J Gen Virol Email Content Delivery
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via CrossRef
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Hung, C.-H.
Right arrow Articles by Liu, S.-T.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Hung, C.-H.
Right arrow Articles by Liu, S.-T.
Agricola
Right arrow Articles by Hung, C.-H.
Right arrow Articles by Liu, S.-T.
Journal of General Virology (1999), 80, 2747-2750.
© 1999 Society for General Microbiology


Animal: DNA Viruses

Characterization of the Epstein–Barr virus BALF2 promoter

Chien-Hui Hung1,2 and Shih-Tung Liu2

Graduate Institute of Microbiology and Immunology, National Yang- Ming University, Shih-Pai, Taipei 112, Taiwan1
Molecular Genetics Laboratory, Department of Microbiology and Immunology, Chang-Gung University, 259 Wen-Hwa 1st Road, Kwei-Shan, Taoyuan 333, Taiwan2

Author for correspondence: Shih-Tung Liu.Fax +886 3 328 0292. e- mail cgliu{at}mail.cgu.edu.tw


   Abstract
TOP
Abstract
Main text
References
 
BALF2, which encodes the major DNA-binding protein of Epstein–Barr virus (EBV), is expressed during the early stage of the lytic cycle. The location of the BALF2 promoter was identified by primer extension, which indicated that the transcription start is located at nucleotide 164,782 of the EBV genome. Transfection analyses revealed that, similar to other EBV early promoters, the BALF2 promoter is activated by the EBV-encoded transcription factors Rta and Zta. The promoter is also synergistically activated if both transcription factors are present in B lymphocytes and in epithelial cells. Deletion analysis and electrophoretic mobility-shift assay revealed that the region between nucleotides -134 and -64 contains Zta- response elements and the region between nucleotides -287 and -254 contains Rta-response elements. This study demonstrates the importance of Rta and Zta in regulating the transcription of EBV early genes.


   Main text
TOP
Abstract
Main text
References
 
Epstein–Barr virus (EBV) is a human herpesvirus which infects lymphoid and epithelial cells. After infecting B lymphocytes, EBV immortalizes the cells and the viral genome is maintained as an episome under latent conditions (Nonoyama & Pagano, 1972Down ). EBV can be switched from a latent to a lytic cycle when latently infected cells are exposed to extracellular stimuli, including 12-O -tetradecanoylphorbol 13-acetate (TPA), sodium butyrate, calcium ionophores and anti-immunoglobulin (Luka et al., 1979Down ; Takada & zur Hausen, 1984Down ; zur Hausen et al., 1978Down ). Such treatment causes cells to express two EBV-encoded transcription factors, Rta and Zta. These two proteins act cooperatively to activate the transcription of EBV early genes, including BALF5, BHLF1, BHRF1 and BMRF1 (Chavrier et al., 1989Down ; Chevallier-Greco et al., 1989Down ; Cox et al., 1990Down ; Furnari et al., 1992Down ; Holley-Guthrie et al., 1990Down ). Of these genes, BALF5 and BMRF1 are involved in EBV lytic DNA replication (Fixman et al., 1992Down ). During the early stage of the EBV lytic cycle, EBV also transcribes BALF2, which encodes a single-stranded DNA- binding protein called mDBP (Tsurumi et al., 1996Down ). A related investigation indicated that the EBV strain Raji, in which BALF2 is deleted, cannot replicate its DNA during the lytic cycle (Polack et al., 1984Down ); this can be corrected by using a functional BALF2 present in trans (Decaussin et al ., 1995Down ), indicating that mDBP is crucial for EBV DNA lytic replication.

