J Gen Virol Tips for Better Browsing
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via CrossRef
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Wang, G.-H.
Right arrow Articles by Cohen, J. I.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Wang, G.-H.
Right arrow Articles by Cohen, J. I.
Agricola
Right arrow Articles by Wang, G.-H.
Right arrow Articles by Cohen, J. I.
Journal of General Virology (1999), 80, 2737-2740.
© 1999 Society for General Microbiology


Animal: DNA Viruses

The murine gammaherpesvirus-68 M11 protein inhibits Fas- and TNF- induced apoptosis

Guang-Hua Wang1, Tara L. Garvey1 and Jeffrey I. Cohen1

Medical Virology Section, Laboratory of Clinical Investigation, National Institute of Allergy and Infectious Diseases, Bethesda, MD 20892, USA1

Author for correspondence: Jeffrey Cohen.Fax +1 301 496 7383. e-mail jcohen{at}niaid.nih.gov


   Abstract
TOP
Abstract
Main text
References
 
The murine gammaherpesvirus-68 (MHV-68) M11 gene encodes a protein predicted to have limited homology to the bcl-2 family of proteins. Unlike most of the other viral bcl-2 homologues, which have both BH1 and BH2 domains conserved with respect to bcl-2, the M11 protein has a BH1 domain, but apparently lacks a BH2 domain. Transfection of HeLa cells with an epitope-tagged MHV-68 M11 construct showed that the protein is predominantly located in the cytoplasm of cells. In HeLa cells, M11 inhibited apoptosis induced by anti-Fas antibody and by TNF-{alpha}. Thus, despite its limited conservation with respect to other bcl-2 family members, the MHV-68 M11 protein is a potent inhibitor of apoptosis.


   Main text
TOP
Abstract
Main text
References
 
Apoptosis is a host defence mechanism that the cell uses to limit production of infectious virus. Many viruses encode proteins that inhibit apoptosis (reviewed in O'Brien, 1998Down ; Tschopp et al., 1998Down ). Some viral proteins inhibit the pro-enzyme or activated form of caspases, while other viral proteins inhibit p53- mediated apoptosis or encode soluble TNF-{alpha} receptors. Several viruses including adenovirus, African swine fever virus and gammaherpesviruses encode homologues of the cellular bcl-2 protein.

The bcl-2 family of proteins includes both anti-apoptotic (e.g. bcl- 2, bcl-XL) and pro-apoptotic (e.g. bak, bax) proteins. Members of this family contain up to four bcl-2 homology domains (BH1 to BH4). The BH1 and BH2 domains are important for bcl-2 and bcl-XL to form heterodimers with bax (reviewed in Kroemer, 1997Down ). The BH3 domain of bak and bax is critical for these proteins to form heterodimers with bcl-2 and bcl-XL. The BH4 domain of bcl-2 is important for interactions with other cellular proteins.

Most herpesvirus bcl-2 homologues show conservation of sequences in both the BH1 and BH2 domains with respect to bcl-2, but have little homology with other regions of bcl-2. The viral bcl-2 proteins have poorly conserved BH3 domains and lack BH4 domains. Each of the gammaherpesviruses for which sequence is available, including Epstein–Barr virus (EBV), Kaposi's sarcoma herpesvirus (KSHV), herpesvirus saimiri (HVS), murine herpesvirus-68 (MHV-68), herpesvirus aeteles, alcelaphine herpesvirus-1, bovine herpesvirus-4 and equine herpesvirus-2, encodes a bcl-2 homologue (reviewed in Neipel et al., 1997Down ; Tschopp et al., 1998Down ). However, only the EBV BHRF1 (Henderson et al., 1993Down ; Kawanishi, 1997Down ), KSHV ORF16 (Cheng et al., 1997bDown ; Sarid et al., 1997Down ) and HVS ORF16 (Nava et al., 1997Down ) proteins, which have both BH1 and BH2 domains, have been shown to inhibit apoptosis.

