|
|
||||||||
Animal: DNA Viruses |
Institute of Microbiology and Immunology, School of Life Science, National Yang-Ming University, Taipei, Taiwan 112, Republic of China 1
Author for correspondence: Szecheng J. Lo.Fax +886 2 2821 2880. e-mail losj{at}ym.edu.tw
| Abstract |
|---|
|
|
|---|
| Introduction |
|---|
|
|
|---|
A model of the three-dimensional structure of HBV nucleocapsid has been revealed to a resolution of 35·07·4
by cryoelectron microscopy (Crowther et al., 1994
; Conway et al., 1997
, 1998a
; Zlotnick et al., 1996
, 1997
; Bottcher et al., 1997
, 1998
). The proposed models agree that three regions of core protein, aa 7882, 127130 and 145153, are exposed on the shell of nucleocapsids. Neither the N nor the C terminus of the core protein is on the external surface. The N-terminal portion (aa 1150) of core protein is capable of self- assembling into nucleocapsids even in the absence of the C terminus (Birnbaum & Nassal, 1990
; Nassal, 1992
; Halton et al., 1992
). In contrast, core mutants bearing a small insertion, substitution or deletion in the N-terminal domain of HBV core protein (Beames & Lanford, 1995
; Metzger & Bringas, 1998
; Konig et al., 1998
) or woodchuck hepatitis virus (WHV) core protein (Yu et al., 1996
) fail to form nucleocapsids. However, studies on duck HBV show that the core protein N-terminal additions have various effects on capsid formation depending on the nature of the extension peptides (von Weizsacker et al., 1996
; Kock et al., 1998
). Therefore, the influence of the core protein N terminus on nucleocapsid assembly needs to be further investigated.
Conway et al. (1998b)
used an extraneous octapeptide to demonstrate that the core protein N terminus is localized at the spike near the entrance of the shell. In this study, we constructed and expressed N-terminal extension core proteins which were either rich in a positive charge of histidine (designated HisC183) or rich in a negative charge of glutamic acid (designated FlagC183) to test their effect on nucleocapsid assembly in either a prokaryotic or a eukaryotic system. We also tested similar constructs for their influence on virion formation by trans-supplementing a core- negative HBV clone in HuH-7 hepatoma cells. We have demonstrated that the N-terminal extension of core proteins does not interfere with core protein dimerization (Zheng et al., 1992
; Zhou & Standring, 1992
) and nucleocapsid assembly. Since protein kinase activity has been demonstrated in the HBV nucleocapsid (Albin & Robinson, 1980
; Gerlich et al., 1982
), in which the serine residues located at the C terminus of core protein are the substrate of the HBV-associated kinase (Roossinck & Siddiqui, 1987
; Yeh & Ou, 1991
), we have also shown that the N-terminal core mutants do not interfere with kinase encapsidation. However, the result of blocking nucleocapsids from envelopment by surface antigens supported the hypothesis that the N terminus of the core protein is localized near the surface of the capsid shell.
| Methods |
|---|
|
|
|---|
Plasmids and construction of mutants.
|
Core protein expression in Escherichia coli.
Purification of core protein.
E. coli lysates from the 800 ml culture described above were incubated with Ni2+-chelated HisBind resin (Novagen) in binding buffer (20 mM TrisHCl, pH 7·9, 0·5 M NaCl and 5 mM imidazole) at room temperature for 1 h. After three washes with binding buffer and washing buffer (20 mM TrisHCl, pH 7·9, 0·5 M NaCl and 60 mM imidazole), the proteins were eluted with elute buffer (20 mM TrisHCl, pH 7·9, 0·5 M NaCl and 1 M imidazole) at room temperature for 30 min. The eluate (5 ml) was collected (concentration 0·17 mg/ml) and aliquots (10 µl) were run on 15% SDSPAGE (Laemmli, 1970
) and stained with Coomassie brilliant blue for analysis of protein purity.
CsCl gradient centrifugation.
E. coli lysates or nucleocapsids from media or cell lysate (see below) were resuspended in a high-salt TNE buffer (10 mM TrisHCl, pH 7·4, 150 mM NaCl, 1 mM EDTA and 0·1% sodium azide) and subjected to CsCl centrifugation (average density 1·24 g/ml) at 35000 r.p.m. in an SW41 rotor for 44 h. The gradients (final density 1·11·5 g/ml) were fractionated into 0·5 ml samples from the top to bottom and each fraction was subjected to ELISA for detection of core antigen and/or surface antigen (General Biologicals). The density of individual fractions was determined by the refractive index using a refractometer.
