J Gen Virol Email Content Delivery
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via CrossRef
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Hui, E. K.-W.
Right arrow Articles by Lo, S. J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Hui, E. K.-W.
Right arrow Articles by Lo, S. J.
Agricola
Right arrow Articles by Hui, E. K.-W.
Right arrow Articles by Lo, S. J.
Journal of General Virology (1999), 80, 2661-2671.
© 1999 Society for General Microbiology


Animal: DNA Viruses

Hepatitis B virus maturation is affected by the incorporation of core proteins having a C-terminal substitution of arginine or lysine stretches

Eric Ka-Wai Hui1, Kun-Lin Chen1 and Szecheng J. Lo1

Institute of Microbiology and Immunology, School of Life Science, National Yang-Ming University, Taipei, Taiwan 112, Republic of China 1

Author for correspondence: Szecheng J. Lo.Fax +886 2 2821 2880. e-mail losj{at}ym.edu.tw


   Abstract
TOP
Abstract
Introduction
Methods
Results
Discussion
References
 
Assembly of replication-competent hepadnavirus nucleocapsids requires interaction of core protein, polymerase and encapsidation signal ({epsilon}) with viral pregenomic RNA. The N-terminal portion (aa 1–149) of the core protein is able to self-assemble into nucleocapsids, whereas the C-terminal portion (aa 150–183) is known to interact with pregenomic RNA. In this study, two hepatitis B virus (HBV) core mutants (C144Arg and C144Lys) in which the C-terminal SPRRR (Ser-Pro-Arg-Arg-Arg) motif was replaced by a stretch of arginine or lysine residues were generated to test their role in pregenome encapsidation and virus maturation. Mutant or wild-type core-expression plasmids were co-transfected with a core-negative plasmid into human hepatoma HuH-7 cells to compare trans-complementation efficiency for virus replication. Both low- and high-density capsids were present in the cytoplasm and culture medium of HuH-7 cells in all transfections. Nucleocapsids formed by C144Arg and C144Lys, however, lost the endogenous polymerase activity to repair HBV DNA. Furthermore, in co-transfection of pHBVC144Arg or pHBVC144Lys with a plasmid which produces replication-competent nucleocapsids, the HBV DNA repairing signal was reduced 40- to 80-fold. This is probably due to formation of mosaic particles of wild-type and mutant cores. Results indicated that the SPRRR motif at the core protein C terminus is important for HBV DNA replication and maturation. Additionally, triple-plasmid transfection experiments showed that nucleocapsids containing various amounts of C144Arg and wild-type core proteins exhibited a bias in selecting a shorter pregenome for encapsidation and DNA replication. It is therefore suggested that unknown factors are also involved in HBV pregenome packaging.


   Introduction
TOP
Abstract
Introduction
Methods
Results
Discussion
References
 
Human hepatitis B virus (HBV), woodchuck hepatitis virus, ground squirrel hepatitis virus and duck hepatitis B virus (DHBV) are members of the family Hepadnaviridae (Gust et al., 1986Down ). Hepadnaviruses are partially double-stranded DNA viruses which have a typical icosahedral nucleocapsid and are enveloped by a lipid bilayer with surface antigens (Tiollais et al., 1981Down ; Ganem & Varmus, 1987Down ). HBV DNA is 3·2 kb long and encodes core (C), polymerase (P), surface ( S) and X genes. The virus replicates its DNA genome through reverse transcription of its pregenomic RNA intermediate (Summers & Mason, 1982Down ; Ganem & Varmus, 1987Down ; Nassal & Schaller, 1993Down ). This reaction takes place inside the nucleocapsid which consists of a shell of 180 or 240 subunits of the core protein. Hence, packaging of the viral pregenomic RNA into the nucleocapsid is a crucial function of the core protein (Nassal & Schaller, 1993Down ; Nassal, 1996Down ). The highly selective packaging of the pregenomic RNA into replication-competent viral nucleocapsids requires the cooperation of core protein, viral polymerase (Hirsch et al., 1990)Down and a packaging signal ({epsilon}) on the pregenomic RNA (Junker-Niepmann et al., 1990Down ). Although the DNA polymerase of hepadnaviruses is active in the absence of nucleocapsid (Wang & Seeger, 1992Down ; Seifer & Standring, 1993Down ; Tavis & Ganem, 1993Down ), transient transfection experiments have indicated that both HBV (Nassal, 1992Down ) and DHBV (Schlicht et al., 1989Down ; Yu & Summers, 1991Down ) core protein are essential for viral DNA maturation.

The HBV core protein contains either 183 or 185 aa, depending on the virus subtype, ayw, adr or adw (Tiollais et al., 1981Down ). Core proteins expressed in bacteria can self-assemble into nucleocapsid-like particles (Cohen & Richmond, 1982Down ; Nassal, 1988Down ; Gallina et al., 1989Down ; Birnbaum & Nassal, 1990Down ; Kann & Gerlich, 1994Down ) and can encapsidate RNA nonspecifically (Pasek et al., 1979Down ). Studies using truncated HBV core protein have also shown that aa 10–144 are responsible for self-assembly into nucleocapsids (Gallina et al., 1989Down ; Birnbaum & Nassal, 1990Down ; Zheng et al. , 1992Down ). In addition, the C terminus of the core protein is required for pregenome encapsidation and modulates the activity of polymerase for reverse transcription of the RNA pregenome and binding to the elongating DNA (Hatton et al., 1992Down ; Nassal, 1992Down ).

The C-terminal 33 aa of HBV core proteins contain 16 (adr and ayw) or 17 (adw) arginine (R) residues; 14 of them are clustered into four arginine repeats (I–IV) (Tiollais et al., 1981Down ). Previous studies have indicated that this arginine-rich domain is important for pregenome encapsidation and genomic DNA binding (Birnbaum & Nassal, 1990Down ; Hatton et al., 1992Down ; Nassal, 1992Down ). In the HBV core protein, the arginine-rich domain appears in three SPRRR (Ser- Pro-Arg-Arg-Arg) motifs. In the DHBV core protein, the nucleic acid- binding domain is located at aa 181–228, which has ten arginine and five lysine residues but no SPRRR motif (Sprengel et al., 1985Down ). It is therefore of interest to know whether an HBV core protein in which the C-terminal SPRRR motif is replaced by a stretch of arginine or lysine residues, similar to that of DHBV, still retains its function for pregenome encapsidation and viral DNA maturation.


