J Gen Virol Email Content Delivery
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via CrossRef
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Urcuqui-Inchima, S.
Right arrow Articles by Bernardi, F.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Urcuqui-Inchima, S.
Right arrow Articles by Bernardi, F.
Agricola
Right arrow Articles by Urcuqui-Inchima, S.
Right arrow Articles by Bernardi, F.
Journal of General Virology (1999), 80, 2809-2812.
© 1999 Society for General Microbiology


Plant

Effect of mutations within the Cys-rich region of potyvirus helper component-proteinase on self-interaction

Silvio Urcuqui-Inchima1, Ivan G. Maia2, Gabrièle Drugeon 1, Anne-Lise Haenni1 and Françoise Bernardi1

Institut Jacques Monod, 2 Place Jussieu – Tour 43, 75251 Paris Cedex 05, France1
Centro de Biologia Molecular e Engenharia Genética, UNICAMP, CP 6109, Campinas – SP, Brazil2

Author for correspondence: Silvio Urcuqui-Inchima.Fax +33 1 44 27 35 80. e- mail urcuqui{at}ijm.jussieu.fr (On leave from the Centro Fruticola Andino, Cali, Colombia.)


   Abstract
TOP
Abstract
Main text
References
 
The first ~60 amino acids of the N-terminal part of the potyvirus helper component-proteinase (HC-Pro) include highly conserved residues comprising a Cys-rich region. In the present study, the domain in Potato virus Y sufficient for self-interaction was mapped using the yeast two-hybrid system to the 83 N-terminal amino acids of HC-Pro. Mutations in the conserved His and two Cys residues within the Cys-rich region have a strong debilitating effect on self-interaction when introduced in the full-length HC-Pro, but not when introduced in the N-terminal fragment.


   Main text
TOP
Abstract
Main text
References
 
The genome of Potato virus Y (PVY), the type member of the genus Potyvirus, contains a monopartite single-stranded RNA of positive polarity. It is translated into a single polyprotein which is processed by three virus-encoded proteinases into the structural and nonstructural proteins necessary for the virus life- cycle (reviewed in Riechmann et al., 1992Down ). Some are these are multifunctional proteins, for example the helper component-proteinase (HC-Pro; reviewed in Maia et al., 1996Down ), the second protein from the N terminus of the polyprotein. This protein has autoproteolytic activity for the release of its own C terminus from the polyprotein, is necessary for systemic movement of the virus within infected plants, is involved in virus amplification and symptom expression, and is required for aphid- transmission of the virus. In addition, the N terminus of HC-Pro from all potyviruses possesses a region containing the highly conserved Lys- Ile-Thr-Cys (KITC) sequence, and it has been shown that the Lys of this sequence is involved in interaction between HC-Pro and the mouthparts of aphids (Blanc et al., 1998Down ). In all potyviruses, this region (which in PVY encompasses amino acids 23 to 56) is rich in Cys residues and contains a highly conserved His residue at position 23 (Fig. 1Down).



View larger version (16K):
[in this window]
[in a new window]
 
Fig. 1. Schematic representation of full-length wild-type PVY HC-Pro (WT) and the deleted constructs PN1 and PN2. The black lines correspond to the part of HC-Pro deleted in PN1 and PN2. The proteins are represented as rectangles and the amino acid stretch present in each polypeptide is shown to the right. The region encompassing amino acids 23 to 56 is shaded. For the WT and PN2 constructs, the sequence within this region is specified. The amino acids that have been independently mutated are in bold and underlined, with their position provided and the amino acid present in the mutant indicated below.

 
The size of biologically active HC-Pro is between 100 and 150 kDa for PVY and Tobacco vein mottling virus (TVMV; Thornbury et al., 1985Down ). These active forms can be resolved as 58 (PVY) and 53 (TVMV) kDa proteins by denaturing gel electrophoresis, suggesting that HC-Pro is a homodimer. Using the yeast two-hybrid system we have previously shown that the N-terminal half (amino acids 1 to 228) of HC-Pro of isolate PVY-LYE84 is capable of self-interaction (Urcuqui-Inchima et al., 1999Down ). We have now further trimmed HC-Pro, and demonstrate that the 83 N-terminal amino acids are sufficient for self-interaction. Furthermore, we show that the highly conserved C25 and C53 residues within the Cys-rich domain, as well as H23, are involved in HC-Pro self-interaction when present in full-length HC-Pro.