Electron microscopy.
Core particles prepared from Ni2+-chelated HisBind resin and CsCl fractions were collected and spotted onto Formvar-coated grids, then negatively stained with saturated uranyl acetate and visualized in a JEOL JEM-2000ExII transmission electron microscope as described previously (Chang et al., 1987
).
Cell culture and transfection.
Human hepatoma cells (HuH-7) were grown in Dulbecco's modified Eagle's medium supplemented with 10 % foetal bovine serum, 1 mM glutamine, 10 U/ml penicillin and 100 µg/ml streptomycin. HuH-7 cells were transfected with an appropriate amount of plasmid, either singly or in combinations, using the calcium phosphate co-precipitation procedure (Graham & van der Eb, 1973
; Sambrook et al., 1989
). At 3, 6 and 9 days post-transfection, media were harvested for viral particle analysis. At 9 days post-transfection, cells were harvested for analysis of nucleocapsid and viral DNA.
Viral nucleocapsid isolation.
To collect nucleocapsids from intracellular extracts, transfected cells were detached from plates and incubated in PBS with 1% NP-40 at 4 °C overnight (Beames & Lanford, 1995
). After a low-speed centrifugation to remove nuclei and NP-40-insoluble cell debris, the cellular lysate was ready for a further isolation step. To collect nucleocapsids and virion-like particles from culture fluids, the media were incubated with or without detergent (NP-40 to a final concentration of 1%) at room temperature for 2 h before centrifugation. Both samples were clarified by centrifugation at 13000 r.p.m. for 30 min in a JA-20 rotor (Beckman Instruments). The nucleocapsids were then concentrated by further centrifugation at 45000 r.p.m. in a Ti55.2 rotor for 2·5 h while the Dane-like particles were enriched under the same conditions for 5 h. The isolated viral particles were subsequently resuspended in a low-salt TNE buffer (10 mM TrisHCl, pH 7·5, 100 mM NaCl and 1 mM EDTA).
Immunoprecipitation and Western blotting analysis.
The precleared cell lysate was incubated with primary antibodies bound with Sepharoseprotein A or G. Antibodies of rabbit polyclonal anti-core (Dako), mouse monoclonal anti-6xHis (Clontech) and anti-Flag (Kodak) were used. The antigenantibody complexes were precipitated and washed three times with NET buffer (50 mM Tris, pH 7·5, 150 mM NaCl, 0·5 mM EDTA and 0·5% NP-40) and then boiled in sample buffer (Laemmli, 1970
) and analysed by 15% SDSPAGE under reducing (with DTT) or non-reducing (without DTT) conditions. Western blotting was performed by reacting with anti-core, anti-6xHis or anti-Flag antibodies following by reacting with secondary antibodies, conjugated with horseradish peroxidase (Organ Teknika). The blot was developed with an enhanced chemiluminescence (ECL) detection system (Amersham Pharmacia).
In vitro kinase assay.
The immunoprecipitated nucleocapsids were washed three times and then incubated in a kinase reaction buffer (50 mM TrisHCl, pH 7·4, 10 mM MgCl2 and 0·4% NP-40) containing 10 pmol [
-32P]ATP (7000 Ci/mmol; Amersham) as described previously (Jeng et al., 1991
; Lin & Lo, 1992
). After incubation at 37 °C for 1 h, the complex was washed five times with NET buffer and then subjected to 15% SDSPAGE separation and autoradiographed.
Endogenous DNA polymerase assay.
Endogenous DNA polymerase activity was assayed as described previously (Junker et al., 1987
) with some modification (Chiang et al., 1990
; Lin & Lo, 1992
). Briefly, one-fifth of the partially purified viral particle samples was incubated with a pol-mix buffer (50 mM TrisHCl pH 7·4, 40 mM NH4Cl, 5 mM MgCl2, 0·5% NP-40, 0·2% 2- mercaptoethanol and 25 µM each of dATP, dGTP and dTTP) at 37 °C for 2 h in the presence of [
-32 P]dCTP (5000 mCi/mmol; Amersham). Subsequently, a chase was performed for 2 h by adding unlabelled dCTP (25 µM final concentration) at 37 °C. Unwanted nucleic acids present outside of particles were digested by micrococcal nuclease (5 U) for 1 h at 37 °C. Particles were then digested by 50 µg/ml proteinase K treatment in the presence of 1% SDS for 1 h at 37 °C. Glycogen was added (0·8 mg/ml final concentration) and samples were extracted with an equal volume of phenol/chloroform. The labelled DNAs were precipitated with 2·5 vol. ethanol which contained 0·3 M sodium acetate (pH 4·8), separated on 1% agarose gels by electrophoresis, and then autoradiographed.
