J Gen Virol Faster Access
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via CrossRef
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Neilan, J. G.
Right arrow Articles by Rock, D. L.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Neilan, J. G.
Right arrow Articles by Rock, D. L.
Agricola
Right arrow Articles by Neilan, J. G.
Right arrow Articles by Rock, D. L.
Journal of General Virology (1999), 80, 2693-2697.
© 1999 Society for General Microbiology


Animal: DNA Viruses

An African swine fever virus ORF with similarity to C-type lectins is non-essential for growth in swine macrophages in vitro and for virus virulence in domestic swine

J. G. Neilan1, M. V. Borca1, Z. Lu1, G. F. Kutish1, S. B. Kleiboeker1, C. Carrillo1, L. Zsak1 and D. L. Rock1

Plum Island Animal Disease Center, Agricultural Research Service, US Department of Agriculture, PO Box 848, Greenport, NY 11944-0848, USA1

Author for correspondence: John Neilan.Fax +1 516 323 2507. e-mail jneilan{at}asrr.arsusda.gov


   Abstract
TOP
Abstract
Main text
References
 
An African swine fever virus (ASFV) ORF, 8CR, with similarity to the C-type lectin family of adhesion proteins has been described in the pathogenic isolate Malawi Lil-20/1. The similarity of 8CR to cellular and poxvirus genes associated with cell adhesion, cell recognition and virus infectivity suggested that 8CR may be of significance to ASFV–host cell interactions. Sequence analysis of the 8CR ORF from additional pathogenic ASFV isolates demonstrated conservation among isolates from both pig and tick sources. Northern blot analysis demonstrated 8CR mRNA transcription late in the virus replication cycle. A Malawi Lil-20/1 8CR deletion mutant ({Delta}8CR) was constructed to analyse 8CR function further. The growth characteristics in vitro of {Delta}8CR in porcine macrophage cell cultures were identical to those observed for parental virus. In domestic swine, {Delta}8CR exhibited an unaltered parental Malawi Lil- 20/1 disease and virulence phenotype. Thus, although well conserved among pathogenic ASFV field isolates, 8CR is non-essential for growth in porcine macrophages in vitro and for virus virulence in domestic swine.


   Main text
TOP
Abstract
Main text
References
 
African swine fever virus (ASFV) is a complex DNA virus; it is the only known DNA arbovirus and it is the sole member of a newly named family of animal viruses, the Asfarviridae (L. K. Dixon, J. V. Costa, J. M. Escribano, D. L. Rock, E. Vinuela and P. J. Wilkinson, unpublished). In nature, perpetuation and transmission of this virus involve the cycling of virus between Ornithodoros ticks and wild pig populations (warthogs and bushpigs) in sub-Saharan Africa (Plowright et al. , 1969Down ;Thomson et al., 1981Down ; Wilkinson, 1989Down ).

An ASFV ORF with similarity to animal C-type lectin proteins has been described in the pathogenic African isolate Malawi Lil-20/1 (Borca et al., 1993Down ) and in a cell culture-adapted European virus, BA71V (Yanez et al., 1995Down ). In animal cells, C-type lectins serve as extracellular cell-adhesion molecules that mediate specific recognition functions via Ca2+ carbohydrate recognition domains. For example, the hepatic lectins serve as membrane receptors mediating endocytosis (Hughes, 1992Down ) and lectin-like proteins mediate the early events involving attachment of migrating leukocytes to venule endothelium (Butcher, 1991Down ). They can also act as effectors in signal transduction pathways and/or gene regulation (Houchins et al., 1991Down ; Fujiwara et al., 1994Down ).

C-type lectin-like proteins have been described in poxviruses. The vaccinia virus gene A34R encodes a transmembrane protein similar to C-type animal lectins (Blasco et al., 1993Down ) and it is suggested that A34R functions either in formation or stabilization of actin-containing microvilli that facilitate the cell-to-cell spread of virus (Wolffe et al., 1997Down ). An A34R homologue is present in smallpox virus (variola), where it is thought to play a role in virus infectivity (Massung et al., 1993Down ; McIntosh & Smith, 1996Down ). Other poxvirus lectin proteins have been described, e.g. fowlpox virus ORFs 2, 8 and 11 (Tomley et al., 1988Down ), vaccinia virus A40R (Goebel et al., 1990Down ) and molluscum contagiosum virus MC143R (Senkevich et al., 1996Down ); however, their functions have not yet been determined.