   Methods
TOP
Abstract
Introduction
Methods
Results
Discussion
References
 
{blacksquare} Plasmid constructions.
Cloning of various plasmids was performed by standard techniques (Sambrook et al., 1989Down ). HBV plasmid pMH 3/3097 (Fig. 1aDown, line 1) of subtype ayw (Junker et al., 1987Down ) was obtained from Heinz Schaller (University of Heidelberg, Germany). pHBVC144+6 (Fig. 1 aDown, line 2) is an expression construct for C-terminal truncated core protein (C144+6) harbouring 144 aa of core protein and 6 aa (Fig. 1bDown) encoded by a synthetic linker. This construct was generated from pMH 3/3097 by cleavage at the unique BspE1 and NcoI site followed by adding a synthetic linker containing EcoRI and XhoI cutting site and stop codons: 5' CCGGGAATTCCTCGAGTAGTCTAGACTAG 3' and 3' CTTAAGGAGCTCATCAGATCTGATCGTAG 5'. pHBVC144Arg ( Fig. 1aDown, line 3) is an expression construct for truncated and mutated core protein (C144Arg) which is composed of 144 aa from HBV core protein plus seven arginine residues and seven amino acids (Fig. 1bDown) encoded by a synthetic linker. For construction, pHBVC144+6 was cut by Eco RI and XhoI. A specific in-frame polyarginine linker (5' AATTCGCCGCCGCCGCCGCCGCCGC 3' and 3' GCGGCGGCGGCGGCGGCGGCGAGCT 5') was ligated to the EcoRI- and XhoI-digested pHBVC144+6. pHBVC144Lys (Fig. 1 aDown, line 4) is an expression construct for truncated and mutated core protein (C144Lys; Fig. 1bDown) which is composed of 144 aa from HBV core protein plus seven lysine residues and seven amino acids encoded by a synthetic linker. The specific in-frame duplex of polylysine linker (5' AATTAAGAAGAAGAAGAAGAAGAAG 3' and 3' TTCTTCTTCTTCTTCTTCTTCAGCT 5') was inserted into the Eco RI and XhoI site of plasmid pHBVC144+6. pHBV{Delta}PSX ( Fig. 1aDown, line 5) was constructed by deleting the 1·3 kb XhoI/AatII HBV fragment encompassing P, S and X genes from pMH 3/3097. pHBV{Delta}C (Fig. 1aDown, line 6) was constructed by replacing the 2·4 kb XbaI (filled- in)/SphI fragment from the pMH 3/3097 with the 2·2 kb HindIII (filled-in)/SphI fragment from the pHBVP (Lin & Lo, 1992Down ; Lin et al., 1995Down ). For construction of control plasmid pUC-MT (without HBV sequence; Fig. 1aDown, line 9), the HindIII/SmaI HBV fragment was excised from pMH 3/3097. All junctions of new clones were verified by DNA sequencing (Sanger et al., 1977Down ) using a commercial kit (Amersham Pharmacia Biotech).



View larger version (26K):
[in this window]
[in a new window]
 
Fig. 1. Diagrammatic representation of plasmids used in this study and characteristics of C termini of four core proteins. (a) The designation of plasmids is shown at the left of lines 1–9. Plasmids are shown by a partial sequence which contains the HBV DNA and the metallothionein or cytomegalovirus promoter (arrows marked MT and CMV, respectively). The boxes above the restriction enzyme map represent the HBV genes in which the shaded box marks the redundant core gene. Common restriction enzyme cutting sites used for cloning have also been indicated. The thick line on plasmids represents the HBV DNA sequence; {epsilon} indicates the HBV pregenome packaging signal; the diamond symbol indicates the HBV polyadenylation signal. The thin line shown by an inverted V-shape is the region of HBV DNA deletion. The stop codon linker (Stop), modified arginine stretch linker (ArgX7), lysine stretch linker (LysX7) and an opal stop codon (TGA) are indicated. (b) Comparison between the C-terminal amino acid sequences of the wild-type (C183) and mutants (C144+6, C144Arg, and C144Lys). The amino acid changes with respect to the wild- type sequence are underlined, the motif of SPRRR is boxed and the phosphorylation sites are marked with asterisks. Numbers indicate the amino acid positions.

 
{blacksquare} Cell culture and transfection.
The human hepatoma cells HuH-7 were grown in Dulbecco's modified Eagle's medium supplemented with 10% foetal bovine serum, 1 mM glutamine, 10 U/ml penicillin and 100 µg/ml streptomycin. For transfection, HuH-7 cells were transfected with the appropriate plasmids alone or in combination, using the calcium phosphate co-precipitation procedure (Graham & van der Eb, 1973Down ; Sambrook et al., 1989Down ). At 3, 6 and 9 days post-transfection, medium was harvested for virus isolation. At 9 days post-transfection, cells were harvested for analysis of cellular nucleocapsid and viral DNA.

{blacksquare} Immunoprecipitation and Western blotting analysis.
Transfected HuH-7 cells were lysed in NET buffer (50 mM Tris, pH 7·5, 150 mM NaCl, 0·5 mM EDTA and 0·5% NP-40). Lysates were centrifuged to remove insoluble cell debris and were cleared by protein A–Sepharose (Amersham Pharmacia Biotech). The supernatant was then incubated with rabbit anti- core (Dako) or mouse anti-Flag (M2; Eastman Kodak) antiserum with protein A–Sepharose complexes. The beads were subsequently washed four times with NET buffer and the complexes were boiled in reducing sample buffer and resolved by 15% SDS–PAGE (Laemmli, 1970Down ). Western blotting was then performed as described by Towbin et al. (1979)Down and a protein–antibody complex was detected by rabbit anti-core antibody and subsequently developed by enhanced chemiluminescence.

{blacksquare} Viral nucleocapsid isolation.
To collect nucleocapsids from intracellular extract, transfected cells were collected and incubated in PBS with 1% NP-40 at 4 °C overnight (Beames & Lanford, 1995Down ). After a low-speed centrifugation to remove nuclei and NP-40-insoluble cell debris, the cellular lysate was collected. To collect nucleocapsids from culture fluids, the media were incubated with NP-40 to a final concentration of 1% at room temperature for 2 h and then clarified by centrifugation at 13000 r.p.m. in a JA-20 rotor for 30 min. The viral nucleocapsids from cellular lysate and medium were then concentrated by centrifugation at 45000 r.p.m. in a Ti55.2 rotor for 2·5 h. The isolated viral nucleocapsids were resuspended in low-salt TNE buffer (10 mM Tris–HCl, pH 7·5, 100 mM NaCl and 1 mM EDTA).