PCR and Southern hybridization.
In addition to using an endogenous DNA polymerase assay to analyse HBV nucleic acids in secreted viral particles, Dane-like particles collected from CsCl density gradients were subjected to PCR amplification followed by Southern hybridization. Particles were first digested with DNase (10 U) in a DNA buffer (10 mM TrisHCl, pH 8·3, 50 mM KCl and 1·5 mM MgCl2 ) at 37 °C for 1 h and then disrupted by boiling for 10 min (Bottcher et al., 1998
). Viral DNAs were amplified by PCR using the forward primer C401F (5' ATGGACATCGACCCTTATAAAG 3') and the reverse primer S1764R (5' TGTTCCTGAACTGGAGCCACCAGCA 3') for 40 cycles of 96 °C for 1 min, 57 °C for 1 min and 74 °C for 20 s and an additional extension period at 72 °C for 5 min. The amplified DNA products were resolved by electrophoresis on 2% agarose gel and subjected to Southern blot analysis (Southern, 1975
) using a probe containing the 279 bp HBV BamHI/EcoRI fragment (see also Fig. 7 a
).
|
| Results |
|---|
|
|
|---|
|
To clarify whether or not the His-tag of HisC183 is exposed at the surface of nucleocapsids, we used an affinity column to purify HisC183. Results of Ni2+-affinity binding resin showed a single band in a 15% SDSPAGE gel stained with Coomassie brilliant blue (Fig. 2c
), indicating that the His-tag of HisC183 was accessible by nickel resins. Protein concentration analyses revealed that this band comprised approximately 8·5 mg HisC183, which was recovered from the 800 ml overnight culture. However, HisC183 bound on nickel resins could be in monomeric, dimeric or particulate form. Electron microscopic examination revealed that at least some HisC183 proteins, if not all of them, retained the integrity of nucleocapsids as those separated by CsCl gradient (Fig. 2d
).
Dimerization of HBV core proteins with an N-terminal extension in hepatoma cells
Since the core-like particles obtained from E. coli lack several features of nucleocapsids, e.g. encapsidation of viral pregenome and cellular kinases, pHBVHisC183 (Fig. 1a
, line 3) was constructed for expression of HisC183 in HuH-7 hepatoma cells. Another plasmid, pHBVFlagC183 (Fig. 1a
, line 4), was also constructed for expression of FlagC183, which has 10 extra amino acid residues, including five negatively charged glutamic acid residues, at the N terminus of the core protein (see Fig. 1b
). In addition to having a different tag sequence to pHBVC183, pHBVFlagC183 is driven by the cytomegalovirus (CMV) promoter to express FlagC183 and the HBV sequence within it lacks the polyadenlyation signal. To characterize and test the expression of the N-terminal extension mutants, pHBVHisC183 or pHBVFlagC183 were co-transfected with a core-negative plasmid (pHBV
C; Fig. 1a
, line 6) (Hui et al., 1999
) into HuH-7 hepatoma cells. In addition, a full-length HBV-containing plasmid, pMH 3/3097 (Fig. 1a
, line 1), co-transfected with a vector plasmid, pUC-MT (Fig. 1a
, line 7), was used as a positive control. Western blot analyses showed that wild-type and two mutant cores were detected by anti-core antibodies (Fig. 3a
). Migration of wild-type C183, and mutants HisC183 and FlagC183 was as expected, i.e. molecular masses of 21·5, ~24 and ~22 kDa, respectively. With a His-tag or Flag-epitope at the N terminus, HisC183 and FlagC183 could be recognized by anti-His or anti-Flag antibodies, respectively, while wild-type HisC183 could not (Fig. 3a
,
His and
Flag panels). To test whether the His-tagging and Flag- tagging could affect dimer formation of core proteins (Zheng et al. , 1992
; Zhou & Standring, 1992
), samples were analysed under non-reducing conditions. Results showed that a dimer was present in the wild-type C183 as well as in HisC183 and FlagC183 (Fig. 3 b
), indicating that formation of intermolecular disulfide bonds was not inhibited by the extensions of amino acid residues located at the N terminus.