The Malawi Lil-20/1 ORF 8CR most closely resembles the fowlpox virus lec1 ORF (Tomley et al., 1988Down ) and the vaccinia virus A40R ORF (Goebel et al., 1990Down ), with less similarity to the vaccinia virus A34R ORF, human NKG2 protein, hepatic lectins and Fc receptors. Here, we have characterized the ASFV 8CR ORF. Our data indicate that: (i) 8CR is transcribed late in the infection cycle; (ii) although conserved among pathogenic ASFV isolates, 8CR is non-essential for virus growth and spread in macrophage cell cultures in vitro; and (iii) 8CR does not affect disease course or virus virulence in domestic swine.

To assess the degree of conservation of the Malawi Lil-20/1 8CR ORF, DNA sequence analysis was performed on 12 pathogenic viruses, representing African, European and Caribbean isolates from both pig and tick sources. The ORF was amplified from purified virion DNA by PCR with oligonucleotide primers (forward primer 5' GTATAAGGATAACTTCGCCAC 3'; reverse primer 5' GGACTTTCTATTTCTTCAACCAC 3') and amplified products were cloned into the TA cloning vector pCR 2.1 (Invitrogen). Two independent PCR clones from each isolate were sequenced completely by using M13 forward and reverse primers and internal primers based on the derived sequence. The ASFV 8CR ORFs and other C-type lectin protein sequences in genetic databases were compared by using computer programs described elsewhere (Afonso et al., 1999Down ; Neilan et al., 1997 aDown ).

Overall, 8CR was highly conserved among the viruses (Fig. 1 aDown), ranging in size from 153 to 166 amino acid residues with a median size of 158 residues and a predicted molecular mass of 18·5 kDa (pI 9·0). Pathogenic European isolates E70 and E75 and the Caribbean isolate Haiti 811 were identical at the nucleotide level to the cell culture- adapted European isolate BA71V (Yanez et al., 1995Down ). Similarity of the predicted 8CR amino acid sequence among the isolates ranged from 74 to 100% and there was no significant difference between isolates in overall relationships at the amino acid level (amino acid Poisson correction-distance estimate by using a neighbour- joining branch length test and a cluster test with 1000 bootstrap samples; {chi}2=12·36, 12 degrees of freedom, P =0·42).



View larger version (93K):
[in this window]
[in a new window]
 
Fig. 1. (a) Alignment of the predicted amino acid sequences encoded by ORF 8CR homologues in various ASFV isolates. E70X denotes isolates BA71V, E70, E75 and Haiti 811, sequences of which were identical. Other isolates are abbreviated as: CH1 (Chiredzi/83/1), CR1 (Crocodile/96/1), CR3 (Crocodile/96/3), K1 (Fairfield/96/1), M1 (Wildebeeslaagte/96/1), MAL (Malawi Lil-20/1), PR4 (Pretoriuskop/96/4), PR5 (Pretoriuskop/96/5), TE (Tengani), UG (Uganda `61) and BA71V (GenBank accession U18466). Identical and conserved amino acid residues are enclosed in boxes (Dayhoff PAM 250 symbol-comparison table and a 0·3 cut-off value for peptide comparisons). Dashes (-) denote gaps introduced to maximize the alignment. The transmembrane region is indicated by a line above the alignment and important lectin conserved residues are indicated by asterisks. (b) Predicted 8CR lectin domain compared with other type II transmembrane proteins with C-type lectin domains (predicted P=8·8x10-3 ). Conserved lectin amino acids are marked with asterisks. Amino acid positions are listed on the right of the alignment; identities are highlighted in black with conserved residues shaded. The adjacent 36 residues have a significant multiple alignment ({chi}2 =78·7, P=10-18). Sequence names are abbreviated as: FCE, mouse low-affinity lymphocyte IgE receptor (SWISS- PROT P20693); Lectin-Rat, hepatic asialoglycoprotein receptor (SWISS- PROT P02706); Vaccinia, ORF A40R lectin homologue (SWISS-PROT P21063); NKG2-A, human natural killer cell G2 membrane protein (SWISS-PROT P26715); Fowl Pox, early hepatic lectin 1 homologue (SWISS-PROT P14370); and CD69, human early lymphocyte-activating antigen (GenBank L07555).