The MHV-68 genome contains an open reading frame, M11 (Virgin et al., 1997Down ), that is predicted to encode a 171 amino acid protein that has limited homology to bcl-2 (Fig. 1Down ). While the M11 protein has a well conserved BH1 domain, the BH2 domain is apparently absent, unlike most of the other gammaherpesvirus bcl-2 homologues. Although MHV-68 M11 is located in a similar position in its genome as the EBV BHRF1 bcl-2 homologue is in the EBV genome, the degree of similarity was insufficient to consider it a true homologue of other gammaherpesvirus bcl-2-like proteins, and Virgin et al. (1997Down ) postulated that the M11 protein may have functions distinct from the other viral bcl-2 homologues. Here we show that the MHV-68 M11 protein, like its gammaherpesvirus counterparts, can inhibit apoptosis.



View larger version (93K):
[in this window]
[in a new window]
 
Fig. 1. Sequence alignment of MHV-68 M11 with bax, bak, bcl- 2, bcl-XL, BHRF1 (from EBV), human herpesvirus-8 (KSHV ORF16), ORF16 (from HVS) and BORFB2 (from bovine herpesvirus-4). Identical amino acids are shown in boxes and dashes indicate gaps introduced for optimal alignment.

 
To determine where M11 is expressed in the cell, a plasmid expressing the M11 gene fused to a haemagglutinin (HA) epitope tag was constructed. Oligonucleotides ACGTACGAATTCAAGATGTACCCATACGACGTGCCAGACTACGCAAGTCATAAGAAAAGC and ACGTACGTCGACTCAGACATAAATCACATTCC were used to amplify MHV-68 M11 by PCR from virus-infected cells. The PCR product was cut with EcoRI and SalI and inserted into pCI (Promega), resulting in pCI-M11- HA, which contains the HA tag sequence (YPYDVPDYA) inserted in-frame between amino acids 1 and 2 of M11.

Transfection of HeLa cells with plasmid expressing the HA-tagged M11 fusion protein followed by incubation with anti-HA antibody (HA.11; Berkeley Antibody Co.) and a fluorescein isothiocyanate-conjugated goat anti-mouse antibody showed that M11 was expressed diffusely throughout the cytoplasm, possibly with a small amount of nuclear staining, in transfected cells (Fig. 2Down ). In virus-infected cells, the pattern of localization may be different in the presence of other viral proteins; however, the EBV bcl-2 homologue also localizes to the cytoplasm of virus-infected cells (Hickish et al., 1994Down ) . Transfection of HeLa cells with empty vector (pCI) showed only background immunofluorescent staining (not shown).



View larger version (74K):
[in this window]
[in a new window]
 
Fig. 2. MHV-68 M11 is localized predominantly to the cytoplasm in transfected cells. HeLa cells were transfected with a plasmid containing HA-tagged M11 and the cells were fixed, incubated with antibody to HA, and examined by immunofluorescence microscopy. A cell that has not been transfected (top centre) does not stain with antibody to HA.

 
To determine whether M11 can block apoptosis, HeLa cells were cotransfected with plasmids expressing ß-galactosidase and M11 or bcl-XL, or empty vector, and apoptosis was induced. The MHV M11 gene was amplified by PCR from an infected cell lysate using oligonucleotides ACGTACGAATTCACCATGAGTCATAAGAAAAGCGG and ACGTACGTCGACTCAGACATAAATCACATTCC, the PCR product was cut with Eco RI and SalI and inserted into pCI, resulting in pCI-M11. The bcl-XL gene was inserted into pCI using PCR and oligonucleotides ACGTACGAATTCAAAATGTCTCAGAGCAACCGGGAG and ACGTACGTCGACCTGGTCATTTCCGACTGAAGAG, resulting in plasmid pCI-bcl-XL . HeLa cells were cotransfected with 50 ng of plasmid expressing the E. coli ß-galactosidase gene (pCMV-ß- gal) and 600 ng of pCI-M11 or pCI-bcl-XL using Fugene-6 (Boehringer Mannheim). After 24 h, the cells were treated with cycloheximide (5 µg/ml) and anti-Fas antibody (250 ng/ml) (CH11; Oncor Appligene) or cycloheximide (15 µg/ml) and recombinant human TNF (20 ng/ml) (Boehringer Mannheim) and incubated overnight. The cells were washed and stained with X-Gal as previously described (Wang et al., 1997Down ). Protection from apoptosis was determined by the number of flat, ß- galactosidase-expressing cells in plates treated with anti-Fas antibody or TNF compared to the number of such cells in untreated plates (Bertin et al., 1997Down ).

