocapsids, we used an affinity column to purify HisC183. Results of Ni2+-affinity binding resin showed a single band in a 15% SDS–PAGE gel stained with Coomassie brilliant blue (Fig. 2cUp), indicating that the His-tag of HisC183 was accessible by nickel resins. Protein concentration analyses revealed that this band comprised approximately 8·5 mg HisC183, which was recovered from the 800 ml overnight culture. However, HisC183 bound on nickel resins could be in monomeric, dimeric or particulate form. Electron microscopic examination revealed that at least some HisC183 proteins, if not all of them, retained the integrity of nucleocapsids as those separated by CsCl gradient (Fig. 2d Up).

Dimerization of HBV core proteins with an N-terminal extension in hepatoma cells
Since the core-like particles obtained from E. coli lack several features of nucleocapsids, e.g. encapsidation of viral pregenome and cellular kinases, pHBVHisC183 (Fig. 1aUp, line 3) was constructed for expression of HisC183 in HuH-7 hepatoma cells. Another plasmid, pHBVFlagC183 (Fig. 1aUp, line 4), was also constructed for expression of FlagC183, which has 10 extra amino acid residues, including five negatively charged glutamic acid residues, at the N terminus of the core protein (see Fig. 1bUp). In addition to having a different tag sequence to pHBVC183, pHBVFlagC183 is driven by the cytomegalovirus (CMV) promoter to express FlagC183 and the HBV sequence within it lacks the polyadenlyation signal. To characterize and test the expression of the N-terminal extension mutants, pHBVHisC183 or pHBVFlagC183 were co-transfected with a core-negative plasmid (pHBV{Delta}C; Fig. 1aUp, line 6) (Hui et al., 1999Down ) into HuH-7 hepatoma cells. In addition, a full-length HBV-containing plasmid, pMH 3/3097 (Fig. 1aUp, line 1), co-transfected with a vector plasmid, pUC-MT (Fig. 1aUp, line 7), was used as a positive control. Western blot analyses showed that wild-type and two mutant cores were detected by anti-core antibodies (Fig. 3aDown). Migration of wild-type C183, and mutants HisC183 and FlagC183 was as expected, i.e. molecular masses of 21·5, ~24 and ~22 kDa, respectively. With a His-tag or Flag-epitope at the N terminus, HisC183 and FlagC183 could be recognized by anti-His or anti-Flag antibodies, respectively, while wild-type HisC183 could not (Fig. 3aDown, {alpha}His and {alpha}Flag panels). To test whether the His-tagging and Flag- tagging could affect dimer formation of core proteins (Zheng et al. , 1992Down ; Zhou & Standring, 1992Down ), samples were analysed under non-reducing conditions. Results showed that a dimer was present in the wild-type C183 as well as in HisC183 and FlagC183 (Fig. 3 bDown), indicating that formation of intermolecular disulfide bonds was not inhibited by the extensions of amino acid residues located at the N terminus.



View larger version (25K):
[in this window]
[in a new window]
 
Fig. 3. Western blot analysis of core proteins from transfected HuH-7 cells. (a) Particles collected from hepatoma cells transfected with pUC-MT (lane 1), pMH 3/3097 plus pUC-MT (lane 2), pHBVC183 plus pHBV{Delta}C (lane 3) or pHBVFlagC183 plus pHBV{Delta}C (lane 4) were analysed by 15% SDS–PAGE under reducing conditions and probed with either anti-core (upper panel), anti-His (middle panel) or anti-Flag (lower panel) antibodies followed by ECL development. (b) Particles were also analysed by 12% SDS–PAGE under non-reducing conditions, then Western blotted and probed with anti-core antibody. Positions of molecular mass markers (kDa) are indicated on the right. Arrowheads indicate the dimer of core proteins. The expected core proteins are indicated at the top of the gel while the antibodies used for the Western blot are indicated on the left.