 
All 8CR ORFs contained a short, hydrophilic N-terminal region corresponding to the lectin cytoplasmic region, followed by a hydrophobic, predicted transmembrane region corresponding to the lectin type II transmembrane region and a hydrophilic, central to C-terminal, aspartate-rich area corresponding to the lectin extracellular region. The N terminus of most 8CR ORFs contained two cysteine residues most similar to the short double-cysteine-containing N terminus of poxvirus lectins. The cytoplasmic region of eukaryotic C-type lectins is in general much longer, 50–250 residues, although a pair of cysteine residues is also present near the N terminus. Two phosphokinase C phosphorylation sites (Prosite PS00005) are present in the cytoplasmic portion of 8CR, which is also similar to other lectins. The predicted C- terminal domain of the ASFV ORFs matched the typical extracellular lectin domain, CPX2WX6CY (Fig. 1bUp). As with the vaccinia virus ORF A40R, ASFV 8CR lacked the third cysteine-pair CWC motif (Prosite PS00615). All 8CR ORFs had a predicted pattern of {alpha}-helices followed by loops and several ß-sheets as seen in the extracellular calcium-dependent lectin- binding domain. Six potential N-linked glycosylation sites (Prosite PS00001) were present in the predicted extracellular portion of 8CR, which is similar to the number of sites found in other lectins. The cytoplasmic N-terminal domain and transmembrane regions of the predicted 8CR proteins were more highly conserved than the C-terminal lectin extracellular regions. Two deletions, each of six amino acids, in this region were observed for a subset of viruses examined here. The putative cell-attachment motif, RGD, described in the BA71V ORF EP153R (residues 133–135) was not conserved in all 8CR ORFs; it was present only in the E70, E75, Haiti 811, M1 and CR3 isolates.

Although 8CR was conserved in all isolates, the variability observed was greater than that seen with other well-characterized non-essential ASFV genes (Neilan et al., 1997aDown , bDown ; Zsak et al., 1996Down ). Analysis of this gene in conjunction with additional viral genes may prove useful for identifying and grouping ASFV strains.

To determine the transcriptional characteristics of 8CR, Northern blot analysis was performed on poly(A)+ RNA extracted from Malawi Lil-20/1-infected macrophage cell cultures using the Reagents Total RNA isolation system (Promega) and Poly(A) Quick mRNA isolation kit (Stratagene) according to the manufacturers' instructions. Northern blot hybridization analysis was performed by standard methods (Sambrook et al., 1989Down ).

By using an 8CR-specific probe, an RNA transcript of 0·74 kb was detected late in the infection cycle. 8CR, like the late-gene control p72, was not transcribed in the presence of cytosine arabinoside, an inhibitor of ASFV late gene expression (Fig. 2 aDown). These data indicate that the 8CR ORF is transcribed at late times in virus infection.



View larger version (58K):
[in this window]
[in a new window]
 
Fig. 2. Characterization of ORF 8CR transcription. (a ) Northern blot analysis of poly(A)-enriched RNA isolated from Malawi Lil-20/1-infected macrophage cell cultures at 5 and 24 h p.i. and in the presence of cytosine arabinoside (ARA C), with probes specific for ORF 8CR, p30 and p72 as indicated. Positions of RNA molecular mass markers are shown (in kb) on the left. ( b) 5' RACE analysis of ORF 8CR mRNA. The transcriptional initiation site is indicated 5' of the ORF 8CR translational start codon (shown in bold) and the predicted polyadenylation signal is indicated by the arrow 3' of the ORF.

