J Gen Virol Faster Access
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via CrossRef
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Menegazzi, P.
Right arrow Articles by Di Luca, D.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Menegazzi, P.
Right arrow Articles by Di Luca, D.
Agricola
Right arrow Articles by Menegazzi, P.
Right arrow Articles by Di Luca, D.
Journal of General Virology (1999), 80, 2705-2712.
© 1999 Society for General Microbiology


Animal: DNA Viruses

Temporal mapping of transcripts in human herpesvirus-7

Paola Menegazzi1, Monica Galvan1, Antonella Rotola1, Tullia Ravaioli1, Arianna Gonelli1, Enzo Cassai1 and Dario Di Luca1

Department of Experimental and Diagnostic Medicine, Section of Microbiology, University of Ferrara, Via L. Borsari 46, 44100 Ferrara , Italy1

Author for correspondence: Dario Di Luca.Fax +39 0532 247618. e-mail dil{at}dns.unife.it


   Abstract
TOP
Abstract
Introduction
Methods
Results
Detection of transcripts...
Discussion
References
 
Transcription of human herpesvirus-7 (HHV-7) in cultures of productively infected T-cells was studied. Transcription of HHV-7 was regulated by the typical herpesvirus cascade in which {alpha}, ß and {gamma} genes are sequentially transcribed. Transcripts of U10, U14, U18, U31, U39, U41, U42, U53, U73 and U89/90 were detected 3 h after infection and were not inhibited by the absence of protein synthesis and therefore were {alpha} functions. U19 and U18/20 were ß genes; their transcription was inhibited by cycloheximide but not by phosphonoacetate, an inhibitor of DNA synthesis. U60/66 and U98/100 were {gamma} genes since their spliced transcripts were not detected in cells treated with phosphonoacetate. HHV-7 transcription was regulated by complex mechanisms, which involve the temporal coordinated activation of specific viral promoters and post-transcriptional processing. Splice mechanisms were also temporally regulated. Transcription of U89/90 pre-mRNA and splice took place simultaneously in the immediate-early phase. On the other hand, U16/17 pre-mRNA was synthesized with typical {alpha} kinetics, but the spliced product was regulated as a ß function. Likewise, the primary transcripts of U60/66 and U98/100 were {alpha} and ß, respectively, but both spliced products were synthesized in the late phase of virus replication. Finally, HHV-7 supported a bona fide latent infection in the adult population, since viral transcripts were not detected in peripheral blood mononuclear cells of healthy donors infected with HHV-7.


   Introduction
TOP
Abstract
Introduction
Methods
Results
Detection of transcripts...
Discussion
References
 
Human herpesvirus-7 (HHV-7) was isolated for the first time in 1990 from activated peripheral blood mononuclear cells (PBMCs) of a healthy donor (Frenkel et al., 1990Down ). The preferential target of `in vitro' infection is represented by primary CD4 T cells (Lusso et al., 1994Down ). The CD4 molecule is an essential component of the cell receptor (Lusso et al., 1994Down ) but is not sufficient for virus entry, as suggested by the inability of HHV-7 to infect several CD4+ lymphoid cell lines.

Primary infection is associated with exanthem subitum (Tanaka et al., 1994Down ) and benign febrile disease (Portolani et al., 1995Down ). The majority of young children, by three years of age, are positive for HHV-7-specific antibodies (Clark et al., 1993Down ; Wyatt et al., 1991Down ) and over 80 % of adults harbour viral sequences in their PBMCs (Di Luca et al., 1995aDown ) at low copy number (Kidd et al., 1996Down ). Viral DNA is found in salivary glands (Di Luca et al., 1995bDown ) and virus is shed in saliva, suggesting that active replication may take place in this region of the body.

The determination of the HHV-7 DNA sequence (Nicholas, 1996Down ) has not reflected a corresponding increase in knowledge of its molecular biology, mostly because its low pathogenic potential does not encourage investments in time and resources towards its study. Nevertheless, HHV- 7 is an interesting subject of study for three main reasons: (i) HHV-7 can reactivate HHV-6 from latency (Katsafanas et al., 1996Down ), and thereby it can indirectly contribute to life- threatening infections supported by HHV-6 in immunocompromised individuals; (ii) HHV-7 has an antagonistic effect with human immunodeficiency virus, interfering at the receptor level (Lusso et al., 1994Down ); and (iii) the tropism of HHV-7 for CD4 T lymphocytes and its low pathogenic potential suggest that the virus may be a good candidate as a vector for gene therapy, delivering therapeutic genes specifically in CD4+ cells.