Treatment of cells transfected with the control vector followed by anti-Fas antibody or TNF resulted in <5% protection from apoptosis. In contrast, treatment of cells transfected with either M11 or bcl-X L resulted in >=70% protection from apoptosis (Fig. 3 Down a). Since TNF has been shown to be a potent antiviral agent (Wong & Goeddel, 1986Down ) and Fas can be used by cytotoxic T cells (CTLs) to initiate killing of virus-infected cells (Nagata, 1997Down ), the ability of M11 to block Fas- and TNF-induced apoptosis may protect MHV-68 virus-infected cells from destruction by CTLs or TNF. A recent report showed that the EBV BHRF1 bcl-2 homologue can also block apoptosis induced by anti-Fas antibody and TNF (Kawanishi, 1997Down ).



View larger version (13K):
[in this window]
[in a new window]
 
Fig. 3. MHV-68 M11 blocks Fas- and TNF-induced apoptosis. ( a) HeLa cells were cotransfected with plasmids expressing ß-galactosidase and MHV-68 or bcl-XL, or empty vector. Twenty-four hours later the cells were treated with cycloheximide alone or cycloheximide and anti-Fas antibody or TNF. The cells were fixed 12 h later, stained with X-Gal, and the number of adherent ß- galactosidase-positive cells in treated plates was compared to the number in untreated plates to determine the percent protection rate from apoptosis. The experiment was performed three times with 100 cells counted from each transfection each day. The error bars represent the standard deviation. (b) HeLa cells were transfected with plasmids expressing M11, or empty vector, treated with cycloheximide and anti-Fas antibody, and stained with annexin V–fluorescein. Flow cytometry was used to determine the number of cells stained with annexin V.

 
To further confirm that M11 can block apoptosis, cells transfected with M11 were stained with annexin V, which binds to phosphatidylserine. While phosphatidylserine is on the inner cell membrane of healthy cells, the molecule is translocated to the outer cell membrane during apoptosis, where it can interact with annexin V. HeLa cells were transfected with pCI or pCI-M11 and 24 h later the cells were treated with cycloheximide and anti-Fas antibody. Five hours later the cells were treated with trypsin, washed and incubated with propidium iodide and annexin V–fluorescein (Roche). Flow cytometry showed that cells transfected with pCI-M11 showed decreased staining with annexin V, when compared to cells transfected with pCI, indicating that M11 protected the cells from apoptosis (Fig. 3b Up).

MHV-68 infects mice and induces a latent infection in B cells (Sunil- Chandra et al., 1992Down ) and splenocytes (Weck et al., 1996Down ). The virus establishes a persistent infection in lung epithelial cells (Stewart et al., 1998) Down . The M11 protein, if similar to its other gammaherpesvirus homologues, is likely to be expressed during lytic but not latent infection with MHV-68. Thus, the M11 protein may protect virus-infected cells from TNF or Fas-induced apoptosis, allowing the virus to complete its replication cycle. MHV-68 DNA has been detected in some lymphomas in mice (Sunil-Chandra et al., 1994) Down . Other gammaherpesviruses with bcl-2 homologues (e.g. EBV, HVS) are tumorigenic in certain animal models. Since bcl-2 enhances oncogenesis in certain models (Vaux et al., 1988) Down , the M11 protein may enhance tumorigenesis by MHV-68.

MHV-68 M11 has a number of features that may make it a better inhibitor of apoptosis than bcl-2. The lack of BH2, BH3 and BH4 domains in M11 may prevent interactions of the viral protein with bax and bak which could otherwise inhibit the pro-apoptotic function of the viral protein. M11 lacks the loop structure located between the BH4 and BH3 domains of bcl-2. Cleavage of this loop in bcl-2 by caspases results in conversion of bcl-2 to a pro-apoptotic protein (Cheng et al., 1997aDown ). Thus, MHV-68 may have taken the bcl-2 gene from the murine genome and modified it to produce a more potent anti-apoptotic protein.