 
To map the transcriptional start site for 8CR, 5' RACE (rapid amplification of cDNA ends) was performed on 2 µg total RNA purified from macrophage cell cultures infected with Malawi Lil-20/1 (m.o.i. of 10) at 8 h post-infection (p.i.) as described above. All reagents (5' RACE System, Gibco BRL) were used according to the supplier's instructions. The 8CR-specific primer used for cDNA synthesis was 5' GCGTAATAGTACTGACTC 3'. After cDNA synthesis and tailing, PCR was performed (PCR Core Kit, Boehringer Mannheim). Primers used for PCR were the 5' RACE abridged anchor primer (Gibco BRL) (5' GGCCACGCGTCGACTAGTACGGGIIGGGIIGGGIIG 3') and an 8CR-specific primer (5' CCCAATAATTAGATTCGTG 3'). Amplified products were cloned into the TA cloning vector pCR 2.1 (Invitrogen) and six independent clones were sequenced as described above.

Sequence analysis of the six independent clones demonstrated that transcription initiated at an adenine residue either 165 (n=5) or 163 (n=1) bases upstream of the predicted 8CR translational initiation codon (Fig. 2bUp). This is unlike other ASFV late genes, where initiation of transcription has been located closer to the translational start site; l11l, A224L and I226R initiate 9–10, 16–19 and 8–11 bases upstream of their respective translational start sites (Kleiboeker et al., 1998Down ; Chacon et al., 1995Down ; Rodriguez et al., 1996Down ). Analysis of the nucleotide sequence downstream of the 8CR ORF showed the presence of seven thymidylate residues (7T), a motif believed to function in 3'-end formation for ASFV mRNA (Almazan et al., 1992Down , 1993Down ) (Fig. 2bUp). The size of the 8CR transcript obtained by Northern blot analysis is consistent with the use of these nucleotides for initiation and termination of 8CR transcription (Fig. 2 aUp).

To examine the role of the 8CR ORF in ASFV growth in vitro and in virulence in swine, an 8CR deletion mutant of Malawi Lil-20/1 was constructed by homologous recombination between parental virus and an engineered recombination transfer vector, p72GUS{Delta}8CR, which was designed to remove all but 12 amino acid residues (one at the N terminus and 11 at the C terminus) of the 8CR ORF by using procedures described previously (Zsak et al., 1996Down ; Neilan et al., 1997 aDown ). Recombinant viruses representing independent primary plaques were purified to homogeneity by plaque assay and verified by Southern blot analysis and PCR as products of a double-crossover recombination event. One of these viruses, {Delta}8CR, was selected for further analysis.

Growth characteristics of {Delta}8CR were compared with those of the parental virus, Malawi Lil-20/1, by infecting primary macrophage cell cultures (m.o.i. of 0·01) in duplicate and then titrating extracellular and intracellular virus yields at various times p.i. In two independent experiments, the growth kinetics and maximum virus yields were: {Delta}8CR, intracellular yield 7·3±0·1 and extracellular yield 7·0±0·3 log10 TCID50/ml; parental virus, intracellular yield 7·3±0·1 and extracellular yield 7·0±0·3 log10 TCID 50/ml. Thus, no significant difference in growth kinetics or virus yield was observed, indicating that 8CR does not affect replication, release or spread of the virus in macrophage cell cultures. Thus, 8CR is not required for virus infectivity in porcine macrophages in vitro.

To examine the role of 8CR in ASFV pathogenesis and virulence, Yorkshire pigs were inoculated intramuscularly with 102 TCID 50 of the parental virus Malawi Lil-20/1 or the mutant, {Delta}8CR. A dose of 102 TCID50 of Malawi Lil- 20/1 represents a challenge dose of between 10 and 100 LD100 (Neilan et al., 1997 a)Down . Clinical signs of ASFV infection, i.e. fever (a rectal temperature greater than 40 °C), anorexia, lethargy, shivering, cyanosis and recumbency, were monitored daily. Virus isolation and titration of ASFV in blood samples were performed as described previously (Onisk et al., 1994Down ).