The transcription start site of BALF2 mRNA was determined by primer extension with a primer (PE261) which is complementary to the 5' region of BALF2 (nucleotides 164,744 to 164,721 of the EBV genome) (Fig. 1ADownDown). Primer extension was performed according to a previously described method (Chang et al., 1998 aDown ) with 100 µg of total RNA isolated from P3HR1 cells that had been treated with 30 ng/ml of TPA and 3 mM sodium butyrate for 36 h. This analysis identified a cDNA product 62 nucleotides long, indicating that the +1 site is located at nucleotide 164,782 of the EBV genome. This transcription start site was also confirmed by using a primer complementary to the region between nucleotides 164,644 and 164,621 of the EBV genome. RNA isolated from P3HR1 cells that had not been treated with TPA and sodium butyrate did not produce this 62 nucleotide cDNA ( Fig. 1BDown, lane 2). Upstream from the transcription start site, the BALF2 promoter contains a TATA sequence and two putative AP-1- binding sites (Fig. 1ADown).



View larger version (28K):
[in this window]
[in a new window]
 
Fig. 1. Sequence of the promoter region of BALF2 (A) and mapping of the transcription start site of BALF2 (B). Primer extension was performed with RNA prepared from P3HR1 cells treated (lane 1) with TPA and sodium butyrate or untreated (lane 2). In (A), TATA denotes TATA box; AP-1 denotes putative AP-1-binding sites; ZRE, Zta-response element; and +1, the transcription start site. Numbers in parentheses indicate the nucleotide positions in the EBV genome. In (B) , the letters above each lane denote the dideoxynucleotide used to terminate each reaction. The asterisk indicates the 5' terminus of mRNA; the arrow indicates the cDNA product of primer extension.

 
We constructed a reporter plasmid, pSSB (Fig. 2CDownDown), to analyse the BALF2 promoter. This plasmid was constructed by inserting a PCR fragment containing the sequence between -1837 and +12 of BALF2 into the BglII site of pGL2-Basic (Promega). This plasmid was transfected into an EBV- positive cell line, P3HR1; the luciferase activity exhibited by the plasmid was measured 36 h after transfection (de Wet et al., 1987Down ). This plasmid exhibited a background level of luciferase activity if the cells were maintained under latent conditions. However, the activity increased 103-fold if the cells were treated with TPA and sodium butyrate, indicating that the promoter is active under lytic conditions.



View larger version (25K):
[in this window]
[in a new window]
 
Fig. 2. Analysis of the BALF2 promoter. EBV-negative Akata cells (A) and C33A cells (B) were co-transfected with pSSB and pCMV-R (R), pCMV-Z (Z) or pCMV-RZ (RZ). The promoter activity was examined in P3HR1 cells treated (white bars) or untreated (black bars) with TPA and sodium butyrate (C). The numbers represent the nucleotide positions relative to the transcription start site. EBV-negative Akata cells were also co-transfected with pCMV-Z (D) or pCMV-R (E). EBV-negative Akata cells were co-transfected with 5 µg of pCMV-R, 5 µg of an SV40-reporter plasmid containing sequences covering the region between nucleotides -334 and -134 and 5 µg of pSV- ß-gal. ß-Galactosidase activity in 2 µl of cell lysate was measured using a Galacto-Light kit (Tropix), and was used to normalize the relative light unit values exhibited by the cells (F). For (A) the average fold-activation, relative to the value obtained from a co-transfection experiment with pSSB and the cloning vector pCMV, is presented. Each transfection experiment was repeated at least three times, and each sample in the experiment was prepared in duplicate.