To gain insights into HHV-7 molecular biology, we have studied the temporal regulation of selected genes and characterized splicing patterns. Gene transcription of herpesviruses is tightly and coordinately regulated during the infectious cycle. Immediate-early (IE) functions are encoded by {alpha} genes and do not require prior protein synthesis. They activate ß genes (early) which switch on the production of late proteins encoded by {gamma} genes. ß genes can be further differentiated into two groups (ß1 and ß2), according to their temporal appearance. The {gamma} genes also form two groups on the basis of their independence ({gamma}1) or dependence ({gamma}2) on viral DNA synthesis for their expression. The regulatory cascade has been extensively studied in cells infected with herpes simplex virus and human cytomegalovirus. Recently, we reported that HHV- 6 transcription is also regulated by the typical herpesvirus cascade mechanism (Mirandola et al., 1998Down ). It is reasonable to assume that HHV-7 genes are coordinately transcribed in a cascade fashion, but experimental evidence is not available and specific studies have yet to be reported. The purpose of this study was to determine the kinetics of HHV-7 transcription in productively and abortively infected cells maintained in the presence of cycloheximide (CEX) or emetine (EME), inhibitors of protein synthesis, or phosphonoacetic acid (PAA), an inhibitor of viral DNA replication.


   Methods
TOP
Abstract
Introduction
Methods
Results
Detection of transcripts...
Discussion
References
 
{blacksquare} Virus and cells.
Strain CZ of HHV-7 (Portolani et al., 1995Down ) was grown and analysed in the SupT1 cell line. Cells were grown in suspension at 37 °C in RPMI 1640 supplemented with 10% foetal calf serum. Cell-free virus inoculum was obtained by pelletting 1 l HHV-7-infected cell cultures exhibiting complete CPE. Infected cells, resuspended in 2 ml 100% foetal calf serum supplemented with RNase (50 µg/ml; Boehringer), were disrupted by four cycles of freezing in liquid nitrogen and thawing at 37 °C. The resulting inoculum was completely free of living cells, as verified by microscopic observation and cultivation, and was also analysed by RT–PCR (both for ß-actin and for the panel of viral mRNAs) to ensure that RNA was completely absent. Infection was performed by adding the viral inoculum to 107 cells/ml. After 1 h adsorption at 37 °C, the cells were diluted with fresh medium to attain a final concentration of 5x105 cells/ml. For cultures which were treated with drugs, the cells were mixed with the appropriate concentrations of drug 1 h prior to infection. Adsorption of virus to cells, dilution and incubation of cells took place in the continuous presence of the drug.

To identify {alpha} genes, the cells were infected in the presence of 200 µg/ml CEX (Sigma) or 50 µg/ml EME (Sigma). Aliquots of 5x106 cells were collected 3, 6 and 8 h after infection for RNA extraction. To identify ß genes, cells were infected in the presence of 500 µg/ml PAA (Sigma), an inhibitor of viral DNA replication. Cells were harvested 8, 16, 24 and 36 h after infection. Control cells were infected under similar conditions, but no drug was added to the medium. Cells were washed in PBS and immediately frozen at -80 °C until RNA extraction.

{blacksquare} RNA purification and reverse transcription.
Total RNA was extracted from cells harvested at each time-point with RNazol B (Tel-Test). DNA contamination was eliminated by three cycles of digestion with 20 units RNase-free DNase (Boehringer Mannheim) at room temperature for 30 min in 5 mM MgSO4 and 100 mM sodium acetate buffer, pH 5·0. RNA was purified with two phenol/chloroform extractions and recovered by ethanol precipitation. After a 75% ethanol rinse, the RNA pellet was resuspended in water treated with diethyl pyrocarbonate (0·1%) and stored at -80 °C with the addition of 40 U RNase inhibitor (Amersham). The complete absence of DNA contaminants was checked by PCR, amplifying 200 ng total RNA with human ß- actin primers (Walther et al., 1994Down ) and two different sets of primers designed to amplify HHV-7 U14 and U42 genes ( Table 1Down).


View this table:
[in this window]
[in a new window]
 
Table 1. HHV-7 primers used in this study

 
Random primer first-strand cDNA synthesis from 2 µg total RNA was carried out with a cDNA cycle kit (Invitrogen), in accordance with the manufacturer's recommendations, with random hexamer primers. cDNAs were purified with phenol/chloroform extractions and ethanol-precipitated. After rinsing with 75% ethanol, the cDNAs were resuspended in water and stored at -80 °C. To assay whether cDNAs from different samples were retrotranscribed with similar efficiencies, 10000-fold dilutions of cDNAs were analysed by PCR for the detection of the human ß-actin gene (Walther et al., 1994Down ).

{blacksquare} PCR analysis.
All primers were derived by us from the published HHV-7 sequence (Nicholas, 1996Down ). The primer sequences, as well as the expected sizes of amplified fragments resulting from DNA and cDNA, are shown in Table 1Up.