{blacksquare} CsCl gradient centrifugation.
The isolated nucleocapsids were resuspended in high-salt TNE buffer (10 mM Tris–HCl, pH 7·4, 150 mM NaCl, 1 mM EDTA and 0·1% sodium azide) and subjected to CsCl centrifugation (average density 1·24 g/ml, final density 1·1–1·5 g/ml) at 35000 r.p.m. in an SW41 rotor for 44 h. The gradients were fractionated into 0·5 ml samples from the top and each fraction was subjected to ELISA for detection of core antigen (General Biologicals). The density of individual fractions was determined by the refractive index using a refractometer.

{blacksquare} Endogenous DNA polymerase assay.
Endogenous DNA polymerase activity assay was performed as described previously (Junker et al., 1987Down ) with modification (Chiang et al., 1990Down ; Lin & Lo, 1992Down ). Briefly, one-fifth of the partially purified virus particle samples was incubated with pol-mix buffer (50 mM Tris–HCl, pH 7·4, 40 mM NH4Cl, 5 mM MgCl2 , 0·5% NP-40, 0·2% 2-mercaptoethanol, and 25 µM each of dATP, dGTP and dTTP) at 37 °C for 2 h in the presence of [{alpha}-32P]dCTP (5000 mCi/mmol; Amersham). Subsequently, a chase was performed for 2 h by adding unlabelled dCTP (25 µM final concentration) at 37 °C. Contaminated nucleic acids were digested by micrococcal nuclease (5 U) for 1 h at 37 °C. Proteins were digested by 50 µg/ml proteinase K treatment in the presence of 1% SDS for 1 h at 37 °C. If necessary, 32 P-labelled 3/3097 HindIII-digested plasmid (6·4 kb) was added as a control for technical error. Glycogen was added (0·8 mg/ml final concentration) and samples were then extracted with an equal volume of phenol/chloroform. An aqueous portion was then collected and desalted, and unincorporated dNTPs were removed by a 1 ml Sephadex G-50 gel filtration column in TE buffer (10 mM Tris–HCl, pH 7·5 and 0·1 mM EDTA). The labelled DNA species were adjusted to 0·3 M sodium acetate (pH 4·8) and then precipitated with 2·5 vol. ethanol; DNAs were then separated on 1% agarose gels by electrophoresis and autoradiographed.

{blacksquare} In vitro kinase assay.
The immunoprecipitated nucleocapsids were washed three times and then incubated in kinase reaction buffer (50 mM Tris–HCl, pH 7·4, 10 mM MgCl2 and 0·4% NP-40) and 10 pmol [{gamma}-32P]ATP (7000 Ci/mmol; Amersham) as described previously (Jeng et al., 1991Down ; Lin & Lo, 1992Down ). After incubation at 37 °C for 1 h, the complex was washed five times with NET buffer and then subjected to SDS–PAGE (15%) separation and autoradiographed.


   Results
TOP
Abstract
Introduction
Methods
Results
Discussion
References
 
Characteristics and expression of mutant core proteins
To test whether mutated HBV core proteins in which the C-terminal protamine-like domain was substituted by a stretch of arginine or lysine residues still retained the function for pregenome encapsidation and viral maturation, we constructed two plasmids, pHBVC144Arg and pHBVC144Lys (Fig. 1aUp, lines 3 and 4). They encode mutated core proteins, C144Arg and C144Lys, respectively. Fig. 1(b)Up shows the features of the C terminus in wild-type C183 and core mutants C144+6, C144Arg and C144Lys. C183 has three stretches of SPRRR motifs whereas C144Arg and C144Lys have 25 aa less than C183 but contain seven extra arginine or lysine residues in a stretch to replace an SPRRR sequence of C183. The mutant C144+6 has a truncation to residue 144, followed by a non-specific 6 aa C-terminal tail (GIPRVV).

After transfection with each plasmid expressing wild-type or mutant core proteins into HuH-7 cells, immunoprecipitation by anti-core antibodies followed by Western blot analysis showed that the migration of the mutated core proteins (C144Arg and C144Lys) was faster than that of the wild-type C183 (Fig. 2 Down, lanes 3 and 4 vs lane 1). This was expected because the mutated core proteins possess 25 aa residues less at the C terminus. Nevertheless, the expression efficiency of mutated core proteins was similar to that of the wild-type core in HuH-7 cells, which were transfected with an equal amount of corresponding plasmids (Fig. 2Down).



View larger version (45K):
[in this window]
[in a new window]
 
Fig. 2. Western blot analysis of core protein expression in transfected cells. HuH-7 cells transfected with pMH 3/3097 (lane 1), pUC-MT (lane 2), pHBVC144Arg+pHBV{Delta}C (lane 3) and pHBVC144Lys+pHBV{Delta}C (lane 4) were lysed and immunoprecipitated with anti-core antiserum followed by Western blot analysis. The position of a molecular mass (kDa) marker is indicated on the left. The designation of core proteins in each transfection is shown at the top of the gel.

 
Formation of heavy particles from the mutant core proteins
Mutations introduced into the C terminus of the core protein cause mutations in the polymerase coding region which interferes with virus replication. In order to complement this function, pHBV{Delta}C ( Fig. 1aUp, line 6) was used in co-transfections to supply polymerase and pregenomic RNA. For comparison with normal core protein, another plasmid, pHBV{Delta}PSX, which has a deletion of large portions of the P, S and X genes, was constructed (Fig. 1aUp, line 5). To probe whether the mutant core proteins can assemble into particles from co- transfections with complement plasmids, an isopycnic CsCl density gradient centrifugation was performed (see Methods). As shown in Fig. 3Down, wild-type and C-terminal arginine- or lysine-substituted core proteins from both intracellular or extracellular (media) fractions appeared in two peaks with densities of 1·18–1·20 g/ml and 1·26–1·31 g/ml, respectively, corresponding to the density of light (empty) and heavy core particles ( Fig. 3 aDown, bDown and cDown). Results also indicated that both C144Arg and C144Lys assembled into light nucleocapsids to a lesser degree than heavy nucleocapsids. In contrast, few heavy core particles were formed by the C-terminal truncation core protein (C144+6) (Fig. 3dDown), implying that the positively charged amino acid residues present at the C terminus of C183, C144Arg and C144Lys might recruit nucleic acids into the heavy particles. In addition, an increased secretion of heavy core particles was observed in C144Arg- and C144Lys-expressing cells.



View larger version (27K):
[in this window]
[in a new window]
 
Fig. 3. Density gradient analysis of medium- (right-hand column) and cytoplasm-derived (left-hand column) HBV particles. HuH-7 cells were transfected with plasmids as indicated in Fig. 2Up and samples were subjected to CsCl gradient density sedimentation as described in the Methods. Twenty fractions (500 µl each) were collected and analysed for the presence of core protein by ELISA. The density (g/ml) of individual fractions is shown (dotted line) in each panel. The closed circles show the ELISA OD490 readings in each fraction.