 
Rta and Zta regulate the transcription of EBV early genes (Chevallier-Greco et al., 1989Down ; Furnari et al ., 1992Down ; Holley-Guthrie et al., 1990Down ). Therefore, we investigated whether or not these two transcription factors also activate the BALF2 promoter. Plasmids pCMV and pSSB were co-transfected into EBV-negative Akata cells. Because pCMV, a cloning vector, does not contain a gene that would activate the BALF2 promoter, the luciferase activity exhibited by pSSB was at a background level. On the other hand, luciferase activity increased 101-fold when the cells were cotransfected with pSSB and a plasmid (pCMV-Z) which expresses Zta (Fig. 2AUp), indicating that Zta activates the BALF2 promoter. Luciferase activity increased 31-fold when the cells were cotransfected with pSSB and a plasmid (pCMV-R) which expresses Rta ( Fig. 2AUp), indicating that Rta also activates the BALF2 promoter. The cells were also co-transfected with pSSB and a plasmid (pCMV-RZ) which expresses both Rta and Zta. The presence of pCMV-RZ in the cells increased luciferase activity 1161-fold (Fig. 2AUp). An earlier study demonstrated that pCMV-RZ transcribes a BRLF1–BZLF1 bicistronic mRNA and that both Rta and Zta are efficiently translated from this bicistronic mRNA in EBV-negative Akata cells (Chang et al., 1998bDown ). Therefore, a 1161-fold activation of the BALF2 promoter by pCMV-RZ indicates that the BALF2 promoter is synergistically activated by Rta and Zta. The BALF2 promoter was also activated by Rta and Zta in an epithelial cell line, C33A (Fig. 2BUp). Plasmid pCMV-Z activated the promoter 2-fold; pCMV-R activated the promoter 3-fold; pCMV-RZ activated the promoter 300-fold (Fig. 2AUp). Next, we generated deletions in pSSB to analyse the function of the BALF2 promoter (Fig. 2CUp). Deletion {Delta}1771 was generated by SmaI/SacII double digestion; {Delta}1459 by Sma I/NruI double digestion; {Delta}864 by SmaI/PvuII double digestion; and {Delta}331 by SmaI/Bss HII double digestion. In P3HR1 cells, these deletions did not significantly lower the luciferase activity under lytic conditions (Fig. 2CUp). We also deleted the regions upstream from the AatII site ({Delta}134) and from nucleotide -64 ({Delta}64), which was generated by inserting the sequence between nucleotides -64 and +12 into the BglII site of pGL2- Basic. Under lytic conditions in P3HR1 cells, deletion {Delta}134 decreased the promoter activity by approximately 90%; {Delta}64 decreased the activity by 95% (Fig. 2CUp), demonstrating that the region downstream from nucleotide -331 is necessary for BALF2 transcription. Co-transfection experiments also revealed that pCMV-Z activated the luc transcription of {Delta}134 but did not activate the transcription of {Delta}64 (Fig. 2DUp), suggesting that the region between nucleotides -134 and -64 contains sequence necessary for activation by Zta. Transcription of luc by {Delta}331 was activated by pCMV-R. However, mutants {Delta}134 and {Delta}64 were not activated by pCMV-R, indicating that the region between nucleotides -331 and -134 contains element necessary for activation by Rta (Fig. 2EUp).

Deletion analysis revealed that the region between the Bss HII (nucleotide -331) and AatII (nucleotide -134) sites probably contains sequences requires for activation by Rta (Fig. 2EUp). Therefore, this fragment was inserted into the SmaI site of a reporter plasmid (pGL2-Promoter) (Promega) which contains luc transcribed from an SV40 promoter. The resulting plasmid [BA(+)] was cotransfected with pCMV-R into EBV- negative Akata cells. Results showed that pCMV-R activated the activity of the SV40 promoter by 5·5-fold. Inserting the DNA fragment in the opposite orientation, BA(-), did not affect activation by Rta (data not shown), implying that the BA fragment functions as an enhancer. DNA fragments containing the sequence between nucleotides -287 and -134, -254 and -134 or -185 and -134 were amplified by PCR with primers SSB-306 (5' GAATTCGGGTGGTGCTGTGCTACA) and SSB-PR, SSB-267 (5' GAATTCGAAACTACCTGGATGA) and SSB-PR, and SSB-200 (5' GAATTCTATCGCAGACTCTGGT) and SSB-PR, respectively. These fragments were digested with AatII, repaired with T4 DNA polymerase and inserted into the SmaI site upstream from an SV40 promoter in pGL2-Promoter (Promega) to generate deletion mutants {Delta}287, {Delta}254 and {Delta}185. Transfection analysis revealed that deleting the region between nucleotides -331 and -287 ({Delta}287) ( Fig. 2FUp) did not affect the luciferase activity ( Fig. 2FUp). Deleting the region between nucleotides -331 and -254 ({Delta}254) and between nucleotides -331 and -185 ({Delta}185) decreased luciferase activity by 50 and 70% (Fig. 2FUp), respectively.