 
Self-assembly into nucleocapsids by mutant cores in hepatoma cells
To verify whether the HisC183 and FlagC183 proteins can self- assemble into core-like particles in HuH-7 cells as in E. coli , we performed CsCl gradient analyses. Both intracellular extracts and detergent-treated extracellular media from cells transfected with the two plasmids in various combinations (as described above) were subjected to CsCl banding and then to ELISA analysis for the presence of core proteins. For another positive control of wild-type core expression, plasmid pHBV{Delta}PSX, in which the P, S and X genes are deleted and the C gene remains intact (Fig. 1aUp, line 5), was also used as a comparison. Results showed a similar profile of core protein distribution obtained from the transfection of wild-type C183 (Fig. 4aDown), mutants HisC183 (Fig. 4 bDown) and FlagC183 (Fig. 4cDown) as well as from the co-transfection of pHBV{Delta}C and pHBV{Delta}PSX (Fig. 4d Down). The core proteins were present at the peak of 1·18–1·20 g/ml or at the peak of 1·25–1·30 g/ml, which correspond to the density of empty core particles (light core) and nucleic acid- containing particles (heavy core), respectively. These results suggest that the N-terminal fusion core proteins do not significantly disrupt the structure of an assembled particle in HuH-7 cells as observed in E. coli (Fig. 2bUp).



View larger version (31K):
[in this window]
[in a new window]
 
Fig. 4. Density gradient analysis of cytoplasm- and medium-derived nucleocapsids. HuH-7 cells were transfected with plasmids as indicated. Intracellular lysate (left column of graphs) and extracellular media containing particles treated with NP-40 (right column of graphs) were subjected to CsCl gradient density sedimentation. Twenty fractions (500 µl each) were collected and analysed for the presence of core protein by ELISA. Density (g/ml) of individual fractions is shown by a dotted line in each panel. Filled-in circles show the OD490 in the ELISA of each fraction.

 
Fusion core proteins can be phosphorylated by in vitro kinase reaction
Protein kinase activity has been demonstrated inside the HBV nucleocapsid (Albin & Robinson, 1980Down ; Gerlich et al. , 1982Down ), which is an indicator of intact particles. In order to obtain more evidence concerning the integrity of nucleocapsids assembled by HisC183 and FlagC183, we performed an in vitro kinase assay for nucleocapsids. Nucleocapsids were collected using immunoprecipitation with anti-core antibodies from both intracellular extracts and extracellular (NP-40-treated) media. The results of the in vitro phosphorylation showed that not only the wild-type C183 but also the HisC183 and FlagC183 mutant core proteins can be phosphorylated in both intracellular nucleocapsids (Fig. 5Down, upper panel) and extracellular nucleocapsids (Fig. 5Down, lower panel). However, no sign of phosphorylation occurred in the FlagC151 mutant, which lacks the C- terminal serine residues, although nucleocapsids can be formed by FlagC151 (Hui et al., 1999Down ). These data suggest that mutant core proteins with an N-terminal extension do not interfere with the kinase packaging into nucleocapsids and particles remain intact.



View larger version (51K):
[in this window]
[in a new window]
 
Fig. 5. Particle-associated protein kinase assay. HuH-7 cells were transfected with pUC-MT (lane 1), pMH 3/3097 plus pUC-MT (lane 2), pHBVC183 plus pHBV{Delta}C (lane 3) or pHBVFlagC183 plus pHBV{Delta}C (lane 4). Particles were isolated from intracellular extracts (upper panel) or extracellular media (lower panel) and were subjected to an in vitro phosphorylation assay. The expected core proteins from transfections are indicated at the top of the gel. Numbers on the right indicate the position of the protein molecular mass markers in kDa.

 
Intracellular mutant nucleocapsids retain DNA repairing activity
One prominent property of nucleocapsids is the formation of partially double-stranded HBV DNA from the encapsidated pregenome by reverse transcriptase/DNA polymerase. This feature can be demonstrated by an endogenous polymerase activity assay (HBV DNA gap fill-in assay), in which a specific length of HBV DNA is filled-in by isotope-labelled nucleotides and is shown by autoradiography. To characterize the integrity of nucleocapsids assembled by HisC183 and FlagC183, an endogenous polymerase activity assay was applied to the samples of complementation experiments as used in the CsCl gradient assay (Fig. 4 bUp, cUp). A band of 3·0 kb HBV DNA, which is presumably derived from the pregenome transcribed by pHBV{Delta}C, was present in intracellular extracts from both co- transfections with pHBVHisC183 or pHBVFlagC183, together with a core- negative plasmid (pHBV{Delta}C) (Fig. 6aDown, lanes 3 and 4). As expected, two bands of 3·0 kb and 2·1 kb were observed in the co- transfection of pHBV{Delta}PSX and pHBV{Delta}C and a single band of 3·2 kb was seen in pMH 3/3097 and pUC-MT co-transfection (Fig. 6aDown, lanes 1 and 2). Although the signal was weaker in the sample of co-transfection with pHBVFlagC183 and pHBV{Delta}C (lane 4), data support the notion that intracellular nucleocapsids formed by HisC183 and FlagC183 remain functional in reverse transcription of the pregenome.