 
Nucleocapsids formed by mutant core proteins lose the endogenous polymerase activity
To further elucidate whether the nucleocapsids formed by mutant core proteins could specifically encapsidate HBV nucleic acids and retain a functional viral polymerase, an endogenous polymerase activity assay (so-called DNA repairing assay) was performed on nucleocapsids obtained from intracellular extracts and media of the complementation experiments. As shown in Fig. 4Down , nucleocapsids encoded by the wild- type HBV-containing plasmid (pMH 3/3097; Fig. 1aUp, line 1) produced a single band of 3·2 kb from the intracellular extract and medium (Fig. 4Down, lanes 2 and 6, respectively). Nucleocapsids from co-transfection of pHBV{Delta}C and pHBV{Delta}PSX also produced two distinct bands of 3·0 kb (expected from pHBV{Delta}C) and 1·9 kb (expected from pHBV{Delta}PSX) from the intracellular extract and medium ( Fig. 4Down, lanes 1 and 5, respectively). The intensity of two bands of 3·0 kb and 1·9 kb was in a ratio of about 2:1, as quantified by densitometry. However, both nucleocapsids from co-transfection of pHBVC144Arg or pHBVC144Lys with pHBV{Delta}C in the intracellular extract or medium produced neither a 3·0 kb band (expected from pHBV{Delta}C) nor a 1·0 kb band (expected from pHBVC144Arg or pHBVC144Lys) after endogenous polymerase reaction (Fig. 4Down, lanes 3, 4 and 7, 8, respectively). Taking all results together, we suggest that C144Arg and C144Lys do not have fully functional endogenous polymerase activity as in the wild-type C183 (Fig. 4Down, lanes 3, 4 and 7, 8 vs. lane 1 and 5), although they could form heavy nucleocapsids.



View larger version (68K):
[in this window]
[in a new window]
 
Fig. 4. Autoradiograph of endogenous polymerase reaction products. HuH-7 cells were transfected with various plasmids as specified (+) on the top of the gel. Viral nucleocapsids derived from each transfection in intracellular extracts (lanes 1–4) or medium (lane 5–8) were analysed by endogenous polymerase reaction and the products were separated on agarose gel and visualized by autoradiography of the dried gel. The sample loading amount in lanes 2 and 6 was 10-fold less than in the other lanes. The positions of the 32P-labelled {lambda} HindIII marker (bp) are shown on the left, according to lane M. The arrows on the right indicate the positions of the repaired DNA signal from the transfected plasmids.

 
Co-expression of mutant and wild-type core proteins reduced the level of virus maturation
Since the core mutants C144Arg or C144Lys failed to show replication competence by the endogenous polymerase assay, it was interesting to know whether these mutants could influence the function of wild-type core proteins in viral pregenome encapsidation and genome maturation. HuH-7 cells were co-transfected with wild-type plasmids (pMH 3/3097) and mutant plasmids (pHBVC144Arg or pHBVC144Lys) in a ratio of 1:9 and the intracellular nucleocapsids were analysed by endogenous polymerase activity. Two notable features were observed. (1) The intensity of the repaired 3·2 kb DNA band expected from the pregenome transcribed by pMH 3/3097 was reduced about 40- to 80-fold in the presence of C144Arg or C144Lys (Fig. 5Down, lanes 3 and 4). (2) Trans- complementation occurred between the wild-type and mutant core pregenome and resulted in the appearance of 1·0 kb HBV DNA (expected from pHBVC144Arg or pHBVC144Lys; see Fig. 5Down, lanes 3 and 4). Consistently, an 8- to 40-fold reduction in repaired full-length HBV DNA was observed in co-transfection with two other core mutants, pFlagC151 and pHBVC144+6 (Fig. 1aUp, lines 7 and 2, respectively), with pMH 3/3097, but no trans- complementation was detected by the appearance of a second band of repaired HBV DNA (Fig. 5Down, lanes 5 and 6). To rule out the possibility that the reduction of 3·2 kb DNA in the co- transfection experiments was due to a technical error, the 6·4 kb 32P-labelled plasmid was added in the samples during viral DNA preparation. The 6·4 kb band of similar intensity shown in all conditions supported the notion that C144Arg and C144Lys exerted a dominant, negative effect on HBV replication.



View larger version (63K):
[in this window]
[in a new window]
 
Fig. 5. Interference of core mutants with HBV replication. HuH-7 cells were transfected with specified plasmids at various amounts (µg) as indicated on the top of the gel. In total, 40 µg DNA was used in each transfection, in which 4 µg wild-type HBV DNA containing plasmid (pMH 3/3097) was constantly used with 36 µg DNA from other mutants. Viral nucleocapsids derived from each transfection in intracellular extracts were analysed by endogenous polymerase reaction. The positions of the 32P-labelled {lambda} HindIII marker (bp) are shown on the left, according to lane M. The top arrow on the right marks the added 32P- labelled plasmid as an internal control in the endogenous polymerase assay. The second and third arrows on the right indicate the positions of the repaired DNA of 3·2 and 1·0 kb, respectively, from the transfected plasmids.

 
Mosaic particles formed by the full-length and C-terminal truncated core proteins retained the kinase activity
To confirm that the dominant negative effect exerted by C144Arg and C144Lys was indeed through the formation of mosaic nucleocapsids with wild-type C183, we used two core proteins, HisC183 with a His-tag fused with full-length core protein (Fig. 1aUp, line 8) and FlagC151 with a Flag-tag fused with core protein truncated to residue 151 (Fig. 1aUp, line 7), to examine the possibility of forming mosaic particles. After a 3 day transfection with various combinations of plasmids, nucleocapsids were harvested with anti-core or anti-Flag antibodies from cell extracts and assayed for kinase activity in vitro. As shown in Fig. 6(a)Down, HisC183 showed a phosphorylation signal in anti-core precipitated nucleocapsids, which were harvested either from two-plasmid transfection (pHBV{Delta}C and pHisC183) or from triple-plasmid transfection (pHBV{Delta}C, pHisC183 and pFlagC151) (Fig. 6Down, lanes 2 and 4). If no mosaic particles formed by FlagC151 and HisC183 in the triple-plasmid transfection, negative phosphorylation of HisC183 would be obtained in the anti-Flag antibody precipitated nucleocapsids. Positive results for phosphorylation of HisC183 (Fig. 6bDown, lane 4) clearly demonstrated that FlagC151, although it has a C-terminal truncation, can form mosaic particles with a full-length core of HisC183 and retain kinase activity. Western blot results showed that FlagC151 was properly expressed (Fig. 6cDown, lanes 3 and 4) but was not phosphorylated in the mosaic particles (Fig. 6bDown, lane 4). This result confirmed previous observations that the phosphorylation site of the core protein is indeed located at aa 152–183 (Liao & Ou, 1995Down ).