A DNA fragment containing the region between nucleotides -134 and -64 was used as a probe to examine the binding of Zta. The DNA was incubated with cell extract prepared from P3HR1 cells treated with TPA and sodium butyrate. Electrophoretic mobility-shift assay (EMSA) revealed that proteins in the cell extract bound to this DNA fragment (Fig. 3ADownDown, lane 1). Adding a DNA fragment containing an Rta-response element (RRE) did not compete against the binding ( Fig. 3ADown, lanes 3). On the other hand, adding an excessive amount of Zta-response element (ZRE) to the binding mixture prevented binding (Fig. 3ADown, lane 2). A supershifted band appeared when antibody against Zta was added to the binding mixture ( Fig. 3ADown, lane 4). According to computer analysis the ZRE is probably located between nucleotides -65 and -71 ( Fig. 1AUp). Since deletion analysis revealed that the region between nucleotides -287 and -185 may contain RRE ( Fig. 2FUp), we used DNA fragments covering this region to examine if Rta binds to the fragments. Results showed that recombinant GST–Rta but not GST bound to the region between nucleotides -287 and -254, indicating that this region contains an RRE. The band was supershifted by antibody against Rta (Fig. 3BDown). Our results also demonstrated that GST–Rta does not bind to the fragments covering the region between nucleotides -254 and -185 and the region between -185 and -134.



View larger version (39K):
[in this window]
[in a new window]
 
Fig. 3. Electrophoretic mobility-shift assay. A probe covering the region between nucleotides -134 and -64 (A) was used for binding analysis (lane 1). ZRE (lane 2) or RRE (lane 3) oligonucleotides, or an antibody against Zta (lane 4), were added to the binding mixture. RRE (5' CCTGTGCCTTGTCCCGTGGACAATGTCCC) was synthesized according to the DR1 sequence of the BHRF1 promoter (Gruffat & Sergeant, 1994Down ); ZRE was synthesized according to a Zta-binding sequence (5' CTAGCTCACCTTGAGCAATTTGGTCTAGAA) in the BHRF1 promoter (Chang et al ., 1990Down ). Three probes covering the regions from nucleotides -287 to -254, -254 to -185 and -185 to -134 were used to study the binding of the BALF2 promoter to recombinant GST–Rta protein (B). DNA fragments containing the regions from nucleotides -254 to -185 and from -185 to -134 were amplified by PCR with end-labelled primers. The region between -287 and -254 was generated by annealing two complementary synthetic oligonucleotides. GST protein prepared from E. coli was used as a control. The arrow indicates the shifted band; `S' indicates the supershifted band. Recombinant Rta protein prepared from E. coli was used to generate Rta antibody.

 
In conclusion, we have identified the +1 site of BALF2 mRNA by primer extension. Results indicated that, similar to other EBV early genes, transcription of BALF2 is synergistically activated by Rta and Zta. BALF2 is a gene required for EBV lytic replication. Our results showed that BALF2 is regulated by the same transcription factors that regulate the transcription of other EBV early genes, allowing these early gene products to be expressed simultaneously for EBV DNA replication.


   Acknowledgments
 
The authors would like to thank Chang-Gung Memorial Hospital (Medical Research Grant CMRP720) and the National Science Council of the Republic of China (NSC 86-2314-B-182-028) for partially supporting this research.