View larger version (39K):
[in this window]
[in a new window]
 
Fig. 6. Endogenous polymerase reaction products. HuH-7 cells were transfected with various plasmids as specified at the top of the gel. Intracellular nucleocapsids (a) and Dane-like particles from extracellular media (b) were collected. Dane- like particles were treated with NP-40 and, together with nucleocapsids, were analysed by endogenous polymerase reaction and the products were separated on an agarose gel and visualized by autoradiography of the dried gel. Positions of the 32P- labelled {lambda} HindIII markers (bp) are shown on the right (lane M). Arrowheads indicate the positions of the repaired HBV DNA signals.

 
Impairment of envelopment in mutant nucleocapsids to form virion-like particles
Since intracellular nucleocapsids assembled by mutant core proteins contain functional components, we were interested to know whether these intracellular nucleocapsids can still interact with surface antigens to form secretable virion-like particles. Because a small amount of naked nucleocapsids can be found in the media from transfected HuH-7 cells (Figs 4Up and 5Up; Gerelsaikhan et al. , 1996Down ), we performed immunoprecipitation twice using excess anti-core antibodies to eliminate extracellular nucleocapsids. The HBV DNA gap fill-in assay for those media precleared by anti-core antibodies showed no sign of isotope-labelled HBV DNA in co-transfections of pHBVHisC183 or pHBVFlagC183 with pHBV{Delta}C (Fig. 6bUp, lanes 3 and 4). As expected, two bands of 3·0 kb and 2·1 kb and a single band of 3·2 kb were observed in the positive groups, respectively (Fig. 6b Up, lanes 1 and 2). The results suggest that intracellular nucleocapsids assembled by HisC183 and FlagC183 could not be enveloped to form mature virions.

To further confirm that the observation of envelopment impairment occurred in mutant nucleocapsids, a more sensitive assay was carried out. Cell culture media precleared by anti-core antibodies as described above were fractionated by CsCl gradient centrifugation and divided into three tubes: <D, lighter density than Dane particles; D, equal density to Dane particles; and >>D, heavier density than Dane particles. Each tube was subjected to PCR amplification followed by Southern blot analysis for detection of HBV DNA present in the fraction. ELISA analyses of CsCl fractions showed that no naked nucleocapsids were present in any preparations (Fig. 7b Up). PCR and Southern blot results showed two bands of 1363 bp and 1046 bp in the sample co-transfected with pHBV{Delta}C and pHBV{Delta}PSX and a single band of 1363 bp in the sample co- transfected with pMH 3/3097 and pUC-MT (Fig. 7bUp ), indicating that they were indeed derived from Dane-like particles instead of nucleocapsids in media. Lighter bands present in both <D and >>D tubes of positive control groups might result from the incomplete separation and the oversensitive detection by PCR amplification plus Southern hybridization. Consistent with the DNA repairing assay results, no PCR product was detected in the tubes of <D, D and >>D from samples which were co-transfected with mutant core plasmids and pHBV{Delta}C (Fig. 7bUp, lanes 7–12); this strongly suggests that no detectable virion was secreted by these transfected cells. Taking together all results from this study, we conclude that HBV core mutants with an N-terminal extension, HisC183 and FlagC183, can form a functional nucleocapsid intracellularly but are incapable of forming a mature and secretable Dane-like particle.


   Discussion
TOP
Abstract
Introduction
Methods
Results
Discussion
References
 
In order to elucidate the role of the N terminus of the HBV core protein in virion maturation, we constructed core mutants with an N- terminal extension to test their ability to assemble nucleocapsids. Using CsCl gradient separation and electron microscopy analyses, we demonstrated that HisC183 could form nucleocapsids in both prokaryotic and eukaryotic systems and that FlagC183 could do so in eukaryotic cells (Figs 2Up and 4Up). In addition, nucleocapsids assembled by HisC183 and FlagC183 in hepatoma cells retained a kinase activity and an endogenous polymerase activity (Figs 5Up and 6aUp). However, these particles could not form secretable virions (Figs 6bUp and 7 bUp), suggesting that either the additional amino acids at the N terminus interfere directly with envelopment by surface antigens or block the signals for the process of envelopment.