View larger version (34K):
[in this window]
[in a new window]
 
Fig. 6. In vitro phosphorylation assay of nucleocapsids formed by various forms of core protein. Plasmids used in transfections are indicated at the top. After 3 days of transfection, intracellular nucleocapsids were precipitated by anti-core antibody ( a) or anti-Flag antibody (b) followed by in vitro kinase assay. In (c), the precipitated nucleocapsids were subjected to Western blot analysis of core proteins. Numbers on the right indicate the molecular mass markers in kDa.

 
Mosaic particles containing various amounts of mutant cores could result in different pregenome packaging
To extend the above observation, experiments of triple-plasmid transfection were performed to see whether C144Arg and C144Lys mutant cores also exert a dominant negative effect on trans- complementation between pHBV{Delta}C and pHBV{Delta}PSX for HBV DNA maturation. An equal amount (13 µg) of pHBV{Delta}C and pHBV{Delta}PSX was co-transfected with various amounts (0, 4, 7 or 13 µg) of pHBVC144Arg into HuH-7 cells; nucleocapsids collected from media of all transfections were analysed by endogenous polymerase activity as described above. As shown in Fig. 7 Down, two distinct bands of 3·0 kb and 1·9 kb in a ratio of about 2:1 were produced from pHBV{Delta}C, pHBV{Delta}PSX and pUC-MT co-transfected cells (Fig. 7Down, lane 1), which is consistent with the results shown in Fig. 4Up. These two bands were barely detectable in the samples of co-transfection with 13 µg pHBVC144Arg (Fig. 7Down, lane 2). When the amount of pHBVC144Arg was reduced to 7 or 4 µg in the triple-plasmid transfections, the intensity of the 1·9 kb HBV DNA increased significantly and the band of 3·0 kb became visible (Fig. 7Down, lanes 3 and 4). Interestingly, in the triple-plasmid transfections with various amounts of pHBVC144Arg, a 1·0 kb species was present with constant intensity ( Fig. 7Down, lanes 2–4). This is presumably derived from the pregenomic RNA transcribed from the pHBVC144Arg plasmid. It might be the first demonstration that three different sizes of pregenomic RNA could be encapsidated in one transfection experiment. Moreover, the intensity of the 3·0/1·9 kb bands was reversed to a 1:7 ratio in the presence of 4 µg pHBVC144Arg (Fig. 7Down, lane 4). Although the underlying mechanism is unknown, it clearly demonstrated that C144Arg can influence the wild-type core proteins either to package different sizes of pregenomic RNA or to prevent longer pregenomes from reaching DNA maturation.



View larger version (57K):
[in this window]
[in a new window]
 
Fig. 7. Endogenous polymerase assay from triplet transfection. HuH-7 cells were transfected with similar amounts of plasmids pHBV{Delta}C and pHBV{Delta}PSX and different amounts of plasmids pUC-MT and pHBVC144Arg as indicated on the top of the gel. In total, 39 µg DNA was used in each transfection. Viral nucleocapsids derived from the medium of each transfection were analysed by endogenous polymerase reaction. Positions of the 32 P-labelled {lambda} HindIII marker (bp) are shown on the left. The arrows indicate the positions of the repaired DNA signal from the transfected plasmids.

 

   Discussion
TOP
Abstract
Introduction
Methods
Results
Discussion
References
 
The protamine-like domain located at the C terminus of HBV core protein is known to be important for binding to nucleic acids (Gallina et al., 1989Down ). To further characterize the arrangement of SPRRR in the protamine domain of the core protein that is essential for pregenome encapsidation and DNA maturation, we replaced the highly charged C-terminal 33 aa of core protein with shorter 7 aa positively charged motifs to generate C144Arg and C144Lys. Consistent with previous studies showing that the core protein truncated to residue 144 still retains the capability to assemble into capsids (Birnbaum & Nassal, 1990Down ; Crowther et al. , 1994Down ; Zlotnick et al., 1996Down ), in this study, we have demonstrated that C144Arg and C144Lys could form nucleocapsids (Fig. 3Up). However, trans- complementation studies combined with an endogenous polymerase assay revealed that the capsids formed by C144Arg and C144Lys could not function in HBV DNA repairing (Fig. 4Up). This result could be due to poor pregenome encapsidation or inability to bind elongating DNA as demonstrated by Hatton et al. (1992)Down . It may be due to the 25 aa less in C144Arg and C144Lys. Alternatively, it may result from introducing the stretch of arginine or lysine in core mutants to produce less stable capsids. The reduction in HBV DNA maturation observed in co-expression of C-terminal truncations with the wild-type core protein (Fig. 5Up) favours the last supposition, since 8- to 80-fold reduction of HBV DNA synthesis reflects the different degree of instability of capsids generated by various C-terminal truncations.

Although the assembly of mosaic nucleocapsids from different types of core proteins has been demonstrated (Chang et al., 1994Down ; Ulrich et al., 1998Down ), it is unclear whether co-expression of mutant with wild-type core protein will reduce or inhibit wild-type viral DNA maturation (Scaglioni et al., 1994Down , 1996Down ; von Weizsacker et al., 1996Down ; Wands et al., 1997Down ). A decrease in HBV DNA maturation may be due to the formation of less stable mosaic capsids as postulated above. Recently, the influence of C-terminal truncation on capsid assembly has been well characterized. It is now known that the segment between aa 129–149 forms an arm-like structure that plays a critical role in capsid assembly (Metzger & Bringas, 1998)Down . Residue 150 has been localized on the inner side of the capsid around the 5-fold and 6-fold symmetry axes (Zlotnick et al., 1997Down ). Capsids formed by C-terminally truncated core proteins ending at residue 144 present a hole around the 6-fold symmetry axes that is not present in wild-type capsids (Crowther et al., 1994Down ). Therefore, any truncation or introduction of a stretch of positively charged amino acids at the C terminus of the core protein could generate instability of mosaic capsids. In this study, we have observed that the effect of mosaic capsids on the retention of pregenome and kinase activity is different. There is an 8-fold reduction in DNA repairing signal in the presence of FlagC151 (Fig. 5Up, lane 5 vs lane 2) whereas no significant change in phosphorylated HisC183 was observed in the presence or absence of FlagC151 (Fig. 6aUp, lane 4 vs lane 2).