Both groups of animals presented with clinical signs of ASF 3–4 days p.i. and these signs progressed until death in all cases (Table 1Down). No differences in the onset of clinical disease, viraemia or time to death were noted for the two groups, indicating that 8CR does not affect disease course or virus virulence in domestic pigs. Replication and spread of ASFV in cells of the mononuclear–phagocytic system appears to be a critical factor in ASFV virulence in domestic swine (Colgrove et al., 1969Down ; Konno et al., 1971Down ; Mebus, 1988Down ; Moulton & Coggins, 1968Down ). Consistent with the observations made in vitro, the animal infection data indicate that 8CR is non-essential for replication in these cell types or for spread within the porcine mononuclear–phagocytic system in vivo.


View this table:
[in this window]
[in a new window]
 
Table 1. Swine survival, viraemia and fever response after infection with Malawi Lil-20/1 and {Delta}8CR

 
Clearly, 8CR is non-essential for virus growth in swine macrophage cell cultures. Although we have been unable to show any phenotypic changes for {Delta}8CR in domestic swine, the conservation of 8CR among field isolates of ASFV does suggest a significant function for this ORF. In nature, ASFV perpetuation involves the cycling of virus between two highly adapted hosts, Ornithodoros ticks and warthogs/bushpigs, in sub-Saharan Africa (Plowright et al., 1969Down , 1994Down ; Thomson et al., 1980Down ). Given that 8CR sequences were selected for under these natural conditions and the fact that ASFV has only recently been introduced into domestic pigs, it is likely that its real function involves one or other of its natural hosts.


   Acknowledgments
 
We thank Pablo Irusta, Frank Lyburt, Ed Kramer, Jose Emmanuelli and the PIADC animal care staff for excellent technical assistance and Glen Scoles, Thomas Burrage and Stefan Swanepoel for providing African tick isolates of ASFV.


   Footnotes
 
The EMBL/GenBank accession numbers of sequences reported in this paper are AF017027 (Chiredzi/83/1), AF017028 (Crocodile/96/1), AF017029 (Crocodile/96/3), AF017030 (E70), AF017031 (E75) AF017032 (Haiti 811), AF017033 (Fairfield/96/1), AF017034 (Wildebeeslaagte/96/1), AF017035 (Malawi Lil20/1), AF017036 (Pretoriuskop/96/4), AF017037 (Pretoriuskop/96/5), AF017038 (Tengani) and AF017039 (Uganda '61).


   References
TOP
Abstract
Main text
References
 
Afonso, C. L. , Tulman, E. R. , Lu, Z. , Oma, E. , Kutish, G. F. & Rock, D. L. (1999). The genome of Melanoplus sanguinipes entomopoxvirus. Journal of Virology 73, 533-552.[Abstract/Free Full Text]

Almazan, F. , Rodriguez, J. M. , Andres, G. , Perez, R. , Vinuela, E. & Rodriguez, J. F. (1992). Transcriptional analysis of multigene family 110 of African swine fever virus. Journal of Virology 66, 6655-6667 .[Abstract/Free Full Text]

Almazan, F. , Rodriguez, J. M. , Angulo, A. , Vinuela, E. & Rodriguez, J. F. (1993). Transcriptional mapping of a late gene coding for the p12 attachment protein of African swine fever virus. Journal of Virology 67, 553-556.[Abstract/Free Full Text]

Blasco, R. , Sisler, J. R. & Moss, B. (1993). Dissociation of progeny vaccinia virus from the cell membrane is regulated by a viral envelope glycoprotein: effect of a point mutation in the lectin homology domain of the A34R gene. Journal of Virology 67, 3319-3325 .[Abstract/Free Full Text]

Borca, M. V., Irusta, P. M., Kutish, G. F., Carrillo, C., Afonso, C. L., Lu, Z., Brun, A., Laegreid, W. W. & Rock, D. L. (1993). Characterization of an African swine fever virus protein with homology to C-type lectins. Abstract from the 74th Conference of Research Workers in Animal Diseases. November 8–9, 1993. Chicago, IL, USA.