   References
TOP
Abstract
Main text
References
 
Chang, Y. N. , Dong, D. L. , Hayward, G. S. & Hayward, S. D. (1990). The Epstein–Barr virus Zta transactivator: a member of the bZIP family with unique DNA-binding specificity and a dimerization domain that lacks the characteristic heptad leucine zipper motif. Journal of Virology 64, 3358-3369 .[Abstract/Free Full Text]

Chang, P.-J. , Chang, Y.-S. & Liu, S.-T. (1998a). Characterization of the BcLF1 promoter in Epstein–Barr virus. Journal of General Virology 79, 2003 -2006.[Abstract]

Chang, P. J. , Chang, Y. S. & Liu, S. T. (1998b). Role of Rta in the translation of bicistronic BZLF1 of Epstein–Barr virus. Journal of Virology 72, 5128 -5136.[Abstract/Free Full Text]

Chavrier, P. , Gruffat, H. , Chevallier-Greco, A. , Buisson, M. & Sergeant, A. (1989). The Epstein–Barr virus (EBV) early promoter DR contains a cis-acting element responsive to the EBV transactivator EB1 and an enhancer with constitutive and inducible activities. Journal of Virology 63, 607-614.[Abstract/Free Full Text]

Chevallier-Greco, A. , Gruffat, H. , Manet, E. , Calender, A. & Sergeant, A. (1989). The Epstein–Barr virus (EBV) DR enhancer contains two functionally different domains: domain A is constitutive and cell specific, domain B is transactivated by the EBV early protein R. Journal of Virology 63, 615-623.[Abstract/Free Full Text]

Cox, M. A. , Leahy, J. & Hardwick, J. M. (1990). An enhancer within the divergent promoter of Epstein–Barr virus responds synergistically to the R and Z transactivators. Journal of Virology 64, 313-321.[Abstract/Free Full Text]

Decaussin, G. , Leclerc, V. & Ooka, T. (1995). The lytic cycle of Epstein–Barr virus in the nonproducer Raji line can be rescued by the expression of a 135-kilodalton protein encoded by the BALF2 open reading frame. Journal of Virology 69, 7309-7314 .[Abstract]

de Wet, J. R. , Wood, K. V. , DeLuca, M. , Helinski, D. R. & Subramani, S. (1987). Firefly luciferase gene: structure and expression in mammalian cells. Molecular and Cellular Biology 7, 725-737.[Abstract/Free Full Text]

Fixman, E. D. , Hayward, G. S. & Hayward, S. D. (1992). Trans-acting requirements for replication of Epstein–Barr virus ori-Lyt. Journal of Virology 66, 5030-5039 .[Abstract/Free Full Text]

Furnari, F. B. , Adams, M. D. & Pagano, J. S. (1992). Regulation of the Epstein–Barr virus DNA polymerase gene. Journal of Virology 66, 2837-2845 .[Abstract/Free Full Text]

Gruffat, H. & Sergeant, A. (1994). Characterization of the DNA- binding site repertoire for the Epstein–Barr virus transcription factor R. Nucleic Acids Research 22, 1172-1178 .[Abstract/Free Full Text]

Holley-Guthrie, E. A. , Quinlivan, E. B. , Mar, E. C. & Kenney, S. (1990). The Epstein–Barr virus (EBV) BMRF1 promoter for early antigen (EA-D) is regulated by the EBV transactivators, BRLF1 and BZLF1, in a cell-specific manner. Journal of Virology 64, 3753-3759 .[Abstract/Free Full Text]

Luka, J. , Kallin, B. & Klein, G. (1979). Induction of the Epstein–Barr virus (EBV) cycle in latently infected cells by n-butyrate. Virology 94, 228-231.[Medline]

Nonoyama, M. & Pagano, J. S. (1972). Replication of viral deoxyribonucleic acid and breakdown of cellular deoxyribonucleic acid in Epstein–Barr virus infection. Journal of Virology 9, 714-716.[Abstract/Free Full Text]

Polack, A. , Delius, H. , Zimber, U. & Bornkamm, G. W. (1984). Two deletions in the Epstein–Barr virus genome of the Burkitt lymphoma nonproducer line Raji. Virology 133, 146-157.[Medline]

Takada, K. & Zur Hausen, H. (1984). Induction of Epstein–Barr virus antigens by tumor promoters for epidermal and nonepidermal tissues. International Journal of Cancer 33, 491-496.