Trans-complementation between two defective pregenomes of HBV DNA has been largely used to define the elements required for pregenome packaging and genome maturation (Schlicht et al., 1989Down ; Chiang et al., 1990Down , 1992Down ; Yu & Summers, 1991Down ; von Weizsacker et al., 1995Down ). In this study, we have employed triple-plasmid transfection and demonstrated that three different less than full- length pregenomic RNAs (3·0, 1·9 and 1·0 kb) could be successfully encapsidated from a single transfection ( Fig. 7Up). To our knowledge, the 1·0 kb HBV DNA may be derived from the smallest pregenome of HBV being encapsidated and reported so far. Since the 1·0 kb band signal results from the filled-in gap of HBV DNA, it may provide insight into the mechanism of immature termination of the plus strand, which is the hallmark of hepadnaviral DNA (Tiollais et al., 1981Down ).

The finding of encapsidation of three less than full-length pregenomes raised a question regarding the mechanism of pregenome encapsidation. In the two-plasmid transfection studies, the higher intensity of the repaired 3·0 kb band as compared with that of the 1·9 kb band (2:1) is probably due to the fact that 3·0 kb RNA can direct polymerase synthesis and can act as cis-preference packaging (Hirsch et al., 1990Down ). In contrast, such cis-preference packaging of polymerase-producing RNA apparently did not happen in the triple- plasmid transfection, since the 3·0 kb DNA is the weakest signal among three repaired HBV DNAs (Fig. 7Up, lane 4). Although the mutated core proteins and various forms of less than full- length pregenomes used in this study do not occur in vivo, competition for pregenome packaging between core internal deletion and wild-type full-length pregenomes was reported in chronic hepatitis patients (Yuan et al., 1998aDown , bDown ). Furthermore, competition between full-length and spliced pregenomes for encapsidation was also commonly observed, since only a minute amount of defective particles containing spliced RNA was detected in the sera of HBV carriers (Terré et al., 1991Down ; R. L. Kuo & T.-S. Su, personal communication). Therefore, the triple- plasmid transfection system can be a tool for exploring the limiting factors involved in the competition of differently sized pregenome encapsidation.

At present, how core protein, polymerase and pregenome interact to assemble into replication-competent nucleocapsids is still largely unknown. Jeng et al. (1993)Down have demonstrated that the core–polymerase interaction occurs in HBV nucleocapsids but the exact contact sites for these two proteins have not yet been determined. Results from this study suggest that the C terminus of wild- type core protein, in addition to interacting with a pregenome, may also be a site for direct interaction with a kinase or cellular factor. Several lines of evidence indicate that the core protein can be phosphorylated in vivo (Roossinck & Siddiqui, 1987Down ) and in vitro (Albin & Robinson, 1980Down ; Feitelson et al., 1982Down ; Gerlich et al., 1982Down ; Duclos-Vallée et al., 1998Down ) and that kinases can be incorporated into nucleocapsids (Albin & Robinson, 1980Down ; Kann & Gerlich, 1994Down ; Kau & Ting, 1998Down ). Additionally, two cellular factors, including the heat shock protein 90 complex (Hu & Seeger, 1996Down ; Hu et al., 1997Down ) and terminal-protein-associated kinase (Kau & Ting, 1997Down , 1998Down ), have been found to interact with polymerase and are present in virus particles. Therefore, it will be interesting to know whether core mutants generated in this study either lose the ability to bind cellular kinases or factors or/and induce the instability of nucleocapsids.


   Acknowledgments
 
We gratefully acknowledge Drs Yan-Hwa Wu Lee and Shu-Der Tsen for their critical review of this manuscript and Kathy Sun for English editing. Thanks are also due to Dr Heinz Schaller for providing us with plasmid pMH 3/3097. This study was supported by grants of NSC85-2331- B010-018-MH and NSC86-2315-B010-004-MH from the National Science Council. S.J.L. was awarded by the National Science Council and the Medical Research and Advancement Foundation in Memory of Dr Chi-Shuen Tsou.


   References
TOP
Abstract
Introduction
Methods
Results
Discussion
References
 
Albin, C. & Robinson, W. S. (1980). Protein kinase activity in hepatitis B virus. Journal of Virology 34, 297-302.[Abstract/Free Full Text]

Beames, B. & Lanford, R. E. (1995). Insertions within the hepatitis B virus capsid protein influence capsid formation and RNA encapsidation. Journal of Virology 69, 6833-6838 .[Abstract]

Birnbaum, F. & Nassal, M. (1990). Hepatitis B virus nucleocapsid assembly: primary structure requirements in the core protein. Journal of Virology 64, 3319-3330 .[Abstract/Free Full Text]

Chang, C. , Zhou, S. , Ganem, D. & Standring, D. N. (1994). Phenotypic mixing between different hepadnavirus nucleocapsid protein reveals C protein dimerization to be cis preferential. Journal of Virology 68, 5225-5231 .[Abstract/Free Full Text]

Chiang, P.-W. , Hu, C.-P. , Su, T.-S. , Lo, S. J. , Chu, M.-H. , Schaller, H. & Chang, C. (1990). Encapsidation of truncated human hepatitis B virus genomes through trans-complementation of the core protein and polymerase. Virology 176, 355-361.[Medline]

Chiang, P.-W. , Jeng, K.-S. , Hu, C.-P. & Chang, C. (1992). Characterization of a cis element required for packaging and replication of the human hepatitis B virus. Virology 186, 701-711.[Medline]

Cohen, B. J. & Richmond, J. E. (1982). Electron microscopy of hepatitis B core antigen synthesized in E. coli. Nature 296, 677-678.[Medline]

Crowther, R. A. , Kiselev, N. A. , Bottcher, B. , Berriman, J. A. , Borisova, G. P. , Ose, V. & Pumpens, P. (1994). Three-dimensional structure of hepatitis B virus core particles determined by electron cryomicroscopy. Cell 77, 943-950.[Medline]

Duclos-Vallée, J.-C. , Capel, F. , Mabit, H. & Petit, M.-A. (1998). Phosphorylation of the hepatitis B virus core protein by glyceraldehyde-3-phosphate dehydrogenase protein kinase activity. Journal of General Virology 79, 1665-1670 .[Abstract]

Feitelson, M. A. , Mavion, P. L. & Robinson, W. S. (1982). Core particles of hepatitis B virus and ground squirrel hepatitis virus. II. Characterization of the protein kinase reaction associated with ground squirrel hepatitis virus and hepatitis B virus. Journal of Virology 43, 741-748.[Abstract/Free Full Text]