Butcher, E. C. (1991). Leukocyte-endothelial cell recognition: three (or more) steps to specificity and diversity. Cell 67, 1033-1036 .[Medline]

Chacon, M. R. , Almazan, F. , Nogal, M. L. , Vinuela, E. & Rodriguez, J. F. (1995). The African swine fever virus IAP homolog is a late structural polypeptide. Virology 214, 670-674.[Medline]

Colgrove, G. S. , Haelterman, E. O. & Coggins, L. (1969). Pathogenesis of African swine fever in young pigs. American Journal of Veterinary Research 30, 1343-1359 .[Medline]

Fujiwara, H. , Kikutani, H. , Suematsu, S. , Naka, T. , Yoshida, K. , Yoshida, T. , Tanaka, T. , Suemura, M. , Matsumoto, N. , Kojima, S. , Kishimoto, T. & Yoshida, N. (1994). The absence of IgE antibody-mediated augmentation of immune responses in CD23-deficient mice. Proceedings of the National Academy of Sciences, USA 91, 6835-6839 .[Abstract/Free Full Text]

Goebel, S. J. , Johnson, G. P. , Perkus, M. E. , Davis, S. W. , Winslow, J. P. & Paoletti, E. (1990). The complete DNA sequence of vaccinia virus. Virology 179, 247-266.[Medline]

Houchins, J. P. , Yabe, T. , McSherry, C. & Bach, F. H. (1991). DNA sequence analysis of NKG2, a family of related cDNA clones encoding type II integral membrane proteins on human natural killer cells. Journal of Experimental Medicine 173, 1017-1020 .[Abstract/Free Full Text]

Hughes, R. C. (1992). Lectins as cell adhesion molecules. Current Opinions in Structural Biology 2, 687-692.

Kleiboeker, S. B. , Kutish, G. F. , Neilan, J. G. , Lu, Z. , Zsak, L. & Rock, D. L. (1998). A conserved African swine fever virus right variable region gene, l11L, is non- essential for growth in vitro and virulence in domestic swine. Journal of General Virology 79, 1189-1195 .[Abstract]

Konno, S. , Taylor, W. D. & Dardiri, A. H. (1971). Acute African swine fever. Proliferative phases in lymphoreticular tissue and the reticuloendothelial system. Cornell Veterinarian 61, 71-84.[Medline]

McIntosh, A. A. G. & Smith, G. L. (1996). Vaccinia virus glycoprotein A34R is required for infectivity of extracellular enveloped virus. Journal of Virology 70, 272-281.[Abstract]

Massung, R. F. , Esposito, J. J. , Liu, L. I. , Qi, J. , Utterback, T. R. , Knight, J. C. , Aubin, L. , Yuran, T. E. , Parsons, J. M. , Loparev, V. N. , Selivanov, N. A. , Cavallaro, K. F. , Kerlavage, A. R. , Mahy, B. W. J. & Venter, J. C. (1993). Potential virulence determinants in terminal regions of variola smallpox virus genome. Nature 366, 748-751.[Medline]

Mebus, C. A. (1988). African swine fever. Advances in Virus Research 35, 251-269.[Medline]

Moulton, J. & Coggins, L. (1968). Comparison of lesions in acute and chronic African swine fever. Cornell Veterinarian 58, 364-388.[Medline]

Neilan, J. G. , Lu, Z. , Kutish, G. F. , Zsak, L. , Burrage, T. G. , Borca, M. V. , Carrillo, C. & Rock, D. L. (1997a). A BIR motif containing gene of African swine fever virus, 4CL, is nonessential for growth in vitro and viral virulence. Virology 230, 252 -264.[Medline]

Neilan, J. G. , Lu, Z. , Kutish, G. F. , Zsak, L. , Lewis, T. L. & Rock, D. L. (1997b). A conserved African swine fever virus I{kappa}B homolog, 5EL, is nonessential for growth in vitro and virulence in domestic swine. Virology 235, 377 -385.[Medline]

Onisk, D. V. , Borca, M. V. , Kutish, G. F. , Kramer, E. , Irusta, P. & Rock, D. L. (1994). Passively transferred African swine fever virus antibodies protect swine against lethal infection. Virology 198, 350-354.[Medline]

Plowright, W. , Parker, J. & Pierce, M. A. (1969). African swine fever virus in ticks (Ornithodoros moubata, murray) collected from animal burrows in Tanzania. Nature 221, 1071-1073 .[Medline]

Plowright, W. , Thomson, G. R. & Neser, J. A. (1994). African swine fever. In Infectious Diseases in Livestock with Special Reference to South Africa, pp. 568-599. Edited by J. A. W. Coetzer, G. R. Thomson & R. C. Tustin. Cape Town: Oxford University Press.