PCR reactions were done in the presence of 400 nM primers, 1·5 mM MgCl2 (2·5 mM for U16/17 and U98/100; 2·0 mM for U31, U39, U53 and U66), 200 µM dNTPs and 1·25 U AmpliTaq DNA polymerase (Perkin Elmer) in the buffer supplied by the manufacturer.

After an initial denaturation of 5 min at 94 °C, a thermal cycle of 1 min at 94 °C, 1 min at 58 °C (54 °C for U19 and U66; 55 °C for U60/66; 56 °C for U10, U18/20, U39 and U98/100; 57 °C for U18 and U99/100) and 1 min at 72 °C (with 3 s increase at each new cycle) was repeated 35 times. Products of amplification were run on agarose gel (1–2%) or polyacrylamide gel (4%), according to the expected fragment size, and UV-visualized after ethidium bromide staining.

Due care was taken to avoid sample-to-sample contamination. Different rooms and dedicated equipment were used for mRNA extraction and processing, PCR set-up and gel analyses; all pipette tips had filters for aerosol protection and all experimental samples were interspersed with blank reactions. All PCR reactions for HHV-7 transcripts had similar sensitivities; tenfold dilutions of DNA extracted from HHV-7 infected cells were similarly amplified by all primers for nested PCR.

{blacksquare} Sequencing.
After electrophoresis, the amplified fragments were purified by GeneClean II (Bio 101) and were sequenced by the fmol sequencing system (Promega). Reaction products were separated on a 6% polyacrylamide gel with 8 M urea and Tris–borate buffer. Gels were dried on filter paper and exposed to autoradiographic film. The sequences, obtained using both sense and antisense primers, were manually determined. Open reading frames were determined with the DNA Strider 1.0 software. Consensus sequences for initiation of translation were determined according to Kozak (1987Down , 1996Down ).

{blacksquare} Analysis of PBMCs.
Buffy coats were collected from 36 healthy blood donors and PBMCs were purified on Ficoll gradients. Aliquots corresponding to 5x10 6 cells were frozen at -80 °C. Nucleic acid extraction and retrotranscription of mRNA was performed as described recently (Rotola et al., 1998Down ). Nested PCR was performed by amplifying 5 ml 1:100 dilution of template from the primary reaction. Sequences of nested primers were: TAACACCGAAGAGGCTATGC and CTGGAAGACCATTCTCATGC for U14; GCTGCTGTTGTTACGTCGTT and AACCGAGCTGCAAGACCTAT for U16/17; CGCGTATGAACTGAGGTTGT and CCAGCTCATAGGATTCGAGA for U42; AAGAAGGAGCTTCCTCGGAT and TGCAGGCACTAATGGACTGA for U89/90.

PCR reactions were done in the presence of 400 nM primers, 1·0 mM MgCl2 (1·25 mM for U14; 2 mM for U89/90), 200 µM dNTPs and 1·25 U Ampli Taq DNA polymerase (Perkin Elmer) in the buffer supplied by the manufacturer. After an initial denaturation of 5 min at 94 °C, a thermal cycle of 1 min at 94 °C, 1 min at 58 °C and 1 min at 72 °C (with 3 s increase at each new cycle) was repeated 35 times.


   Results
TOP
Abstract
Introduction
Methods
Results
Detection of transcripts...
Discussion
References
 
Temporal regulation of HHV-7 transcription
As a preliminary step in studying the temporal regulation of HHV-7 transcription, a panel of PCR reactions was set up. The viral genes studied included regulatory functions (U16/17, U18/20, U42 and U89/90), functions involved in viral DNA replication (U41, U60/66 and U73) and structural proteins (U10, U14, U31, U39 and U98/100). Primers specific for each ORF were selected (Table 1Up). ORFs with putative splice sites were identified on the basis of homology with HHV-6. Different sets of primers spanning intronic regions were designed with the intent of differentiating between pre-mRNA and spliced transcripts.

All PCR reactions had similar efficiencies, as shown by amplification of 10-fold dilutions of DNA extracted from HHV-7 infected cells (data not shown).

To analyse the temporal regulation of HHV-7 transcription, SupT1 cells were infected with HHV-7 in the presence of inhibitors of protein synthesis (CEX or EME) or an inhibitor of viral DNA replication (PAA). The concentrations of drugs compatible with cell viability that are effective in inhibiting viral protein or DNA synthesis were determined in two independent preliminary experiments. To ensure reproducibility, RNA extracted from infected cells was retrotranscribed after priming with random hexamers, and the resulting cDNAs were analysed for the whole panel of HHV-7 genes. The same samples were retrotranscribed in different experiments and equivalent results were always obtained. Aliquots of the viral inoculum were carefully analysed by RT–PCR to be sure that the cDNAs detected originated from newly synthesized mRNAs and not from transcripts present in the inoculum. The samples were also checked for the absence of viral DNA; all time-points were analysed by PCR, without retrotranscription, for the presence of residual HHV-7 DNA. No contaminant DNA was present in the samples.