Gallina, A. , Bonelli, F. , Zentilin, L. , Rindi, G. , Muttini, M. & Milanesi, G. (1989). A recombinant hepatitis B core antigen polypeptide with the protamine-like domain deleted self- assembles into capsid particles but fails to bind nucleic acids. Journal of Virology 63, 4645-4652 .[Abstract/Free Full Text]

Ganem, D. & Varmus, H. E. (1987). The molecular biology of hepatitis B viruses. Annual Review of Biochemistry 56, 651-693.[Medline]

Gerlich, W. H. , Goldmann, U. , Muller, R. , Stibbe, W. & Wolff, W. (1982). Specificity and localization of the hepatitis B virus-associated protein kinase. Journal of Virology 42, 761-766.[Abstract/Free Full Text]

Graham, F. & van der Eb, A. (1973). A new technique for the assay of infectivity of human adenovirus 5 DNA. Virology 52, 456-457.[Medline]

Gust, I. D. , Burrell, C. J. , Coulepis, A. G. , Robinson, W. S. & Zuckerman, A. J. (1986). Taxonomic classification of human hepatitis B virus. Intervirology 25, 14-29.[Medline]

Hatton, T. , Zhou, S. & Standring, D. N. (1992). RNA- and DNA- binding activities in hepatitis B virus capsid protein: a model for their roles in viral replication. Journal of Virology 66, 5232-5241 .[Abstract/Free Full Text]

Hirsch, R. , Lavine, J. , Chang, L. , Varmus, H. & Ganem, D. (1990). Polymerase gene products of hepatitis B viruses are required for genomic RNA packaging as well as for reverse transcription. Nature 344, 552-555.[Medline]

Hu, J. & Seeger, C. (1996). Hsp90 is required for the activity of a hepatitis B virus reverse transcriptase. Proceedings of the National Academy of Sciences, USA 93, 1060-1064 .[Abstract/Free Full Text]

Hu, J. , Toft, D. O. & Seeger, C. (1997). Hepadnavirus assembly and reverse transcription require a multi-component chaperone complex which is incorporated into nucleocapsids. EMBO Journal 10, 59-68.[Medline]

Jeng, K.-S. , Hu, C.-P. & Chang, C. (1991). Differential formation of disulfide linkages in the core antigen of extracellular and intracellular hepatitis B virus core particles. Journal of Virology 65, 3924-3927 .[Abstract/Free Full Text]

Jeng, K.-S. , Hu, C.-P. & Chang, C. (1993). Hepatitis B core antigen forms oligomers and complexes with the p gene product in hepatitis B virus core particles. Journal of Gastroenterology and Hepatology 8, S114-S118.

Junker, M. , Galle, P. & Schaller, H. (1987). Expression and replication of the hepatitis B virus genome under foreign promoter control. Nucleic Acids Research 15, 10117-10132 .[Abstract/Free Full Text]

Junker-Niepmann, M. , Bartenschlager, R. & Schaller, H. (1990). A short cis-acting sequence is required for hepatitis B virus pregenome encapsidation and sufficient for packaging of foreign RNA. EMBO Journal 9, 3389-3396.[Medline]

Kann, M. & Gerlich, W. H. (1994). Effect of core protein phosphorylation by protein kinase C on encapsidation of RNA within core particles of hepatitis B virus. Journal of Virology 68, 7993-8000 .[Abstract/Free Full Text]

Kau, J.-H. & Ting, L.-P. (1997). A serine-kinase-containing protein complex interacts with the terminal protein domain of polymerase of hepatitis B virus. Journal of Biomedical Science 4, 155-161.[Medline]

Kau, J.-H. & Ting, L.-P. (1998). Phosphorylation of the core protein of hepatitis B virus by a 46-kilodalton serine kinase. Journal of Virology 72, 3796-3803 .[Abstract/Free Full Text]

Laemmli, U. K. (1970). Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature 227, 680-685.[Medline]

Liao, W. & Ou, J.-H. (1995). Phosphorylation and nuclear localization of the hepatitis B virus core protein: significance of serine in the three repeated SPRRR motifs. Journal of Virology 69, 1025-1029 .[Abstract]

Lin, C.-G. & Lo, S. J. (1992). Evidence for involvement of a ribosomal leaky scanning mechanism in the translation of the hepatitis B virus pol gene from the viral pregenome RNA. Virology 188, 342-352.[Medline]

Lin, C.-G. , Yang, S.-J. , Hwang, W.-L. , Su, T.-S. & Lo, S. J. (1995). Demonstration of the presence of protease-cutting site in the spacer of hepatitis B viral Pol protein. Journal of Virological Methods 51, 61-74.[Medline]

Metzger, K. & Bringas, R. (1998). Proline-138 is essential for the assembly of hepatitis B virus core protein. Journal of General Virology 79, 587-590.[Abstract]

Nassal, M. (1988). Total chemical synthesis of a gene for hepatitis B core protein and its functional characterization. Gene 66, 279-294.[Medline]

Nassal, M. (1992). The arginine-rich domain of the hepatitis B virus core protein is required for pregenome encapsidation and productive viral positive-strand DNA synthesis but not for virus assembly. Journal of Virology 66, 4107-4116 .[Abstract/Free Full Text]

Nassal, M. (1996). Hepatitis B virus morphogenesis. Current Topics in Microbiology and Immunology 214, 297-337.[Medline]

Nassal, M. & Schaller, H. (1993). Hepatitis B virus replication. Trends in Microbiology 1, 221-228.[Medline]

Pasek, M. , Goto, T. , Gilbert, W. , Zink, B. , Schaller, H. , MacKay, P. , Leadbetter, G. & Murray, K. (1979). Hepatitis B virus genes and their expression in E. coli. Nature 282, 575-579.[Medline]

Roossinck, M. J. & Siddiqui, A. (1987). In vivo phosphorylation and protein analysis of hepatitis B virus core protein. Journal of Virology 61, 955-961.[Abstract/Free Full Text]

Sambrook, J., Fritsch, E. F. & Maniatis, T. (1989). Molecular Cloning: A Laboratory Manual, 2nd edn. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory Press .