|
PSX, in which the P, S and X genes are deleted and the C gene remains intact (Fig. 1a
C and pHBV
PSX (Fig. 4d
|
|
C, was present in intracellular extracts from both co- transfections with pHBVHisC183 or pHBVFlagC183, together with a core- negative plasmid (pHBV
C) (Fig. 6a
PSX and pHBV
C and a single band of 3·2 kb was seen in pMH 3/3097 and pUC-MT co-transfection (Fig. 6a
C (lane 4), data support the notion that intracellular nucleocapsids formed by HisC183 and FlagC183 remain functional in reverse transcription of the pregenome.
|
C (Fig. 6b
To further confirm that the observation of envelopment impairment occurred in mutant nucleocapsids, a more sensitive assay was carried out. Cell culture media precleared by anti-core antibodies as described above were fractionated by CsCl gradient centrifugation and divided into three tubes: <D, lighter density than Dane particles; D, equal density to Dane particles; and >>D, heavier density than Dane particles. Each tube was subjected to PCR amplification followed by Southern blot analysis for detection of HBV DNA present in the fraction. ELISA analyses of CsCl fractions showed that no naked nucleocapsids were present in any preparations (Fig. 7b
). PCR and Southern blot results showed two bands of 1363 bp and 1046 bp in the sample co-transfected with pHBV
C and pHBV
PSX and a single band of 1363 bp in the sample co- transfected with pMH 3/3097 and pUC-MT (Fig. 7b
), indicating that they were indeed derived from Dane-like particles instead of nucleocapsids in media. Lighter bands present in both <D and >>D tubes of positive control groups might result from the incomplete separation and the oversensitive detection by PCR amplification plus Southern hybridization. Consistent with the DNA repairing assay results, no PCR product was detected in the tubes of <D, D and >>D from samples which were co-transfected with mutant core plasmids and pHBV
C (Fig. 7b
, lanes 712); this strongly suggests that no detectable virion was secreted by these transfected cells. Taking together all results from this study, we conclude that HBV core mutants with an N-terminal extension, HisC183 and FlagC183, can form a functional nucleocapsid intracellularly but are incapable of forming a mature and secretable Dane-like particle.
| Discussion |
|---|
|
|
|---|
In the past, HBV core proteins have been successfully used to express heterologous epitopes in many prokaryotic and eukaryotic systems because of their ability to form particles (see review by Pumpens & Grens, 1999
). In addition, HBV nucleocapsids are exceptionally potent antigens that induce both T-cell-dependent and T-cell-independent responses (see review by Schodel et al., 1996
). Several insertion sites have been tested to improve the immunogenicity of foreign peptides (Clarke et al., 1990
; Pumpens et al., 1995
; Borisova et al., 1996
; Ulrich et al., 1998
). Three insertions, located at aa 13, 7493 and 141183 of core proteins, are found to be regions that are dispensable for nucleocapsid assembly (Pumpens & Grens, 1999
). In this study, the nucleocapsid assembled by HisC183 is consistent with previous studies and gives a new example that additional amino acids at the N terminus do not disturb formation of the nucleocapsid. Furthermore, it shows that the His-tag of HisC183 is possibly located at the surface of nucleocapsids, since the particles can be purified on a nickel column (Fig. 2c
and d
). It is noted that three bands of HisC183 were observed on the Western blot as compared with one single band of purified HisC183 on the gel stained by Coomassie brilliant blue (Fig. 2a
, lane 8 vs c, lane 2). This could be because (i) the HisC183 protein inside the bacteria is not completely reduced by DTT while the purified HisC183 is fully reduced, or (ii) degradation of HisC183 occurs inside bacteria while those degraded forms cannot be recovered from the nickel column.
In addition to demonstrating that nucleocapsids are assembled from HisC183 in E. coli, we also showed that nucleocapsids are able to assemble using HisC183 in human hepatoma cells and that they retained kinase and DNA polymerase activities. To date, the role of cellular kinase encapsidated by HBV core particles remains poorly defined. Our current finding provides evidence that the N-terminal additions to the core protein do not interfere in cellular kinase incorporation. Although we did not produce FlagC183 in E. coli to test for nucleocapsid formation, we showed that FlagC183 has all the characteristics of HisC183 in hepatoma cells. Basically, the additional amino acids present in HisC183 or FlagC183 do not disrupt the formation of core dimer, which provides grounds for further polymerization to form particles (Zhou & Standring, 1992
). If the intermolecular Cys-61Cys-61 disulfide bond of core proteins is disrupted, no particles are produced (Conway et al., 1998b
).