The efficiency of retrotranscription was monitored by amplification of the human ß-actin cDNA, after a 1:10000 dilution. All samples taken at different intervals were amplified with similar efficiencies, which excluded the possibility of marked differences in retrotranscription. Furthermore, the presence of drugs inhibiting protein synthesis did not affect the mRNA levels of a `housekeeping' gene such as ß-actin.

The results of temporal analysis of HHV-7 transcripts are shown in Table 2DownDown. The {alpha} genes, which included U10, U14, U18, U31, U39, U41, U42, U53, U73 and U89/90, were transcribed as early as 3 h after infection even when protein synthesis was inhibited. The results obtained with CEX and EME were identical (data not shown). A typical example of an {alpha} gene is U42 (Fig. 1aDownDown ). U19 and U18/20 were regulated as ß genes. Transcripts of these genes were detected 8 h after infection; they were inhibited by EME but were unaffected by the addition of PAA. The example of U19 is shown in Fig. 1(b)Down. Two genes in the panel, U60/66 and U98/100, had spliced products regulated as {gamma} functions and are described below.


View this table:
[in this window]
[in a new window]
 
Table 2. Temporal mapping of HHV-7 transcripts

 


View larger version (52K):
[in this window]
[in a new window]
 
Fig. 1. Agarose gels stained with ethidium bromide showing the results of RT–PCR for HHV-7 U42, an {alpha} gene ( a), and U19, a ß gene (b). RNA was extracted at the indicated times after infection from cells infected with HHV-7 in the presence or absence of EME or PAA. Lanes: M, molecular mass marker, 123 bp ladder; D, PCR on DNA from HHV-7- infected cells, extracted 5 days after infection at complete CPE; R, RT–PCR on RNA extracted from HHV-7-infected cells with complete CPE. The sizes of amplified fragments are shown.

 
Characterization of spliced transcripts
Spliced transcripts were identified on the basis of homology with HHV-6. PCR reactions were carefully designed to amplify sequences spanning putative donor and acceptor splice sites.

U16/17. Two mRNAs were detected. Sequence analysis showed that both are transcribed from the same coding strand (Fig. 2aDown ). The unspliced mRNA was {alpha}, as it was synthesized 3 h after infection in the presence of protein inhibitors (Fig. 2bDown). The spliced form was transcribed at 16 h post- infection (p.i.). It was inhibited by EME but not by PAA and therefore it belongs to the ß transcriptional class. The unspliced mRNA encoded two ORFs (Fig. 2bDown). U17 had canonical start and stop signals and could be translated. In comparison, U16 had no start signal and the 3' end lacked Kozak consensus sequences, and therefore translation could not take place. The splice event (donor site, ACCTAT/GGTAAGT; acceptor site, TCATAG/GTTGCT) excised 72 bases, including the stop codon for U17. The fusion product acquired the start signals from U17 and the stop codon from U16 and has the potential to be translated (Fig. 2Down).



View larger version (56K):
[in this window]
[in a new window]
 
Fig. 2. (a) Schematic representation of U16/17. The fragment amplified by the PCR assay is shown within the shaded area. The sequenced cDNAs are indicated by hatched bars. Splice donor (D) and acceptor (A) sites are shown. Diagrams showing the corresponding ORFs, determined on the basis of the sequencing data, are shown at the side. Complete lines indicate stop codons and half lines indicate start codons. (b) Agarose gel stained with ethidium bromide showing the results of RT–PCR for U16/17. RNA was extracted at the indicated times after infection from cells infected in the presence or absence of EME or PAA. Lanes M, D and R are as described in the legend to Fig. 1Up.

 
U60/66. U60 and U66 are two exons separated by approximately 3000 bp (Fig. 3aDownDown ). Due to the large size of the target fragment, two different PCR reactions had to be designed. One (shown in Fig. 3aDown and bDown) amplified the spliced transcript (donor site, ACTCAC/GTAAGT; acceptor site, TCTCAG/AGTATA). The other (shown in Fig. 3cDown and dDown) was specific for the primary transcript. The pre-mRNA, amplified by primers encompassing the donor site (Fig. 3cDown), was already abundant at 3 h p.i. and was not significantly affected by EME, allowing it to be classified as an {alpha} transcript (Fig. 3dDown). The spliced transcript was faintly detected at 3 h p.i.; it increased remarkably only in the late stages of infection (40 h p.i.; Fig. 3bDown). Accumulation of mature mRNA had typical {gamma} kinetics and was inhibited by addition of PAA (Fig. 3bDown).