Sanger, F. , Nicklen, S. & Coulson, A. R. (1977). DNA sequencing with chain-terminating inhibitor. Proceedings of the National Academy of Sciences, USA 74, 5463-5467 .[Abstract/Free Full Text]

Scaglioni, P. P. , Melegari, M. & Wands, J. R. (1994). Characterization of hepatitis B virus core mutants that inhibit viral replication. Virology 205, 112-120.[Medline]

Scaglioni, P. , Melegari, M. , Takahashi, M. , Chowdhury, J. R. & Wands, J. (1996). Use of dominant negative mutants of the hepadnaviral core protein as antiviral agents. Hepatology 24, 1010-1017 .[Medline]

Schlicht, H. J. , Bartenschlager, R. & Schaller, H. (1989). The duck hepatitis B virus core protein contains a highly phosphorylated C terminus that is essential for replication but not for RNA packaging. Journal of Virology 63, 2995-3000 .[Abstract/Free Full Text]

Seifer, M. & Standring, D. N. (1993). Recombinant human hepatitis B virus reverse transcriptase is active in the absence of the nucleocapsid of the viral replication origin, DR1. Journal of Virology 67, 4513-4520 .[Abstract/Free Full Text]

Sprengel, R. , Kuhn, C. , Will, H. & Schaller, H. (1985). Comparative sequence analysis of duck and human hepatitis B virus genomes. Journal of Medical Virology 15, 323-333.[Medline]

Summers, J. & Mason, W. S. (1982). Replication of the genome of a hepatitis B-like virus by reverse transcription of an RNA intermediate. Cell 29, 403-415.[Medline]

Tavis, J. E. & Ganem, D. (1993). Expression of functional hepatitis B virus polymerase in yeast reveals it to be the sole viral protein required for correct initiation of reverse transcription. Proceedings of the National Academy of Sciences, USA 90, 4107-4111 .[Abstract/Free Full Text]

Terré, S. , Petit, M.-A. & Brechot, C. (1991). Defective hepatitis B virus particles are generated by packaging and reverse transcription of spliced viral RNAs in vivo. Journal of Virology 65, 5539-5543 .[Abstract/Free Full Text]

Tiollais, P. , Charnay, P. & Vyas, G. N. (1981). Biology of hepatitis B virus. Science 213, 406-411.[Abstract/Free Full Text]

Towbin, H. , Stachelin, T. & Gordon, J. (1979). Electrophoretic transfer of proteins from polyacrylamide gels to nitrocellulose sheets: procedure and some applications. Proceedings of the National Academy Sciences, USA 76, 4350-4354 .[Abstract/Free Full Text]

Ulrich, R. , Nassal, M. , Meisel, H. & Kruger, D. H. (1998). Core particles of hepatitis B virus as carrier for foreign epitopes. Advances in Virus Research 50, 141-182.[Medline]

von Weizsacker, F. , Wieland, S. & Blum, H. E. (1995). Identification of two separable modules in the duck hepatitis B virus core protein. Journal of Virology 69, 2704-2707 .[Abstract]

von Weizsacker, F. , Wieland, S. & Blum, H. E. (1996). Inhibition of viral replication by genetically engineered mutants of the duck hepatitis B virus core protein. Hepatology 24, 294-299.[Medline]

Wands, J. R. , Geissler, M. , Putlitz, J. , Blum, H. , von Weizsacker, F. , Mohr, L. , Yoon, S. K. , Melegari, M. & Scaglioni, P. P. (1997). Nucleic acid-based antiviral and gene therapy of chronic hepatitis B infection. Journal of Gastroenterology and Hepatology 12, S354-S369 .[Medline]

Wang, G. H. & Seeger, C. (1992). The reverse transcriptase of hepatitis B virus acts as a protein primer for viral DNA synthesis. Cell 71, 663-670.[Medline]

Yu, M. & Summers, J. (1991). A domain of the hepadnavirus capsid protein is specifically required for DNA maturation and virus assembly. Journal of Virology 65, 2511-2517 .[Abstract/Free Full Text]

Yuan, T. T.-T. , Lin, M.-H. , Chen, D.-S. & Shih, C. (1998a). A defective interference-like phenomenon of human hepatitis B virus in chronic carriers. Journal of Virology 72, 578 -584.[Abstract/Free Full Text]

Yuan, T. T.-T. , Lin, M.-H. , Qiu, S. M. & Shih, C. (1998b). Functional characterization of naturally occurring variants of human hepatitis B virus containing the core internal deletion mutation. Journal of Virology 72, 2168 -2176.[Abstract/Free Full Text]

Zheng, J. , Schodel, F. & Peterson, D. L. (1992). The structure of hepadnaviral core antigen: identification of free thiols and determination of the disulfide bonding pattern. Journal of Biological Chemistry 267, 9422-9429 .[Abstract/Free Full Text]

Zlotnick, A. , Cheng, N. , Conway, J. F. , Booy, F. P. , Steven, A. C. , Stahl, S. J. & Wingfield, P. T. (1996). Dimorphism of hepatitis B virus capsids is strongly influenced by the C-terminus of the capsid protein. Biochemistry 35, 7412-7421 .[Medline]

Zlotnick, A. , Cheng, N. , Stahl, S. J. , Conway, J. F. , Steven, A. C. & Wingfield, P. T. (1997). Localization of the C terminus of the assembly domain of hepatitis B virus capsid protein: implications for morphogenesis and organization of encapsidated RNA. Proceedings of the National Academy of Sciences, USA 94, 9556-9561 .[Abstract/Free Full Text]

Received 8 June 1999; accepted 24 June 1999.


This article has been cited by other articles:


Home page
Proc. Natl. Acad. Sci. USAHome page
B. Rabe, A. Vlachou, N. Pante, A. Helenius, and M. Kann
Nuclear import of hepatitis B virus capsids and release of the viral genome
PNAS, August 19, 2003; 100(17): 9849 - 9854.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
E. K.-W. Hui, S. Barman, T. Y. Yang, and D. P. Nayak
Basic Residues of the Helix Six Domain of Influenza Virus M1 Involved in Nuclear Translocation of M1 Can Be Replaced by PTAP and YPDL Late Assembly Domain Motifs
J. Virol., June 15, 2003; 77(12): 7078 - 7092.
[Abstract] [Full Text] [PDF]


Home page
J. Gen. Virol.Home page
E. K.-W. Hui, Y. S. Yi, and S. J. Lo
Hepatitis B viral core proteins with an N-terminal extension can assemble into core-like particles but cannot be enveloped
J. Gen. Virol., October 1, 1999; 80(10): 2647 - 2659.
[Abstract] [Full Text]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via CrossRef
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Hui, E. K.-W.
Right arrow Articles by Lo, S. J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Hui, E. K.-W.
Right arrow Articles by Lo, S. J.
Agricola
Right arrow Articles by Hui, E. K.-W.
Right arrow Articles by Lo, S. J.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
INT J SYST EVOL MICROBIOL MICROBIOLOGY J GEN VIROL
J MED MICROBIOL ALL SGM JOURNALS