Rodriguez, J. M. , Salas, M. L. & Vinuela, E. (1996). Intermediate class of mRNAs in African swine fever virus. Journal of Virology 70, 8584-8589 .[Abstract]

Sambrook, J., Fritsch, E. F. & Maniatis, T. (1989). Molecular Cloning: A Laboratory Manual, 2nd edn. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory.

Senkevich, T. G. , Bugert, J. J. , Sisler, J. R. , Koonin, E. V. , Darai, G. & Moss, B. (1996). Genome sequence of a human tumorigenic poxvirus: prediction of specific host response-evasion genes. Science 273, 813-816.[Abstract]

Thomson, G. R. , Gainaru, M. D. & Van Dellen, A. F. (1980). Experimental infection of warthogs (Phacochoerus aethiopicus) with African swine fever virus. Onderstepoort Journal of Veterinary Research 47, 19-22.[Medline]

Thomson, G. R. , Gainaru, M. , Lewis, A. , Biggs, H. , Nevill, E. , van der Pypekamp, M. , Gerbes, L. , Esterhuysen, J. , Bengis, R. , Bezuidenhout, D. & Condy, J. (1981). The relationship between ASFV, the warthog and Ornithodoros species in southern Africa. In ASF, Eur8466 EN. Proceedings of CEC/FAO Research Seminar, Sardinia, Italy, pp. 85-100. Edited by P. J. Wilkinson. Luxembourg: Commission of the European Communities.

Tomley, F. , Binns, M. , Campbell, J. & Boursnell, M. (1988). Sequence analysis of an 11·2 kilobase, near-terminal, BamHI fragment of fowlpox virus. Journal of General Virology 69, 1025-1040 .[Abstract/Free Full Text]

Wilkinson, P. J. (1989). African swine fever virus.Virus Infections of Porcines, 17-35. Amsterdam: Elsevier Science.

Wolffe, E. J. , Katz, E. , Weisberg, A. & Moss, B. (1997). The A34R glycoprotein gene is required for induction of specialized actin-containing microvilli and efficient cell-to-cell transmission of vaccinia virus. Journal of Virology 71, 3904-3915 .[Abstract]

Yanez, R. J. , Rodriguez, J. M. , Nogal, M. L. , Juste, L. , Enrique, C. , Rodriguez, J. F. & Vinuela, E. (1995). Analysis of the complete nucleotide sequence of African swine fever virus. Virology 208, 249-278.[Medline]

Zsak, L. , Lu, Z. , Kutish, G. F. , Neilan, J. G. & Rock, D. L. (1996). An African swine fever virus virulence-associated gene NL-S with similarity to the herpes simplex virus ICP34.5 gene. Journal of Virology 70, 8865-8871 .[Abstract]

Received 16 April 1999; accepted 7 July 1999.


This article has been cited by other articles:


Home page
J. Virol.Home page
S. Voigt, G. R. Sandford, L. Ding, and W. H. Burns
Identification and Characterization of a Spliced C-Type Lectin-Like Gene Encoded by Rat Cytomegalovirus
J. Virol., January 15, 2001; 75(2): 603 - 611.
[Abstract] [Full Text]


Home page
J. Virol.Home page
C. L. Afonso, E. R. Tulman, Z. Lu, L. Zsak, G. F. Kutish, and D. L. Rock
The Genome of Fowlpox Virus
J. Virol., April 15, 2000; 74(8): 3815 - 3831.
[Abstract] [Full Text]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via CrossRef
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Neilan, J. G.
Right arrow Articles by Rock, D. L.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Neilan, J. G.
Right arrow Articles by Rock, D. L.
Agricola
Right arrow Articles by Neilan, J. G.
Right arrow Articles by Rock, D. L.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
INT J SYST EVOL MICROBIOL MICROBIOLOGY J GEN VIROL
J MED MICROBIOL ALL SGM JOURNALS