|
|
||||||||
Animal: DNA Viruses |
Graduate Institute of Microbiology and Immunology, National Yang- Ming University, Shih-Pai, Taipei 112, Taiwan1
Molecular Genetics Laboratory, Department of Microbiology and Immunology, Chang-Gung University, 259 Wen-Hwa 1st Road, Kwei-Shan, Taoyuan 333, Taiwan2
Author for correspondence: Shih-Tung Liu.Fax +886 3 328 0292. e- mail cgliu{at}mail.cgu.edu.tw
| Abstract |
|---|
|
|
|---|
| Main text |
|---|
|
|
|---|
The transcription start site of BALF2 mRNA was determined by primer extension with a primer (PE261) which is complementary to the 5' region of BALF2 (nucleotides 164,744 to 164,721 of the EBV genome) (Fig. 1A![]()
). Primer extension was performed according to a previously described method (Chang et al., 1998 a
) with 100 µg of total RNA isolated from P3HR1 cells that had been treated with 30 ng/ml of TPA and 3 mM sodium butyrate for 36 h. This analysis identified a cDNA product 62 nucleotides long, indicating that the +1 site is located at nucleotide 164,782 of the EBV genome. This transcription start site was also confirmed by using a primer complementary to the region between nucleotides 164,644 and 164,621 of the EBV genome. RNA isolated from P3HR1 cells that had not been treated with TPA and sodium butyrate did not produce this 62 nucleotide cDNA ( Fig. 1B
, lane 2). Upstream from the transcription start site, the BALF2 promoter contains a TATA sequence and two putative AP-1- binding sites (Fig. 1A
).
|
|
1771 was generated by SmaI/SacII double digestion;
1459 by Sma I/NruI double digestion;
864 by SmaI/PvuII double digestion; and
331 by SmaI/Bss HII double digestion. In P3HR1 cells, these deletions did not significantly lower the luciferase activity under lytic conditions (Fig. 2C
134) and from nucleotide -64 (
64), which was generated by inserting the sequence between nucleotides -64 and +12 into the BglII site of pGL2- Basic. Under lytic conditions in P3HR1 cells, deletion
134 decreased the promoter activity by approximately 90%;
64 decreased the activity by 95% (Fig. 2C
134 but did not activate the transcription of
64 (Fig. 2D
331 was activated by pCMV-R. However, mutants
134 and
64 were not activated by pCMV-R, indicating that the region between nucleotides -331 and -134 contains element necessary for activation by Rta (Fig. 2E
Deletion analysis revealed that the region between the Bss HII (nucleotide -331) and AatII (nucleotide -134) sites probably contains sequences requires for activation by Rta (Fig. 2E
). Therefore, this fragment was inserted into the SmaI site of a reporter plasmid (pGL2-Promoter) (Promega) which contains luc transcribed from an SV40 promoter. The resulting plasmid [BA(+)] was cotransfected with pCMV-R into EBV- negative Akata cells. Results showed that pCMV-R activated the activity of the SV40 promoter by 5·5-fold. Inserting the DNA fragment in the opposite orientation, BA(-), did not affect activation by Rta (data not shown), implying that the BA fragment functions as an enhancer. DNA fragments containing the sequence between nucleotides -287 and -134, -254 and -134 or -185 and -134 were amplified by PCR with primers SSB-306 (5' GAATTCGGGTGGTGCTGTGCTACA) and SSB-PR, SSB-267 (5' GAATTCGAAACTACCTGGATGA) and SSB-PR, and SSB-200 (5' GAATTCTATCGCAGACTCTGGT) and SSB-PR, respectively. These fragments were digested with AatII, repaired with T4 DNA polymerase and inserted into the SmaI site upstream from an SV40 promoter in pGL2-Promoter (Promega) to generate deletion mutants
287,
254 and
185. Transfection analysis revealed that deleting the region between nucleotides -331 and -287 (
287) ( Fig. 2F
) did not affect the luciferase activity ( Fig. 2F
). Deleting the region between nucleotides -331 and -254 (
254) and between nucleotides -331 and -185 (
185) decreased luciferase activity by 50 and 70% (Fig. 2F
), respectively.