In the past, HBV core proteins have been successfully used to express heterologous epitopes in many prokaryotic and eukaryotic systems because of their ability to form particles (see review by Pumpens & Grens, 1999Down ). In addition, HBV nucleocapsids are exceptionally potent antigens that induce both T-cell-dependent and T-cell-independent responses (see review by Schodel et al., 1996Down ). Several insertion sites have been tested to improve the immunogenicity of foreign peptides (Clarke et al., 1990Down ; Pumpens et al., 1995Down ; Borisova et al., 1996Down ; Ulrich et al., 1998Down ). Three insertions, located at aa 1–3, 74–93 and 141–183 of core proteins, are found to be regions that are dispensable for nucleocapsid assembly (Pumpens & Grens, 1999Down ). In this study, the nucleocapsid assembled by HisC183 is consistent with previous studies and gives a new example that additional amino acids at the N terminus do not disturb formation of the nucleocapsid. Furthermore, it shows that the His-tag of HisC183 is possibly located at the surface of nucleocapsids, since the particles can be purified on a nickel column (Fig. 2cUp and dUp). It is noted that three bands of HisC183 were observed on the Western blot as compared with one single band of purified HisC183 on the gel stained by Coomassie brilliant blue (Fig. 2aUp, lane 8 vs c, lane 2). This could be because (i) the HisC183 protein inside the bacteria is not completely reduced by DTT while the purified HisC183 is fully reduced, or (ii) degradation of HisC183 occurs inside bacteria while those degraded forms cannot be recovered from the nickel column.

In addition to demonstrating that nucleocapsids are assembled from HisC183 in E. coli, we also showed that nucleocapsids are able to assemble using HisC183 in human hepatoma cells and that they retained kinase and DNA polymerase activities. To date, the role of cellular kinase encapsidated by HBV core particles remains poorly defined. Our current finding provides evidence that the N-terminal additions to the core protein do not interfere in cellular kinase incorporation. Although we did not produce FlagC183 in E. coli to test for nucleocapsid formation, we showed that FlagC183 has all the characteristics of HisC183 in hepatoma cells. Basically, the additional amino acids present in HisC183 or FlagC183 do not disrupt the formation of core dimer, which provides grounds for further polymerization to form particles (Zhou & Standring, 1992Down ). If the intermolecular Cys-61–Cys-61 disulfide bond of core proteins is disrupted, no particles are produced (Conway et al., 1998b Down ).

In this study, we provide additional information on the envelopment of mutant nucleocapsids, since envelopment is one of the critical steps in HBV maturation. Three surface proteins (L-HBsAg, M-HBsAg and S- HBsAg) on the envelope are important for virus maturation and infection (Ueda et al., 1991Down ; Bruss & Ganem, 1991Down ; Le Seyec et al., 1998Down ). The molecular nature of the HBV envelopment signal is still unknown. However, previous reports have suggested that triggering the envelopment signal is linked to genomic replication in the interior of nucleocapsids (Gerelsaikhan et al., 1996Down ; Wei et al., 1996Down ). Such a signal may result in a conformational change in the core proteins and allow interaction between the core proteins and surface proteins to occur. Bottcher et al. (1998)Down have demonstrated that L-HBsAg may bind to Glu-77 and Asp- 78 of the core protein. Therefore, the impairment of envelopment in nucleocapsids assembled from HisC183 and FlagC183 (Fig. 7Up ) is possibly influenced by the six histidines or the five glutamic acids at the N terminus of the core protein (Fig. 1bUp). These N-terminal extensions could either block the envelopment signal or interfere with surface antigen binding to core particles. Based on results of the accessibility of the His-tag and Flag-tag by antibodies (data not shown) or nickel resins (Fig. 2c Up, dUp), we favour the second hypothesis. Nevertheless, further cryoelectron microscopy is required to reveal the structure of HisC183 particles isolated from E. coli , which are easily obtained from the pHisC183-harbouring cells. The structure of HisC183 particles will definitely provide a better conclusion.