In this study, we provide additional information on the envelopment of mutant nucleocapsids, since envelopment is one of the critical steps in HBV maturation. Three surface proteins (L-HBsAg, M-HBsAg and S- HBsAg) on the envelope are important for virus maturation and infection (Ueda et al., 1991
; Bruss & Ganem, 1991
; Le Seyec et al., 1998
). The molecular nature of the HBV envelopment signal is still unknown. However, previous reports have suggested that triggering the envelopment signal is linked to genomic replication in the interior of nucleocapsids (Gerelsaikhan et al., 1996
; Wei et al., 1996
). Such a signal may result in a conformational change in the core proteins and allow interaction between the core proteins and surface proteins to occur. Bottcher et al. (1998)
have demonstrated that L-HBsAg may bind to Glu-77 and Asp- 78 of the core protein. Therefore, the impairment of envelopment in nucleocapsids assembled from HisC183 and FlagC183 (Fig. 7
) is possibly influenced by the six histidines or the five glutamic acids at the N terminus of the core protein (Fig. 1b
). These N-terminal extensions could either block the envelopment signal or interfere with surface antigen binding to core particles. Based on results of the accessibility of the His-tag and Flag-tag by antibodies (data not shown) or nickel resins (Fig. 2c
, d
), we favour the second hypothesis. Nevertheless, further cryoelectron microscopy is required to reveal the structure of HisC183 particles isolated from E. coli , which are easily obtained from the pHisC183-harbouring cells. The structure of HisC183 particles will definitely provide a better conclusion.
| Acknowledgments |
|---|
| References |
|---|
|
|
|---|
Beames, B. & Lanford, R. E. (1995). Insertions within the hepatitis B virus capsid protein influence capsid formation and RNA encapsidation. Journal of Virology 69, 6833-6838 .[Abstract]
Beasley, R. P., Hwang, L. Y., Lin, C. C. & Chien, C. S. (1981). Hepatocellular carcinoma and hepatitis B virus. Lancet ii, 11291132.
Birnbaum, F. & Nassal, M. (1990). Hepatitis B virus nucleocapsid assembly: primary structure requirements in the core protein. Journal of Virology 64, 3319-3330 .
Borisova, G. , Wanst, O. B. , Mezule, G. , Skrastina, D. , Petrovskis, I. , Dislers, A. , Pumpens, P. & Grens, E. (1996). Spatial structure and insertion capacity of immunodominant region of hepatitis B core antigen. Intervirology 39, 16-22.[Medline]
Bottcher, B. , Wynne, S. A. & Crowther, R. A. (1997). Determination of the fold of the core protein of hepatitis B virus by electron cryomicroscopy. Nature 386, 88-91.[Medline]
Bottcher, B. , Tsuji, N. , Takahashi, H. , Dyson, M. R. , Zhao, S. , Crowther, R. A. & Murray, K. (1998). Peptides that block hepatitis B virus assembly: analysis by cryomicroscopy, mutagenesis and transfection. EMBO Journal 17, 6839-6845 .[Medline]
Bruss, V. (1997). A short linear sequence in the pre-S domain of the large hepatitis B virus envelope protein required for virion formation. Journal of Virology 71, 9350-9357 .[Abstract]
Bruss, V. & Ganem, D. (1991). The role of envelope proteins in hepatitis B virus assembly. Proceedings of the National Academy of Sciences, USA 88, 1059-1063 .
Chang, C. , Jeng, K.-S. , Hu, C.-P. , Lo, S. J. , Su, T.-S. , Ting, L.-P. , Chou, C.-K. , Han, S.-H. , Pfaff, E. , Salfeld, J. & Schaller, H. (1987). Production of hepatitis B virus in vitro by transient expression of cloned HBV DNA in a hepatoma cell line. EMBO Journal 6, 675-680.[Medline]
Chiang, P.-W. , Hu, C.-P. , Su, T.-S. , Lo, S. J. , Chu, M.-H. , Schaller, H. & Chang, C. (1990). Encapsidation of truncated human hepatitis B virus genomes through trans-complementation of the core protein and polymerase. Virology 176, 355-361.[Medline]
Clarke, B. E. , Brown, A. L. , Grace, K. G. , Hastings, G. Z. , Brown, F. , Rowlands, D. J. & Francis, M. J. (1990). Presentation and immunogenicity of viral epitopes on the surface of hybrid hepatitis B virus core particles produced in bacteria. Journal of General Virology 71, 1109-1117 .