View larger version (54K):
[in this window]
[in a new window]
 
Fig. 3. (a) Schematic representation of U60/66. The amplified fragment is shown within the shaded area. The thick bars indicate sequences from the coding region; thin hatched bars show sequences intervening between U66 stop and U60 start. Splice donor (D) and acceptor (A) sites are shown. (b) Agarose gel stained with ethidium bromide showing the results of RT–PCR for U60/66. RNA was extracted at the indicated times after infection from cells infected in the presence or absence of EME or PAA. Lanes M, D and R are as described in the legend to Fig. 1(c)Up. Schematic representation of the portion of U66 amplified by PCR, encompassing the splice donor site. (d) Agarose gel stained with ethidium bromide showing the results of RT–PCR for HHV-7, the unspliced messenger of U66.

 
U89/90. PCR amplification showed the presence of two transcripts regulated as {alpha} functions, corresponding respectively to the pre- mRNA and to the spliced messenger (Fig. 4DownDown ). Sequence analysis revealed that the pre-mRNA was bicistronic. The splice event (donor site, CAGCAG/GTATTT; acceptor site, TTCTAG/CTCAGT) excised 83 bases and fused in-frame U90 and U89. U90 lacked a start signal, but analysis of the DNA sequences showed the presence of an additional short coding region, upstream from U90, with a start signal and characterized by the presence of a Kozak consensus sequence. Therefore, it is likely that additional splice events take place in this region and lead to a transcript potentially encoding a U90/89 fusion protein, as has been described for HHV-6 (Schiewe et al., 1994Down ).



View larger version (66K):
[in this window]
[in a new window]
 
Fig. 4. (a) Schematic representation of U89/90. The amplified fragment is shown within the shaded area. The thick bars indicate sequences from the coding region; thin hatched bars show sequences intervening between U90 stop and U89 start. Splice donor (D) and acceptor (A) sites are shown. (b) Agarose gel stained with ethidium bromide showing the results of RT–PCR for U89/90. RNA was extracted at the indicated times after infection from cells infected in the presence or absence of EME or PAA. Lanes M, D and R are as described in the legend to Fig. 1Up.

 
U98/100. The results show that this region has a complex splice pattern (Fig. 5aDownDown ). The homologous region of HHV-6 undergoes multiple splice events and the final result is a fusion of sequences from 12 exons (Pfeiffer et al., 1995Down ). The PCR reaction was designed to amplify U100, U99 and U98, as well as the two intervening introns (Fig. 5aDown). Three RNAs were detected, as shown in Fig. 5(b)Down. The pre-mRNA, revealed after RT–PCR as a 887 bp fragment, was a ß function, synthesized 16 h p.i. and unaffected by PAA. A singly spliced mRNA, characterized by A2/D2 splice sites (donor, AGCACA/GTAAGT; acceptor, TCTAAG/GGTTAT) was regulated as an {alpha} gene (Fig. 5Down). Two splice events, A1/D1 (donor site, TCAATG/GTAAGC; acceptor site, TATTAG/TGAATT) and A2/D2, give rise to the mature mRNA. This form was present in low abundance at 8 h p.i., was detected with difficulty at later times and the amount increased again at 40 h p.i. (Fig. 5Down). The late increase was inhibited by PAA, suggesting that it is a {gamma} function. The singly spliced form with A1D1 splice sites was not detected. The results were confirmed with a different set of primers, encompassing only the A2/D2 splice site (Fig. 5Down).



View larger version (51K):
[in this window]
[in a new window]
 
Fig. 5. (a) Schematic representation of U98/100. The amplified fragment is shown within the shaded area. The thick hatched bars indicate sequences from the coding region; thin hatched bars show intervening sequences. Splice donor (D) and acceptor (A) sites are shown. (b) Polyacrylamide gel stained with ethidium bromide showing the results of RT–PCR for U98/100. RNA was extracted at the indicated times after infection from cells infected in the presence or absence of PAA. Lanes M, D and R are as described in the legend to Fig. 1(c)Up. Representation of the portion of U99/100 amplified by the PCR assay. The amplified fragment is shown within the shaded area. The thick hatched bars indicate sequences from the coding region; thin hatched bars show intervening sequences. Splice donor (D) and acceptor (A) sites are shown. (d ) Agarose gel stained with ethidium bromide showing the results of RT–PCR for HHV-7 U99/100. RNA was extracted at the indicated times after infection from cells infected in the presence or absence of EME or PAA. Lanes M, D and R are as described in the legend to Fig. 1Up.