   Acknowledgments
 
We gratefully acknowledge Drs Yan-Hwa Wu Lee and Shu-Der Tsen for their critical review of this manuscript and Kathy Sun for English editing. Thanks are also due to Dr Heinz Schaller for providing us the plasmid pMH 3/3097. The assistance of Miss Y.-Y. Yu with electron microscopy is greatly appreciated. This study was supported by grants of NSC86-2315-B010-004-MH and NSC87-2314-B010-043 from the National Science Council. S.J.L. was awarded by the National Science Council and the Medical Research and Advancement Foundation in Memory of Dr Chi- Shuen Tsou.


   References
TOP
Abstract
Introduction
Methods
Results
Discussion
References
 
Albin, C. & Robinson, W. S. (1980). Protein kinase activity in hepatitis B virus. Journal of Virology 34, 297-302.[Abstract/Free Full Text]

Beames, B. & Lanford, R. E. (1995). Insertions within the hepatitis B virus capsid protein influence capsid formation and RNA encapsidation. Journal of Virology 69, 6833-6838 .[Abstract]

Beasley, R. P., Hwang, L. Y., Lin, C. C. & Chien, C. S. (1981). Hepatocellular carcinoma and hepatitis B virus. Lancet ii, 1129–1132.

Birnbaum, F. & Nassal, M. (1990). Hepatitis B virus nucleocapsid assembly: primary structure requirements in the core protein. Journal of Virology 64, 3319-3330 .[Abstract/Free Full Text]

Borisova, G. , Wanst, O. B. , Mezule, G. , Skrastina, D. , Petrovskis, I. , Dislers, A. , Pumpens, P. & Grens, E. (1996). Spatial structure and insertion capacity of immunodominant region of hepatitis B core antigen. Intervirology 39, 16-22.[Medline]

Bottcher, B. , Wynne, S. A. & Crowther, R. A. (1997). Determination of the fold of the core protein of hepatitis B virus by electron cryomicroscopy. Nature 386, 88-91.[Medline]

Bottcher, B. , Tsuji, N. , Takahashi, H. , Dyson, M. R. , Zhao, S. , Crowther, R. A. & Murray, K. (1998). Peptides that block hepatitis B virus assembly: analysis by cryomicroscopy, mutagenesis and transfection. EMBO Journal 17, 6839-6845 .[Medline]

Bruss, V. (1997). A short linear sequence in the pre-S domain of the large hepatitis B virus envelope protein required for virion formation. Journal of Virology 71, 9350-9357 .[Abstract]

Bruss, V. & Ganem, D. (1991). The role of envelope proteins in hepatitis B virus assembly. Proceedings of the National Academy of Sciences, USA 88, 1059-1063 .[Abstract/Free Full Text]

Chang, C. , Jeng, K.-S. , Hu, C.-P. , Lo, S. J. , Su, T.-S. , Ting, L.-P. , Chou, C.-K. , Han, S.-H. , Pfaff, E. , Salfeld, J. & Schaller, H. (1987). Production of hepatitis B virus in vitro by transient expression of cloned HBV DNA in a hepatoma cell line. EMBO Journal 6, 675-680.[Medline]

Chiang, P.-W. , Hu, C.-P. , Su, T.-S. , Lo, S. J. , Chu, M.-H. , Schaller, H. & Chang, C. (1990). Encapsidation of truncated human hepatitis B virus genomes through trans-complementation of the core protein and polymerase. Virology 176, 355-361.[Medline]

Clarke, B. E. , Brown, A. L. , Grace, K. G. , Hastings, G. Z. , Brown, F. , Rowlands, D. J. & Francis, M. J. (1990). Presentation and immunogenicity of viral epitopes on the surface of hybrid hepatitis B virus core particles produced in bacteria. Journal of General Virology 71, 1109-1117 .[Abstract/Free Full Text]

Cohen, B. J. & Richmond, J. E. (1982). Electron microscopy of hepatitis B core antigen synthesized in E. coli. Nature 296, 677-679.[Medline]

Conway, J. F. , Cheng, N. , Zlotnick, A. , Wingfield, P. T. , Stahl, S. J. & Steven, A. C. (1997). Visualization of a 4- helix bundle in the hepatitis B virus capsid by cryo-electron microscopy. Nature 386, 91-94.[Medline]