   Acknowledgments
 
We thank Herbert Morse for MHV-68 and Stephen Straus for reviewing the manuscript.


   References
TOP
Abstract
Main text
References
 
Bertin, J. , Armstrong, R. C. , Ottilie, S. , Martin, D. A. , Wang, Y. , Banks, S. , Wang, G.-H. , Senkevich, T. G. , Alnemri, E. S. , Moss, B. , Lenardo, M. J. , Tomaselli, K. J. & Cohen, J. I. (1997). Death effector domain- containing herpesvirus and poxvirus proteins inhibit both Fas- and TNFR1-induced apoptosis. Proceedings of the National Academy of Sciences, USA 94, 1172-1176 .[Abstract/Free Full Text]

Cheng, E. H.-Y. , Kirsch, D. G. , Clem, R. J. , Ravi, R. , Kastan, M. B. , Bedi, A. , Ueno, K. & Hardwick, J. M. (1997a). Conversion of bcl-2 to a bax-like death effector by caspases. Science 278, 1966 -1968.[Abstract/Free Full Text]

Cheng, E. H.-Y. , Nicholas, J. , Bellows, D. S. , Hayward, G. S. , Guo, H.-G. , Reitz, M. S. & Hardwick, J. M. (1997b). A bcl-2 homolog encoded by Kaposi sarcoma-associated virus, human herpesvirus 8, inhibits apoptosis but does not heterodimerize with bax or bak. Proceedings of the National Academy of Sciences, USA 94, 690 -694.[Abstract/Free Full Text]

Henderson, S. , Huen, D. , Rowe, M. , Dawson, C. , Johnson, G. & Rickinson, A. (1993). Epstein–Barr virus-coded BHRF1 protein, a viral homolog of bcl-2, protects human B cells from programmed cell death. Proceedings of the National Academy of Sciences, USA 90, 8479-8483 .[Abstract/Free Full Text]

Hickish, T. , Robertson, D. , Clarke, P. , Hill, M. , di Stefano, F. , Clarke, C. & Cunningham, D. (1994). Ultrastructural localization of BHRF1: an Epstein–Barr virus gene product which has homology with bcl-2. Cancer Research 54, 2808-2811 .[Abstract/Free Full Text]

Kawanishi, M. (1997). Epstein–Barr virus BHRF1 protein protects intestine 407 epithelial cells from apoptosis induced by tumor necrosis factor alpha and anti-Fas antibody. Journal of Virology 71, 3319-3322 .[Abstract]

Kroemer, G. (1997). The proto-oncogene bcl-2 and its role in regulating apoptosis. Nature Medicine 6, 614-620.

Nagata, S. (1997). Apoptosis by death factor. Cell 88, 355-365.[Medline]

Nava, V. E. , Cheung, E. H. , Veliuona, M. , Zou, S. , Clem, R. J. , Mayer, M. L. & Hardwick, J. M. (1997). Herpesvirus saimiri encodes a functional homolog of the human bcl-2 oncogene. Journal of Virology 71, 4118-4122 .[Abstract]

Neipel, F. , Albrecht, J.-C. & Fleckenstein, B. (1997). Cell-homologous genes in the Kaposi's sarcoma-associated rhadinovirus human herpesvirus 8: determinants of its pathogenicity? Journal of Virology 71, 4187-4192 .[Medline]

O'Brien, V. (1998). Viruses and apoptosis. Journal of General Virology 79, 1833-1845 .[Medline]

Sarid, R. , Sato, T. , Bohenzky, R. A. , Russo, J. J. & Chang, Y. (1997). Kaposi's sarcoma-associated herpesvirus encodes a functional bcl-2 homolog. Nature Medicine 3, 293-298.[Medline]

Stewart, J. P. , Usherwood, E. J. , Ross, A. , Dyson, H. & Nash, T. (1998). Lung epithelial cells are a major site of murine gammaherpesvirus persistence. Journal of Experimental Medicine 187, 1941-1951 .[Abstract/Free Full Text]