Tsurumi, T. , Kobayashi, A. , Tamai, K. , Yamada, H. , Daikoku, T. , Yamashita, Y. & Nishiyama, Y. (1996). Epstein–Barr virus single- stranded DNA-binding protein: purification, characterization, and action on DNA synthesis by the viral DNA polymerase. Virology 222, 352-364.[Medline]

zur Hausen, H. , Fresen, K. O. & Bornkamm, G. W. (1978). Epstein–Barr virus genomes and their biological functions: a review. IARC Scientific Publications 24, 3-10.

Received 15 March 1999; accepted 29 June 1999.


This article has been cited by other articles:


Home page
J. Biol. Chem.Home page
S. Nakayama, T. Murata, K. Murayama, Y. Yasui, Y. Sato, A. Kudoh, S. Iwahori, H. Isomura, T. Kanda, and T. Tsurumi
Epstein-Barr Virus Polymerase Processivity Factor Enhances BALF2 Promoter Transcription as a Coactivator for the BZLF1 Immediate-Early Protein
J. Biol. Chem., August 7, 2009; 284(32): 21557 - 21568.
[Abstract] [Full Text] [PDF]


Home page
J. Gen. Virol.Home page
Y.-H. Lee, Y.-F. Chiu, W.-H. Wang, L.-K. Chang, and S.-T. Liu
Activation of the ERK signal transduction pathway by Epstein-Barr virus immediate-early protein Rta
J. Gen. Virol., October 1, 2008; 89(10): 2437 - 2446.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
M. A. Calderwood, A. M. Holthaus, and E. Johannsen
The Epstein-Barr Virus LF2 Protein Inhibits Viral Replication
J. Virol., September 1, 2008; 82(17): 8509 - 8519.
[Abstract] [Full Text] [PDF]


Home page
J. Gen. Virol.Home page
Y.-F. Chiu, C.-P. Tung, Y.-H. Lee, W.-H. Wang, C. Li, J.-Y. Hung, C.-Y. Wang, Y. Kawaguchi, and S.-T. Liu
A comprehensive library of mutations of Epstein Barr virus
J. Gen. Virol., September 1, 2007; 88(9): 2463 - 2472.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
C.-H. Ho, C.-F. Hsu, P.-F. Fong, S.-K. Tai, S.-L. Hsieh, and C.-J. Chen
Epstein-Barr Virus Transcription Activator Rta Upregulates Decoy Receptor 3 Expression by Binding to Its Promoter
J. Virol., May 1, 2007; 81(9): 4837 - 4847.
[Abstract] [Full Text] [PDF]


Home page
J. Gen. Virol.Home page
T.-Y. Hsu, Y. Chang, P.-W. Wang, M.-Y. Liu, M.-R. Chen, J.-Y. Chen, and C.-H. Tsai
Reactivation of Epstein-Barr virus can be triggered by an Rta protein mutated at the nuclear localization signal
J. Gen. Virol., February 1, 2005; 86(2): 317 - 322.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
Y. Chang, H.-H. Lee, S.-S. Chang, T.-Y. Hsu, P.-W. Wang, Y.-S. Chang, K. Takada, and C.-H. Tsai
Induction of Epstein-Barr Virus Latent Membrane Protein 1 by a Lytic Transactivator Rta
J. Virol., December 1, 2004; 78(23): 13028 - 13036.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via CrossRef
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Hung, C.-H.
Right arrow Articles by Liu, S.-T.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Hung, C.-H.
Right arrow Articles by Liu, S.-T.
Agricola
Right arrow Articles by Hung, C.-H.
Right arrow Articles by Liu, S.-T.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
INT J SYST EVOL MICROBIOL MICROBIOLOGY J GEN VIROL
J MED MICROBIOL ALL SGM JOURNALS