 

   Detection of transcripts associated with in vivo persistence of HHV-7
TOP
Abstract
Introduction
Methods
Results
Detection of transcripts...
Discussion
References
 
HHV-7 transcription was analysed in PBMCs from healthy adults. DNA was extracted from PBMCs of 36 healthy blood donors, and 1·5x105 cells (corresponding to 1 µg DNA) were screened by nested PCR for the presence of HHV-7 genomic DNA. Thirty-one samples (86%) were positive with three different PCR reactions, amplifying viral DNA fragments from different genomic regions (U16/17, U42 and U89/90). A semiquantification of virus load was performed by PCR analysis of tenfold dilutions of positive samples. The nested PCR reaction, as estimated on the basis of reconstruction experiments, allowed the consistent detection of as few as ten target molecules (data not shown). It was determined that the positive samples harboured different amounts of HHV-7 DNA: one specimen contained about 1000 HHV-7 genomes in 150000 cells (corresponding to one copy in 150 cells); 13 harboured one copy of viral DNA in 1500 cells; and 17 had about one copy in 15000 cells. Transcription of HHV-7 {alpha} genes, normally detected in productive and in abortive infection (U14, U16/17, U42 and U89/90), was analysed in nine samples with the higher virus load, but no viral transcripts were detected.


   Discussion
TOP
Abstract
Introduction
Methods
Results
Detection of transcripts...
Discussion
References
 
HHV-7 was isolated for the first time in 1990 (Frenkel et al. , 1990Down ) and the nucleotide sequence was determined in 1996 (Nicholas, 1996Down ). However, studies on transcription of viral genes have not yet been reported and the temporal coordination of gene expression is unknown. The temporal regulation of transcription of a panel of HHV-7 genes is described here for the first time.

Transcription of HHV-7 was regulated with the typical herpesvirus cascade pattern, in which {alpha}, ß and {gamma} genes are sequentially transcribed (Table 2Up). As we recently discussed for HHV-6 (Mirandola et al., 1998Down ), several factors complicate the analysis of transcriptional classes. The presence of a specific mRNA does not necessarily imply protein expression and transcript may accumulate before protein synthesis is observed. Furthermore, the levels of mRNA increased significantly as infection progressed, suggesting that transcription begins early p.i. and that specific steps in the replication cycle might enhance promoter activity and transcription. In these instances, RT–PCR will result in an enrichment of transcripts scarcely transcribed. Furthermore, the block of protein synthesis is not absolute, and RT–PCR is sensitive enough to detect even low levels of transcription from ß genes with strong promoters. For this reason, the experiments were performed independently with two different inhibitors of protein synthesis (CEX and EME). EME exerts a stronger inhibition on protein synthesis, but it has a more pronounced toxic effect. The same results were obtained with both drugs, showing that the effects on virus transcription could not be ascribed to toxicity.

The kinetic classes of HHV-7 genes correspond to those recently described for HHV-6 (Mirandola et al., 1998Down ). Exceptions are represented by U41 and U53 which are transcribed in the IE phase of HHV-7, but are ß genes in HHV-6. Other differences between HHV-7 and HHV-6 transcription are observed in U18/20, which encodes transcriptional activators. The splice pattern of this region in HHV-6 is variant-specific, due to different recognition of splice donor and acceptor sites, and consequently each variant originates transcripts expressing partially different proteins (Mirandola et al., 1998Down ). The PCR reaction for this region of HHV-7 was designed to detect the potentially occurring splice mechanisms, but no splice was observed. HHV-6 variants and HHV-7 are closely related viruses and yet possess distinct biological properties, mainly reflected by specific in vitro cell tropism and by different pathogenic potential. It will be interesting to determine whether the distinct biological behaviours of these viruses are associated with the different patterns of transcription of U18/20.

It is difficult to predict if the primary transcript is actually translated. Indicators predictive of whether an mRNA can be translated include the presence of an upstream terminator codon, an ATG codon and Kozak consensus signals for the start of translation (Kozak, 1996Down ). For example, U16 lacks both the ATG and the Kozak consensus, and therefore it is extremely unlikely that the primary transcript can be translated. Instead, the mature mRNA acquires the potential for translating U16 as a fusion product with U17 ( Fig. 2Up). Therefore, the splice product might be reasonably considered to be the functional messenger. Also, the expression of U98/100 requires post-transcriptional processing. The pre- mRNA is tricistronic, but can possibly translate only U100. In fact, the three ORFs are not in-frame and only U100 has both a start codon and Kozak consensus sequences. The singly spliced mRNA is bicistronic and could express a U100/99 fusion product. Only the doubly spliced mRNA can express all three ORFs, as a U100/98 product. The study of the splice pattern suggests that post-transcriptional processing is essential for HHV-7 expression.

Interestingly, in addition to the synthesis of the primary transcript, the splice mechanisms are also temporally regulated. In fact, in several cases the pre-mRNA and the spliced product have a different kinetic class. For example, the primary transcript of U16/17 is synthesized with a typical {alpha} pattern, and splicing takes place only during the ß phase of infection.

U60/66 is another example of the temporal regulation of splice mechanisms. The primary transcript is abundant and belongs to the {alpha} kinetic class. The spliced transcript was detectable in small amounts as early as 3 h after infection and levels of synthesis increased over time. Addition of PAA prevented accumulation of the mature mRNA, suggesting that a virus function associated with virus replication might enhance the splicing activity and increase the rate of conversion from the pre-mRNA ({alpha}) into the final messenger ({gamma}1).