Sunil-Chandra, N. P. , Efstathiou, S. & Nash, A. A. (1992). Murine gammaherpesvirus 68 establishes a latent infection in mouse B lymphocytes in vivo . Journal of General Virology 73, 3275-3279 .[Abstract/Free Full Text]

Sunil-Chandra, N. P. , Arno, J. , Fazakerley, J. & Nash, A. A. (1994). Lymphoproliferative disease in mice infected with murine gammaherpesvirus 68. American Journal of Pathology 145, 818-826.[Abstract]

Tschopp, J. , Thome, M. , Hofmann, K. & Meinl, E. (1998). The fight of viruses against apoptosis. Current Opinion in Genetics and Development 8, 82-87.[Medline]

Vaux, D. L. , Cory, S. & Adams, J. M. (1988). Bcl-2 gene promotes haemopoietic cell survival and cooperates with c-myc to immortalize pre- B cells. Nature 335, 440-442.[Medline]

Virgin, H. W. , Latreille, P. , Wamsley, P. , Hallsworth, K. , Weck, K. E. , Dal Canto, A. J. & Speck, S. H. (1997). Complete sequence and genomic analysis of murine gammaherpesvirus 68. Journal of Virology 71, 5894-5904 .[Abstract]

Wang, G.-H. , Bertin, J. , Wang, Y. , Martin, D. A. , Wang, J. , Tomaselli, K. J. , Armstrong, R. C. & Cohen, J. I. (1997). Bovine herpesvirus 4 BORFE2 protein inhibits Fas- and tumor necrosis factor 1-induced apoptosis and contains death effector domains shared with other gamma-2 herpesviruses. Journal of Virology 71, 8928-8932 .[Abstract]

Weck, K. E. , Barkon, M. L. , Yoo, L. I. , Speck, S. H. & Virgin, H. W. (1996). Mature B cells are required for acute splenic infection, but not for establishment of latency by murine gammaherpesvirus 68. Journal of Virology 70, 6775-6780 .[Abstract/Free Full Text]

Wong, G. H. & Goeddel, D. V. (1986). Tumour necrosis factors {alpha} and ß inhibit virus replication and synergize with interferons. Nature 323, 819-822.[Medline]

Received 7 December 1998; accepted 9 June 1999.


This article has been cited by other articles:


Home page
J. Gen. Virol.Home page
N. Jacobs, N. W. Bartlett, R. H. Clark, and G. L. Smith
Vaccinia virus lacking the Bcl-2-like protein N1 induces a stronger natural killer cell response to infection
J. Gen. Virol., November 1, 2008; 89(11): 2877 - 2881.
[Abstract] [Full Text] [PDF]


Home page
Proc Am Thorac SocHome page
T. Raymond, M. Schaller, C. M. Hogaboam, N. W. Lukacs, R. Rochford, and S. L. Kunkel
Toll-like Receptors, Notch Ligands, and Cytokines Drive the Chronicity of Lung Inflammation
Proceedings of the ATS, December 1, 2007; 4(8): 635 - 641.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
J. C. Forrest, C. R. Paden, R. D. Allen III, J. Collins, and S. H. Speck
ORF73-Null Murine Gammaherpesvirus 68 Reveals Roles for mLANA and p53 in Virus Replication
J. Virol., November 1, 2007; 81(21): 11957 - 11971.
[Abstract] [Full Text] [PDF]


Home page
J. Gen. Virol.Home page
B. D. de Lima, J. S. May, S. Marques, J. P. Simas, and P. G. Stevenson
Murine gammaherpesvirus 68 bcl-2 homologue contributes to latency establishment in vivo
J. Gen. Virol., January 1, 2005; 86(1): 31 - 40.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
J. Loh, D. A. Thomas, P. A. Revell, T. J. Ley, and H. W. Virgin IV
Granzymes and Caspase 3 Play Important Roles in Control of Gammaherpesvirus Latency
J. Virol., November 15, 2004; 78(22): 12519 - 12528.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
S. Marques, S. Efstathiou, K. G. Smith, M. Haury, and J. P. Simas
Selective Gene Expression of Latent Murine Gammaherpesvirus 68 in B Lymphocytes
J. Virol., July 1, 2003; 77(13): 7308 - 7318.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
E. Flano, I.-J. Kim, J. Moore, D. L. Woodland, and M. A. Blackman
Differential {gamma}-Herpesvirus Distribution in Distinct Anatomical Locations and Cell Subsets During Persistent Infection in Mice
J. Immunol., April 1, 2003; 170(7): 3828 - 3834.
[Abstract] [Full Text] [PDF]