Cohen, B. J. & Richmond, J. E. (1982). Electron microscopy of hepatitis B core antigen synthesized in E. coli. Nature 296, 677-679.[Medline]
Conway, J. F. , Cheng, N. , Zlotnick, A. , Wingfield, P. T. , Stahl, S. J. & Steven, A. C. (1997). Visualization of a 4- helix bundle in the hepatitis B virus capsid by cryo-electron microscopy. Nature 386, 91-94.[Medline]
Conway, J. F. , Cheng, N. , Zlotnick, A. , Stahl, S. J. , Wingfield, P. T. , Belnap, D. M. , Kanngiesser, U. , Noah, M. & Steven, A. C. (1998a). Hepatitis B virus capsid: localization of the putative immunodominant loop (residues 78 to 83) on the capsid surface, and implications for the distinction between c and e-antigens. Journal of Molecular Biology 279, 1111 -1121.[Medline]
Conway, J. F. , Cheng, N. , Zlotnick, A. , Stahl, S. J. , Wingfield, P. T. & Steven, A. C. (1998b). Localization of the N terminus of hepatitis B virus capsid protein by peptide-based difference mapping from cryoelectron microscopy. Proceedings of the National Academy of Sciences, USA 95, 14622 -14627.
Crowther, R. A. , Kiselev, N. A. , Bottcher, B. , Berriman, J. A. , Borisova, G. P. , Ose, V. & Pumpens, P. (1994). Three-dimensional structure of hepatitis B virus core particles determined by electron cryomicroscopy. Cell 77, 943-950.[Medline]
Dyson, M. R. & Murray, K. (1995). Selection of peptide inhibitors of interactions involved in complex protein assemblies: association of the core and surface antigens of hepatitis B virus. Proceedings of the National Academy of Sciences, USA 92, 2194-2198 .
Ganem, D. & Varmus, H. E. (1987). The molecular biology of hepatitis B viruses. Annual Review of Biochemistry 56, 651-693.[Medline]
Gerelsaikhan, T. , Tavis, J. E. & Bruss, V. (1996). Hepatitis B virus nucleocapsid envelopment does not occur without genomic DNA synthesis. Journal of Virology 70, 4269-4274 .[Abstract]
Gerlich, W. H. , Goldman, U. , Muller, R. , Stibbe, W. & Wolff, W. (1982). Specificity and localization of the hepatitis B virus-associated protein kinase. Journal of Virology 42, 761-766.
Graham, F. & van der Eb, A. (1973). A new technique for the assay of infectivity of human adenovirus 5 DNA. Virology 52, 456-457.[Medline]
Halton, T. , Zhou, S. & Standring, D. N. (1992). RNA- and DNA- binding activities in hepatitis B virus capsid protein: a model for their roles in viral replication. Journal of Virology 66, 5232-5241 .
Hu, J. & Seeger, C. (1997). RNA signals that control DNA replication in hepadnaviruses. Seminars in Virology 8, 205-211.
Hui, E. K.-W. , Chen, K.-L. & Lo, S. J. (1999). Hepatitis B virus maturation is affected by the incorporation of core proteins having a C- terminal substitution of arginine or lysine stretches. Journal of General Virology 80, 2661-2671 .
Huovila, A.-P. J. , Eder, A. M. & Fuller, S. D. (1992). Hepatitis B surface antigen assembles in a post-ER, pre-Golgi compartment. Journal of Cell Biology 118, 1305-1320 .
Jeng, K.-S. , Hu, C.-P. & Chang, C. (1991). Differential formation of disulfide linkages in the core antigen of extracellular and intracellular hepatitis B virus core particles. Journal of Virology 65, 3924-3927 .
Junker, M. , Galle, P. & Schaller, H. (1987). Expression and replication of the hepatitis B virus genome under foreign promoter control. Nucleic Acids Research 15, 10117-10132 .