Conway, J. F. , Cheng, N. , Zlotnick, A. , Stahl, S. J. , Wingfield, P. T. , Belnap, D. M. , Kanngiesser, U. , Noah, M. & Steven, A. C. (1998a). Hepatitis B virus capsid: localization of the putative immunodominant loop (residues 78 to 83) on the capsid surface, and implications for the distinction between c and e-antigens. Journal of Molecular Biology 279, 1111 -1121.[Medline]

Conway, J. F. , Cheng, N. , Zlotnick, A. , Stahl, S. J. , Wingfield, P. T. & Steven, A. C. (1998b). Localization of the N terminus of hepatitis B virus capsid protein by peptide-based difference mapping from cryoelectron microscopy. Proceedings of the National Academy of Sciences, USA 95, 14622 -14627.[Abstract/Free Full Text]

Crowther, R. A. , Kiselev, N. A. , Bottcher, B. , Berriman, J. A. , Borisova, G. P. , Ose, V. & Pumpens, P. (1994). Three-dimensional structure of hepatitis B virus core particles determined by electron cryomicroscopy. Cell 77, 943-950.[Medline]

Dyson, M. R. & Murray, K. (1995). Selection of peptide inhibitors of interactions involved in complex protein assemblies: association of the core and surface antigens of hepatitis B virus. Proceedings of the National Academy of Sciences, USA 92, 2194-2198 .[Abstract/Free Full Text]

Ganem, D. & Varmus, H. E. (1987). The molecular biology of hepatitis B viruses. Annual Review of Biochemistry 56, 651-693.[Medline]

Gerelsaikhan, T. , Tavis, J. E. & Bruss, V. (1996). Hepatitis B virus nucleocapsid envelopment does not occur without genomic DNA synthesis. Journal of Virology 70, 4269-4274 .[Abstract]

Gerlich, W. H. , Goldman, U. , Muller, R. , Stibbe, W. & Wolff, W. (1982). Specificity and localization of the hepatitis B virus-associated protein kinase. Journal of Virology 42, 761-766.[Abstract/Free Full Text]

Graham, F. & van der Eb, A. (1973). A new technique for the assay of infectivity of human adenovirus 5 DNA. Virology 52, 456-457.[Medline]

Halton, T. , Zhou, S. & Standring, D. N. (1992). RNA- and DNA- binding activities in hepatitis B virus capsid protein: a model for their roles in viral replication. Journal of Virology 66, 5232-5241 .[Abstract/Free Full Text]

Hu, J. & Seeger, C. (1997). RNA signals that control DNA replication in hepadnaviruses. Seminars in Virology 8, 205-211.

Hui, E. K.-W. , Chen, K.-L. & Lo, S. J. (1999). Hepatitis B virus maturation is affected by the incorporation of core proteins having a C- terminal substitution of arginine or lysine stretches. Journal of General Virology 80, 2661-2671 .[Abstract/Free Full Text]

Huovila, A.-P. J. , Eder, A. M. & Fuller, S. D. (1992). Hepatitis B surface antigen assembles in a post-ER, pre-Golgi compartment. Journal of Cell Biology 118, 1305-1320 .[Abstract/Free Full Text]

Jeng, K.-S. , Hu, C.-P. & Chang, C. (1991). Differential formation of disulfide linkages in the core antigen of extracellular and intracellular hepatitis B virus core particles. Journal of Virology 65, 3924-3927 .[Abstract/Free Full Text]

Junker, M. , Galle, P. & Schaller, H. (1987). Expression and replication of the hepatitis B virus genome under foreign promoter control. Nucleic Acids Research 15, 10117-10132 .[Abstract/Free Full Text]

Kann, M. & Gerlich, W. H. (1994). Effect of core protein phosphorylation by protein kinase C on encapsidation of RNA within core particles of hepatitis B virus. Journal of Virology 68, 7993-8000 .[Abstract/Free Full Text]

Kau, J.-H. & Ting, L.-P. (1998). Phosphorylation of the core protein of hepatitis B virus by a 46-kilodalton serine kinase. Journal of Virology 72, 3796-3803 .[Abstract/Free Full Text]

Kock, J. , Wieland, S. , Blum, H. & von Weizsacker, F. (1998). Duck hepatitis B virus nucleocapsids formed by N-terminally extended or C-terminally truncated core proteins disintegrate during viral DNA maturation. Journal of Virology 72, 9116-9120 .[Abstract/Free Full Text]

Konig, S. , Beterams, G. & Nassal, M. (1998). Mapping of homologous interaction sites in the hepatitis B virus core protein. Journal of Virology 72, 4997-5005 .[Abstract/Free Full Text]

Laemmli, U. K. (1970). Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature 277, 680-682.