Also, the splicing of U98/100 is temporally regulated. RT–PCR showed the presence of three mRNAs of different sizes. The primary transcript is a ß function (Fig. 5Up). The singly spliced transcript (splice sites A2/D2) is synthesized in low abundance, but with typical {alpha} kinetics. The observation that the singly spliced transcript is detected earlier than primary mRNA could reflect a high rate of splicing activity specific for A2/D2 allowing accumulation of the pre-mRNA only at later stages of infection. The doubly spliced mRNA is produced at 8 h p.i. in limited amounts even in the absence of protein synthesis, but subsequently it is drastically reduced until 40 h p.i., when the product accumulates. PAA inhibits the accumulation at late times, showing that it is (or is dependent on) a {gamma}1 function (Fig. 5Up). The observation that a singly spliced transcript A1/D1 was not detected suggests that the A2/D2 junction might be a requirement for efficient A1/D1 splicing, regulated as a {gamma} event.

These results show that the splicing machinery can recognize and select targets and is dependent upon factors synthesized in different moments of the infectious cycle. Furthermore, it is possible that the splicing pattern is regulated by virus-induced functions, possibly affecting the formation and/or the specificity of cell spliceosomes.

In conclusion, HHV-7 transcription is regulated by complex mechanisms, involving both pre-transcriptional factors, such as the temporal coordinated activation of specific viral promoters, and post- transcriptional processing, mediated by virus-induced factors affecting the specificity of splicing.

To examine whether HHV-7 establishes a true virus latency, we analysed PBMCs from healthy blood donors for the presence of viral RNA transcripts. We focused our attention on transcription of four IE genes, transcribed also during abortive infection, reasoning that their presence is a necessary requisite for productive virus replication. The lack of detection of viral transcripts, even in samples harbouring fairly large amounts of viral DNA (1 copy in 150 cells) supports the notion that HHV-7 establishes a true latency in PBMCs.

The pathogenic role of HHV-7 is not clear and current information is derived from few case reports. Exanthem subitum (Tanaka et al. , 1994Down ), childhood febrile syndrome (Portolani et al. , 1995Down ) and pityriasis rosea (Drago et al., 1997Down ) have been associated with productive HHV-7 infection. Pathogenic studies are complicated by the fact that infection with HHV- 7 is widespread in the human population and serological analysis is of little value. PCR is often used to detect HHV-7 DNA, but viral sequences are detected in the majority of healthy adults (Di Luca et al., 1995aDown ) and PCR cannot discriminate the state of virus replication. RT–PCR instead might allow a relatively simple differentiation between latent and active infection and will be an useful approach to study pathogenic associations of HHV-7.


   Acknowledgments
 
We thank Linda M. Sartor for revising the English manuscript. This work was supported by grants from Ministero della Sanit à (Istituto Superiore Sanit à, AIDS Project), from BiomedII (European Community), from Associazione Italiana per la Ricerca sul Cancro (AIRC) and MURST.


   References
TOP
Abstract
Introduction
Methods
Results
Detection of transcripts...
Discussion
References
 
Clark, D. A. , Freeland, J. M. L. , Mackie, P. L. K. , Jarrett, R. F. & Onions, D. E. (1993). Prevalence of antibody to human herpesvirus 7 by age. Journal of Infectious Diseases 168, 251-252.[Medline]

Di Luca, D. , Zorzenon, M. , Mirandola, P. , Colle, R. , Botta, G. A. & Cassai, E. (1995a). Human herpesvirus 6 and human herpesvirus 7 in chronic fatigue syndrome. Journal of Clinical Microbiology 33, 1660 -1661.[Abstract]

Di Luca, D. , Mirandola, P. , Ravaioli, T. , Dolcetti, R. , Frigatti, A. , Bovenzi, P. , Sighinolfi, L. , Monini, P. & Cassai, E. (1995b). HHV-6 and HHV-7 in salivary glands and shedding in saliva of healthy and HIV positive individuals.Journal of Medical Virology 45, 462 -468.[Medline]

Drago, F. , Ranieri, E. , Malaguti, F. , Losi, E. & Rebora, A. (1997). Human herpesvirus 7 in pityriasis rosea. Lancet 349, 1367-1368 .[Medline]

Frenkel, N. , Schirmer, E. C. , Wyatt, L. , Katsafanas, G. , Roffman, E. , Danovich, R. M. & June, C. H. (1990). Isolation of a new herpesvirus from human CD4+ T cells. Proceedings of the National Academy of Sciences, USA 87, 748-752.[Abstract/Free Full Text]