Home page
J. Gen. Virol.Home page
B. Ebrahimi, B. M. Dutia, K. L. Roberts, J. J. Garcia-Ramirez, P. Dickinson, J. P. Stewart, P. Ghazal, D. J. Roy, and A. A. Nash
Transcriptome profile of murine gammaherpesvirus-68 lytic infection
J. Gen. Virol., January 1, 2003; 84(1): 99 - 109.
[Abstract] [Full Text] [PDF]


Home page
JEMHome page
E. Flano, I.-J. Kim, D. L. Woodland, and M. A. Blackman
{gamma}-Herpesvirus Latency Is Preferentially Maintained in Splenic Germinal Center and Memory B Cells
J. Exp. Med., November 18, 2002; 196(10): 1363 - 1372.
[Abstract] [Full Text] [PDF]


Home page
Genes Dev.Home page
A. Cuconati and E. White
Viral homologs of BCL-2: role of apoptosis in the regulation of virus infection
Genes & Dev., October 1, 2002; 16(19): 2465 - 2478.
[Full Text] [PDF]


Home page
J. Virol.Home page
E. T. Clambey, H. W. Virgin IV, and S. H. Speck
Characterization of a Spontaneous 9.5-Kilobase-Deletion Mutant of Murine Gammaherpesvirus 68 Reveals Tissue-Specific Genetic Requirements for Latency
J. Virol., June 5, 2002; 76(13): 6532 - 6544.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
R. Rochford, M. L. Lutzke, R. S. Alfinito, A. Clavo, and R. D. Cardin
Kinetics of Murine Gammaherpesvirus 68 Gene Expression following Infection of Murine Cells in Culture and in Mice
J. Virol., June 1, 2001; 75(11): 4955 - 4963.
[Abstract] [Full Text]


Home page
J. Gen. Virol.Home page
M. N. Wakeling, D. J. Roy, A. A. Nash, and J. P. Stewart
Characterization of the murine gammaherpesvirus 68 ORF74 product: a novel oncogenic G protein-coupled receptor
J. Gen. Virol., May 1, 2001; 82(5): 1187 - 1197.
[Abstract] [Full Text]


Home page
J. Virol.Home page
D. S. Bellows, B. N. Chau, P. Lee, Y. Lazebnik, W. H. Burns, and J. M. Hardwick
Antiapoptotic Herpesvirus Bcl-2 Homologs Escape Caspase-Mediated Conversion to Proapoptotic Proteins
J. Virol., June 1, 2000; 74(11): 5024 - 5031.
[Abstract] [Full Text]


Home page
JEMHome page
S. Gangappa, L. F. van Dyk, T. J. Jewett, S. H. Speck, and H. W. Virgin IV
Identification of the In Vivo Role of a Viral bcl-2
J. Exp. Med., April 1, 2002; 195(7): 931 - 940.
[Abstract] [Full Text] [PDF]


Home page
JEMHome page
M. A. Blackman and E. Flano
Persistent {gamma}-herpesvirus Infections: What Can We Learn from an Experimental Mouse Model?
J. Exp. Med., April 1, 2002; 195(7): F29 - F32.
[Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via CrossRef
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Wang, G.-H.
Right arrow Articles by Cohen, J. I.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Wang, G.-H.
Right arrow Articles by Cohen, J. I.
Agricola
Right arrow Articles by Wang, G.-H.
Right arrow Articles by Cohen, J. I.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
INT J SYST EVOL MICROBIOL MICROBIOLOGY J GEN VIROL
J MED MICROBIOL ALL SGM JOURNALS