Le Seyec, J. , Chouteau, P. , Cannie, I. , Guguen-Guillouzo, C. & Gripon, P. (1998). Role of the pre-S2 domain of the large envelope protein in hepatitis B virus assembly and infectivity. Journal of Virology 72, 5573-5578 .[Abstract/Free Full Text]

Lin, C.-G. & Lo, S. J. (1992). Evidence for involvement of a ribosomal leaky scanning mechanism in the translation of the hepatitis B virus Pol gene from the viral pregenome RNA. Virology 188, 342-352.[Medline]

Metzger, K. & Bringas, R. (1998). Proline-138 is essential for the assembly of hepatitis B virus core protein. Journal of General Virology 79, 587-590.[Abstract]

Nassal, M. (1992). The arginine-rich domain of the hepatitis B virus core protein is required for pregenome encapsidation and productive viral positive-strand DNA synthesis but not for virus assembly. Journal of Virology 66, 4107-4116 .[Abstract/Free Full Text]

Nassal, M. (1996). Hepatitis B virus morphogenesis. Current Topics in Microbiology and Immunology 214, 297-337.[Medline]

Nassal, M. & Schaller, H. (1993). Hepatitis B virus replication. Trends in Microbiology 1, 221-228.[Medline]

Pasek, M. , Goto, T. , Gilbert, W. , Zink, B. , Schaller, H. , MacKay, P. , Leadbetter, G. & Murray, K. (1979). Hepatitis B virus genes and their expression in E. coli. Nature 282, 575-579.[Medline]

Poisson, F. , Severac, A. , Hourioux, C. , Goudeau, A. & Roingeard, P. (1997). Both pre-S1 and S domains of hepatitis B virus envelope proteins interact with the core particle. Virology 228, 115-120.[Medline]

Pumpens, P. & Grens, E. (1999). Hepatitis B core particles as a universal display model: a structure-function basis for development. FEBS Letters 442, 1-6.[Medline]

Pumpens, P. , Borisova, G. P. , Crowther, R. A. & Grens, E. (1995). Hepatitis B virus core particle as epitope carriers. Intervirology 38, 63-74.[Medline]

Roossinck, M. J. & Siddiqui, A. (1987). In vivo phosphorylation and protein analysis of hepatitis B virus core antigen. Journal of Virology 61, 955-961.[Abstract/Free Full Text]

Sambrook, J., Fritsch, E. F. & Maniatis, T. (1989). Molecular Cloning: A Laboratory Manual, 2nd edn. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory Press .

Sanger, F. , Nicklen, S. & Coulson, A. R. (1977). DNA sequencing with chain-terminating inhibitor. Proceedings of the National Academy of Sciences, USA 74, 5463-5467 .[Abstract/Free Full Text]

Schodel, F. , Peterson, D. & Milich, D. (1996). Hepatitis B virus core and e antigen: immune recognition and use as a vaccine carrier moiety. Intervirology 39, 104-110.[Medline]

Southern, E. M. (1975). Detection of specific sequences among DNA fragments separated by gel electrophoresis. Journal of Molecular Biology 98, 503-517.[Medline]

Stahl, S. , MacKay, P. , Magazin, M. , Bruce, S. A. & Murray, K. (1982). Hepatitis B virus core antigen: synthesis in E. coli and application in diagnosis. Proceedings of the National Academy of Sciences, USA 79, 1606-1616 .[Abstract/Free Full Text]

Summers, J. & Mason, W. S. (1982). Replication of the genome of a hepatitis B-like virus by reverse transcription of an RNA intermediate. Cell 29, 403-415.[Medline]

Szmuness, W. (1978). Hepatocellular carcinoma and the hepatitis B virus: evidence for a causal association. Progress in Medical Virology 24, 40-69.[Medline]

Tiollais, P. , Charnay, P. & Vyas, G. N. (1981). Biology of hepatitis B virus. Science 213, 406-411.[Abstract/Free Full Text]

Ueda, K. , Tsurimoto, T. & Matsubara, K. (1991). Three envelope proteins of hepatitis B virus: large S, middle S, and major S proteins needed for the formation of Dane particles. Journal of Virology 65, 3521-3529 .[Abstract/Free Full Text]