A DNA fragment containing the region between nucleotides -134 and -64 was used as a probe to examine the binding of Zta. The DNA was incubated with cell extract prepared from P3HR1 cells treated with TPA and sodium butyrate. Electrophoretic mobility-shift assay (EMSA) revealed that proteins in the cell extract bound to this DNA fragment (Fig. 3A![]()
, lane 1). Adding a DNA fragment containing an Rta-response element (RRE) did not compete against the binding ( Fig. 3A
, lanes 3). On the other hand, adding an excessive amount of Zta-response element (ZRE) to the binding mixture prevented binding (Fig. 3A
, lane 2). A supershifted band appeared when antibody against Zta was added to the binding mixture ( Fig. 3A
, lane 4). According to computer analysis the ZRE is probably located between nucleotides -65 and -71 ( Fig. 1A
). Since deletion analysis revealed that the region between nucleotides -287 and -185 may contain RRE ( Fig. 2F
), we used DNA fragments covering this region to examine if Rta binds to the fragments. Results showed that recombinant GSTRta but not GST bound to the region between nucleotides -287 and -254, indicating that this region contains an RRE. The band was supershifted by antibody against Rta (Fig. 3B
). Our results also demonstrated that GSTRta does not bind to the fragments covering the region between nucleotides -254 and -185 and the region between -185 and -134.
|
| Acknowledgments |
|---|
| References |
|---|
|
|
|---|
Chang, P.-J. , Chang, Y.-S. & Liu, S.-T. (1998a). Characterization of the BcLF1 promoter in EpsteinBarr virus. Journal of General Virology 79, 2003 -2006.[Abstract]
Chang, P. J. , Chang, Y. S. & Liu, S. T. (1998b). Role of Rta in the translation of bicistronic BZLF1 of EpsteinBarr virus. Journal of Virology 72, 5128 -5136.
Chavrier, P. , Gruffat, H. , Chevallier-Greco, A. , Buisson, M. & Sergeant, A. (1989). The EpsteinBarr virus (EBV) early promoter DR contains a cis-acting element responsive to the EBV transactivator EB1 and an enhancer with constitutive and inducible activities. Journal of Virology 63, 607-614.
Chevallier-Greco, A. , Gruffat, H. , Manet, E. , Calender, A. & Sergeant, A. (1989). The EpsteinBarr virus (EBV) DR enhancer contains two functionally different domains: domain A is constitutive and cell specific, domain B is transactivated by the EBV early protein R. Journal of Virology 63, 615-623.
Cox, M. A. , Leahy, J. & Hardwick, J. M. (1990). An enhancer within the divergent promoter of EpsteinBarr virus responds synergistically to the R and Z transactivators. Journal of Virology 64, 313-321.
Decaussin, G. , Leclerc, V. & Ooka, T. (1995). The lytic cycle of EpsteinBarr virus in the nonproducer Raji line can be rescued by the expression of a 135-kilodalton protein encoded by the BALF2 open reading frame. Journal of Virology 69, 7309-7314 .[Abstract]
de Wet, J. R. , Wood, K. V. , DeLuca, M. , Helinski, D. R. & Subramani, S. (1987). Firefly luciferase gene: structure and expression in mammalian cells. Molecular and Cellular Biology 7, 725-737.
Fixman, E. D. , Hayward, G. S. & Hayward, S. D. (1992). Trans-acting requirements for replication of EpsteinBarr virus ori-Lyt. Journal of Virology 66, 5030-5039 .
Furnari, F. B. , Adams, M. D. & Pagano, J. S. (1992). Regulation of the EpsteinBarr virus DNA polymerase gene. Journal of Virology 66, 2837-2845 .
Gruffat, H. & Sergeant, A. (1994). Characterization of the DNA- binding site repertoire for the EpsteinBarr virus transcription factor R. Nucleic Acids Research 22, 1172-1178 .