Katsafanas, G. C. , Schirmer, L. S. & Frenkel, N. (1996). In vitro activation of human herpesvirus 6 and 7 from latency. Proceedings of the National Academy of Sciences, USA 93, 9788-9792 .[Abstract/Free Full Text]

Kidd, I. M. , Clark, D. A. , Ait-Khaled, M. , Griffiths, P. D. & Emery, V. C. (1996). Measurement of human herpesvirus 7 load in peripheral blood and saliva of healthy subjects by quantitative polymerase chain reaction. Journal of Infectious Diseases 174, 396-401.[Medline]

Kozak, M. (1987). An analysis of 5'-noncoding sequences from 699 vertebrate messenger RNAs. Nucleic Acids Research 15, 8125-8133 .[Abstract/Free Full Text]

Kozak, M. (1996). Interpreting cDNA sequences: some insights from studies on translations. Mammalian Genome 7, 563-574.

Lusso, P. , Secchiero, P. , Crowley, R. W. , Garzino-Demo, A. , Berneman, N. & Gallo, R. (1994). CD4 is a critical component of the receptor for human herpesvirus 7: interference with human immunodeficiency virus. Proceedings of the National Academy of Sciences, USA 91, 3872-3876 .[Abstract/Free Full Text]

Mirandola, P. , Menegazzi, P. , Merighi, S. , Ravaioli, T. , Cassai, E. & Di Luca, D. (1998). Temporal mapping of transcripts in herpesvirus 6 variants. Journal of Virology 72, 3837-3844 .[Abstract/Free Full Text]

Nicholas, J. (1996). Determination and analysis of the complete nucleotide sequence of human herpesvirus 7. Journal of Virology 70, 5975-5989 .[Abstract]

Pfeiffer, B. , Thomson, B. & Chandran, B. (1995). Identification and characterization of a cDNA derived from multiple splicing that encodes envelope glycoprotein gp105 of human herpesvirus 6. Journal of Virology 69, 3490-3500 .[Abstract]

Portolani, M. , Cermelli, C. , Mirandola, P. & Di Luca, D. (1995). Isolation of human herpesvirus 7 from an infant with febrile syndrome. Journal of Medical Virology 45, 282-283.[Medline]

Rotola, A. , Ravaioli, T. , Gonelli, A. , Dewhurst, S. , Cassai, E. & Di Luca, D. (1998). U94 of human herpesvirus 6 is expressed in latently infected peripheral blood mononuclear cells, and blocks viral gene expression in transformed lymphocytes in culture. Proceedings of the National Academy of Sciences, USA 95, 13911-13916 .[Abstract/Free Full Text]

Schiewe, U. , Neipel, F. , Schreiner, D. & Fleckenstein, B. (1994). Structure and transcription of an immediate-early region in the human herpesvirus 6 genome. Journal of Virology 68, 2978-2985 .[Abstract/Free Full Text]

Tanaka, K. , Kondo, T. , Torigoe, S. , Okada, S. , Mukai, T. & Yamanishi, K. (1994). Human herpesvirus 7: another causal agent for roseola (exanthem subitum). Journal of Pediatrics 125, 1-5.[Medline]

Walther, W. , Stein, U. & Eder, C. (1994). RNA analysis using miniprep RNA in reverse transcription PCR. BioTechniques 17, 674-675.[Medline]

Wyatt, L. S. , Rodriguez, J. , Balachandran, N. & Frenkel, N. (1991). Human herpesvirus 7: antigenic properties and prevalence in children and adults. Journal of Virology 65, 6260-6265 .[Abstract/Free Full Text]

Received 13 May 1999; accepted 7 July 1999.


This article has been cited by other articles:


Home page
J. Clin. Pathol.Home page
M Comar, P D'Agaro, C Campello, A Poli, J P Breinholt III, J A Towbin, and M Vatta
Human herpes virus 6 in archival cardiac tissues from children with idiopathic dilated cardiomyopathy or congenital heart disease
J. Clin. Pathol., January 1, 2009; 62(1): 80 - 83.
[Abstract] [Full Text] [PDF]


Home page
J. Gen. Virol.Home page
H. Shimada-Beltran and R. F. Rivera-Bustamante
Early and late gene expression in pepper huasteco yellow vein virus
J. Gen. Virol., November 1, 2007; 88(11): 3145 - 3153.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
A. J. Davison and N. D. Stow
New Genes from Old: Redeployment of dUTPase by Herpesviruses
J. Virol., October 15, 2005; 79(20): 12880 - 12892.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via CrossRef
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Menegazzi, P.
Right arrow Articles by Di Luca, D.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Menegazzi, P.
Right arrow Articles by Di Luca, D.
Agricola
Right arrow Articles by Menegazzi, P.
Right arrow Articles by Di Luca, D.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
INT J SYST EVOL MICROBIOL MICROBIOLOGY J GEN VIROL
J MED MICROBIOL ALL SGM JOURNALS