Ulrich, R. , Nassal, M. , Meisel, H. & Kruger, D. H. (1998). Core particles of hepatitis B virus as carrier for foreign epitopes. Advances in Virus Research 50, 141-182.[Medline]

von Weizsacker, F. , Wieland, S. & Blum, H. E. (1996). Inhibition of viral replication by genetically engineered mutants of the duck hepatitis B virus core protein. Hepatology 24, 294-299.[Medline]

Wei, Y. , Tavis, J. E. & Ganem, D. (1996). Relationship between viral DNA synthesis and virion envelopment in hepatitis B viruses. Journal of Virology 70, 6455-6458 .[Abstract]

Yeh, C.-T. & Ou, J.-H. (1991). Phosphorylation of hepatitis B virus precore and core proteins. Journal of Virology 65, 2327-2331 .[Abstract/Free Full Text]

Yu, M. , Miller, R. H. , Emerson, S. & Purcell, R. H. (1996). A hydrophobic heptad repeat of the core protein of woodchuck hepatitis virus is required for capsid assembly. Journal of Virology 70, 7085-7091 .[Abstract/Free Full Text]

Zheng, J. , Schodel, F. & Peterson, D. L. (1992). The structure of hepadnaviral core antigens: identification of free thiols and determination of the disulfide bonding pattern. Journal of Biological Chemistry 267, 9422-9429 .[Abstract/Free Full Text]

Zhou, S. & Standring, D. N. (1992). Hepatitis B virus capsid particles are assembled from core-protein dimer precursors. Proceedings of the National Academy of Sciences, USA 89, 10046-10050 .[Abstract/Free Full Text]

Zlotnick, A. , Cheng, N. , Conway, J. F. , Booy, F. P. , Steven, A. C. , Stahl, S. J. & Wingfield, P. T. (1996). Dimorphism of hepatitis B virus capsids is strongly influenced by the C-terminus of the capsid protein. Biochemistry 35, 7412-7421 .[Medline]

Zlotnick, A. , Cheng, N. , Stahl, S. J. , Conway, J. F. , Steven, A. C. & Wingfield, P. T. (1997). Localization of the C terminus of the assembly domain of hepatitis B virus capsid protein: implications for morphogenesis and organization of encapsidated RNA. Proceedings of the National Academy of Sciences, USA 94, 9556-9561 .[Abstract/Free Full Text]

Received 18 May 1999; accepted 24 June 1999.


This article has been cited by other articles:


Home page
J. Virol.Home page
K. Li, F. Zoulim, C. Pichoud, K. Kwei, S. Villet, J. Wands, J. Li, and S. Tong
Critical Role of the 36-Nucleotide Insertion in Hepatitis B Virus Genotype G in Core Protein Expression, Genome Replication, and Virion Secretion
J. Virol., September 1, 2007; 81(17): 9202 - 9215.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
X. Lu, T. Tran, E. Simsek, and T. M. Block
The Alkylated Imino Sugar, n-(n-Nonyl)-Deoxygalactonojirimycin, Reduces the Amount of Hepatitis B Virus Nucleocapsid in Tissue Culture
J. Virol., November 15, 2003; 77(22): 11933 - 11940.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
S. Le Pogam, T. T.-T. Yuan, G. K. Sahu, S. Chatterjee, and C. Shih
Low-Level Secretion of Human Hepatitis B Virus Virions Caused by Two Independent, Naturally Occurring Mutations (P5T and L60V) in the Capsid Protein
J. Virol., October 1, 2000; 74(19): 9099 - 9105.
[Abstract] [Full Text]


Home page
J. Gen. Virol.Home page
C. Hourioux, A. Touzé, P. Coursaget, and P. Roingeard
DNA-containing and empty hepatitis B virus core particles bind similarly to envelope protein domains
J. Gen. Virol., April 1, 2000; 81(4): 1099 - 1101.
[Abstract] [Full Text]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via CrossRef
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Hui, E. K.-W.
Right arrow Articles by Lo, S. J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Hui, E. K.-W.
Right arrow Articles by Lo, S. J.
Agricola
Right arrow Articles by Hui, E. K.-W.
Right arrow Articles by Lo, S. J.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
INT J SYST EVOL MICROBIOL MICROBIOLOGY J GEN VIROL
J MED MICROBIOL ALL SGM JOURNALS