Kann, M. & Gerlich, W. H. (1994). Effect of core protein phosphorylation by protein kinase C on encapsidation of RNA within core particles of hepatitis B virus. Journal of Virology 68, 7993-8000 .
Kau, J.-H. & Ting, L.-P. (1998). Phosphorylation of the core protein of hepatitis B virus by a 46-kilodalton serine kinase. Journal of Virology 72, 3796-3803 .
Kock, J. , Wieland, S. , Blum, H. & von Weizsacker, F. (1998). Duck hepatitis B virus nucleocapsids formed by N-terminally extended or C-terminally truncated core proteins disintegrate during viral DNA maturation. Journal of Virology 72, 9116-9120 .
Konig, S. , Beterams, G. & Nassal, M. (1998). Mapping of homologous interaction sites in the hepatitis B virus core protein. Journal of Virology 72, 4997-5005 .
Laemmli, U. K. (1970). Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature 277, 680-682.
Le Seyec, J. , Chouteau, P. , Cannie, I. , Guguen-Guillouzo, C. & Gripon, P. (1998). Role of the pre-S2 domain of the large envelope protein in hepatitis B virus assembly and infectivity. Journal of Virology 72, 5573-5578 .
Lin, C.-G. & Lo, S. J. (1992). Evidence for involvement of a ribosomal leaky scanning mechanism in the translation of the hepatitis B virus Pol gene from the viral pregenome RNA. Virology 188, 342-352.[Medline]
Metzger, K. & Bringas, R. (1998). Proline-138 is essential for the assembly of hepatitis B virus core protein. Journal of General Virology 79, 587-590.[Abstract]
Nassal, M. (1992). The arginine-rich domain of the hepatitis B virus core protein is required for pregenome encapsidation and productive viral positive-strand DNA synthesis but not for virus assembly. Journal of Virology 66, 4107-4116 .
Nassal, M. (1996). Hepatitis B virus morphogenesis. Current Topics in Microbiology and Immunology 214, 297-337.[Medline]
Nassal, M. & Schaller, H. (1993). Hepatitis B virus replication. Trends in Microbiology 1, 221-228.[Medline]
Pasek, M. , Goto, T. , Gilbert, W. , Zink, B. , Schaller, H. , MacKay, P. , Leadbetter, G. & Murray, K. (1979). Hepatitis B virus genes and their expression in E. coli. Nature 282, 575-579.[Medline]
Poisson, F. , Severac, A. , Hourioux, C. , Goudeau, A. & Roingeard, P. (1997). Both pre-S1 and S domains of hepatitis B virus envelope proteins interact with the core particle. Virology 228, 115-120.[Medline]
Pumpens, P. & Grens, E. (1999). Hepatitis B core particles as a universal display model: a structure-function basis for development. FEBS Letters 442, 1-6.[Medline]
Pumpens, P. , Borisova, G. P. , Crowther, R. A. & Grens, E. (1995). Hepatitis B virus core particle as epitope carriers. Intervirology 38, 63-74.[Medline]
Roossinck, M. J. & Siddiqui, A. (1987). In vivo phosphorylation and protein analysis of hepatitis B virus core antigen. Journal of Virology 61, 955-961.
Sambrook, J., Fritsch, E. F. & Maniatis, T. (1989). Molecular Cloning: A Laboratory Manual, 2nd edn. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory Press .
Sanger, F. , Nicklen, S. & Coulson, A. R. (1977). DNA sequencing with chain-terminating inhibitor. Proceedings of the National Academy of Sciences, USA 74, 5463-5467 .
Schodel, F. , Peterson, D. & Milich, D. (1996). Hepatitis B virus core and e antigen: immune recognition and use as a vaccine carrier moiety. Intervirology 39, 104-110.[Medline]
Southern, E. M. (1975). Detection of specific sequences among DNA fragments separated by gel electrophoresis. Journal of Molecular Biology 98, 503-517.[Medline]
Stahl, S. , MacKay, P. , Magazin, M. , Bruce, S. A. & Murray, K. (1982). Hepatitis B virus core antigen: synthesis in E. coli and application in diagnosis. Proceedings of the National Academy of Sciences, USA 79, 1606-1616 .