Holley-Guthrie, E. A. , Quinlivan, E. B. , Mar, E. C. & Kenney, S. (1990). The EpsteinBarr virus (EBV) BMRF1 promoter for early antigen (EA-D) is regulated by the EBV transactivators, BRLF1 and BZLF1, in a cell-specific manner. Journal of Virology 64, 3753-3759 .
Luka, J. , Kallin, B. & Klein, G. (1979). Induction of the EpsteinBarr virus (EBV) cycle in latently infected cells by n-butyrate. Virology 94, 228-231.[Medline]
Nonoyama, M. & Pagano, J. S. (1972). Replication of viral deoxyribonucleic acid and breakdown of cellular deoxyribonucleic acid in EpsteinBarr virus infection. Journal of Virology 9, 714-716.
Polack, A. , Delius, H. , Zimber, U. & Bornkamm, G. W. (1984). Two deletions in the EpsteinBarr virus genome of the Burkitt lymphoma nonproducer line Raji. Virology 133, 146-157.[Medline]
Takada, K. & Zur Hausen, H. (1984). Induction of EpsteinBarr virus antigens by tumor promoters for epidermal and nonepidermal tissues. International Journal of Cancer 33, 491-496.
Tsurumi, T. , Kobayashi, A. , Tamai, K. , Yamada, H. , Daikoku, T. , Yamashita, Y. & Nishiyama, Y. (1996). EpsteinBarr virus single- stranded DNA-binding protein: purification, characterization, and action on DNA synthesis by the viral DNA polymerase. Virology 222, 352-364.[Medline]
zur Hausen, H. , Fresen, K. O. & Bornkamm, G. W. (1978). EpsteinBarr virus genomes and their biological functions: a review. IARC Scientific Publications 24, 3-10.
Received 15 March 1999;
accepted 29 June 1999.
This article has been cited by other articles:
![]() |
Y.-H. Lee, Y.-F. Chiu, W.-H. Wang, L.-K. Chang, and S.-T. Liu Activation of the ERK signal transduction pathway by Epstein-Barr virus immediate-early protein Rta J. Gen. Virol., October 1, 2008; 89(10): 2437 - 2446. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. A. Calderwood, A. M. Holthaus, and E. Johannsen The Epstein-Barr Virus LF2 Protein Inhibits Viral Replication J. Virol., September 1, 2008; 82(17): 8509 - 8519. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y.-F. Chiu, C.-P. Tung, Y.-H. Lee, W.-H. Wang, C. Li, J.-Y. Hung, C.-Y. Wang, Y. Kawaguchi, and S.-T. Liu A comprehensive library of mutations of Epstein Barr virus J. Gen. Virol., September 1, 2007; 88(9): 2463 - 2472. [Abstract] [Full Text] [PDF] |
||||
![]() |
C.-H. Ho, C.-F. Hsu, P.-F. Fong, S.-K. Tai, S.-L. Hsieh, and C.-J. Chen Epstein-Barr Virus Transcription Activator Rta Upregulates Decoy Receptor 3 Expression by Binding to Its Promoter J. Virol., May 1, 2007; 81(9): 4837 - 4847. [Abstract] [Full Text] [PDF] |
||||
![]() |
T.-Y. Hsu, Y. Chang, P.-W. Wang, M.-Y. Liu, M.-R. Chen, J.-Y. Chen, and C.-H. Tsai Reactivation of Epstein-Barr virus can be triggered by an Rta protein mutated at the nuclear localization signal J. Gen. Virol., February 1, 2005; 86(2): 317 - 322. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Chang, H.-H. Lee, S.-S. Chang, T.-Y. Hsu, P.-W. Wang, Y.-S. Chang, K. Takada, and C.-H. Tsai Induction of Epstein-Barr Virus Latent Membrane Protein 1 by a Lytic Transactivator Rta J. Virol., December 1, 2004; 78(23): 13028 - 13036. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| INT J SYST EVOL MICROBIOL | MICROBIOLOGY | J GEN VIROL |
| J MED MICROBIOL | ALL SGM JOURNALS | |