Summers, J. & Mason, W. S. (1982). Replication of the genome of a hepatitis B-like virus by reverse transcription of an RNA intermediate. Cell 29, 403-415.[Medline]
Szmuness, W. (1978). Hepatocellular carcinoma and the hepatitis B virus: evidence for a causal association. Progress in Medical Virology 24, 40-69.[Medline]
Tiollais, P. , Charnay, P. & Vyas, G. N. (1981). Biology of hepatitis B virus. Science 213, 406-411.
Ueda, K. , Tsurimoto, T. & Matsubara, K. (1991). Three envelope proteins of hepatitis B virus: large S, middle S, and major S proteins needed for the formation of Dane particles. Journal of Virology 65, 3521-3529 .
Ulrich, R. , Nassal, M. , Meisel, H. & Kruger, D. H. (1998). Core particles of hepatitis B virus as carrier for foreign epitopes. Advances in Virus Research 50, 141-182.[Medline]
von Weizsacker, F. , Wieland, S. & Blum, H. E. (1996). Inhibition of viral replication by genetically engineered mutants of the duck hepatitis B virus core protein. Hepatology 24, 294-299.[Medline]
Wei, Y. , Tavis, J. E. & Ganem, D. (1996). Relationship between viral DNA synthesis and virion envelopment in hepatitis B viruses. Journal of Virology 70, 6455-6458 .[Abstract]
Yeh, C.-T. & Ou, J.-H. (1991). Phosphorylation of hepatitis B virus precore and core proteins. Journal of Virology 65, 2327-2331 .
Yu, M. , Miller, R. H. , Emerson, S. & Purcell, R. H. (1996). A hydrophobic heptad repeat of the core protein of woodchuck hepatitis virus is required for capsid assembly. Journal of Virology 70, 7085-7091 .
Zheng, J. , Schodel, F. & Peterson, D. L. (1992). The structure of hepadnaviral core antigens: identification of free thiols and determination of the disulfide bonding pattern. Journal of Biological Chemistry 267, 9422-9429 .
Zhou, S. & Standring, D. N. (1992). Hepatitis B virus capsid particles are assembled from core-protein dimer precursors. Proceedings of the National Academy of Sciences, USA 89, 10046-10050 .
Zlotnick, A. , Cheng, N. , Conway, J. F. , Booy, F. P. , Steven, A. C. , Stahl, S. J. & Wingfield, P. T. (1996). Dimorphism of hepatitis B virus capsids is strongly influenced by the C-terminus of the capsid protein. Biochemistry 35, 7412-7421 .[Medline]
Zlotnick, A. , Cheng, N. , Stahl, S. J. , Conway, J. F. , Steven, A. C. & Wingfield, P. T. (1997). Localization of the C terminus of the assembly domain of hepatitis B virus capsid protein: implications for morphogenesis and organization of encapsidated RNA. Proceedings of the National Academy of Sciences, USA 94, 9556-9561 .
Received 18 May 1999;
accepted 24 June 1999.
This article has been cited by other articles:
![]() |
K. Li, F. Zoulim, C. Pichoud, K. Kwei, S. Villet, J. Wands, J. Li, and S. Tong Critical Role of the 36-Nucleotide Insertion in Hepatitis B Virus Genotype G in Core Protein Expression, Genome Replication, and Virion Secretion J. Virol., September 1, 2007; 81(17): 9202 - 9215. [Abstract] [Full Text] [PDF] |
||||
![]() |
X. Lu, T. Tran, E. Simsek, and T. M. Block The Alkylated Imino Sugar, n-(n-Nonyl)-Deoxygalactonojirimycin, Reduces the Amount of Hepatitis B Virus Nucleocapsid in Tissue Culture J. Virol., November 15, 2003; 77(22): 11933 - 11940. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Le Pogam, T. T.-T. Yuan, G. K. Sahu, S. Chatterjee, and C. Shih Low-Level Secretion of Human Hepatitis B Virus Virions Caused by Two Independent, Naturally Occurring Mutations (P5T and L60V) in the Capsid Protein J. Virol., October 1, 2000; 74(19): 9099 - 9105. [Abstract] [Full Text] |
||||
![]() |
C. Hourioux, A. Touzé, P. Coursaget, and P. Roingeard DNA-containing and empty hepatitis B virus core particles bind similarly to envelope protein domains J. Gen. Virol., April 1, 2000; 81(4): 1099 - 1101. [Abstract] [Full Text] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| INT J SYST EVOL MICROBIOL | MICROBIOLOGY | J GEN VIROL |
| J MED MICROBIOL | ALL SGM JOURNALS | |