For the two-hybrid experiments, pGADGH-STOP (activation domain) and pLexA (DNA-binding domain; Urcuqui-Inchima et al., 1999Down ) were cleaved by EcoRI/BglII and EcoRI/Bam HI respectively, and purified using the QIAquick gel extraction kit (Qiagen).

The fragment corresponding to the 5'-terminal 249 nucleotides (83 amino acids) of PVY-LYE84 HC-Pro (Maia & Bernardi, 1996Down ) was recovered by EcoRI/SalI digestion of pT7:HC-Pro, and purified using the QIAquick gel extraction kit. To clone this region (designated PN2) into pGADGH-STOP and pLexA, we used an adapter that was obtained by annealing oligonucleotides 5' p TCGACTGTAATTAATTAA 3' and 5' pGATCT TAATTAATTACAG 3', carrying the SalI and BglII sites (underlined), and termination codons in all three reading frames. PN1, corresponding to the N-terminal 228 amino acids of PVY HC-Pro, was obtained as described previously (Urcuqui-Inchima et al., 1999Down ).

Four mutants with single amino acid substitutions in the N-terminal Cys-rich region of PVY HC-Pro shown in Fig. 1Up were prepared. Point mutants were obtained by site-directed mutagenesis using the Transformer site-directed mutagenesis kit version 2, as specified by Clontech, with the following oligonucleotides (introduced changes underlined):

5' GATACCCCTCAGATGGTACC TGTGTAGCTGGTTTACCG 3', for mutant H23G

5' CCCTCAGATCATACCGGTGTAGCTGG 3', for mutant C 25G

5' CTACCGTGTTACGAGATAACTGCCCC 3', for mutant K 50E

5' CCGTGTTACAAGATAACGGGCCCCACCTGTGCTC 3', for mutant C53G

The mutants were initially constructed in pMal:NtHC (Maia & Bernardi, 1996Down ), which contains the sequence encoding the N- terminal 118 amino acids of HC-Pro between EcoRI and Dra I sites. To introduce the point mutations within full-length HC- Pro, an EcoRI/ClaI fragment spanning the Cys-rich region in pMal:HC-Pro (Maia & Bernardi, 1996Down ) was replaced by the corresponding and identically digested fragments from the pMal:NtHC mutants. All recombinant plasmids were sequenced to confirm the presence of the introduced mutations.

The entire cDNA of wild-type HC-Pro, and HC-Pro with single amino acid substitutions in the full-length protein at H23, C25, K50 and C53 contained in pMal:HC-Pro, were released by EcoRI/XbaI and inserted into similarly cleaved pGADGH-STOP. Each of the resulting constructs was cleaved by EcoRI/XhoI and the fragment carrying the HC-Pro gene inserted into pLexA cleaved by EcoRI/Sal I. Four PN2 point mutants were prepared by introducing the Eco RI/SalI fragments of the corresponding full-length mutants in either pLexA or pGADGH-STOP carrying the SalI/BglII adapter.

The recombinant plasmids were amplified in Escherichia coli and used to transform Saccharomyces cerevisiae L40 (Le Douarin et al., 1995Down ) by co-transformation as described in the Stratagene HybriZAPr 2.1 kit. Clones were plated on selective medium without Trp, Leu or His (not shown) and their ß- galactosidase activities tested on X-Gal (5-bromo-4-chloro-3-indolyl ß-d-galactopyranoside). Unrelated sequences [the human proteins Ras and Raf (Vojtek et al., 1993Down ) and murine laminin {gamma}1 (Chang et al., 1996Down )] were used as positive or negative interaction controls respectively.

For quantitative ß-galactosidase assays, the transformed yeast colonies were cultured overnight in synthetic selective medium lacking Trp, Leu and His. The overnight cultures were diluted 10-fold with fresh medium and grown to OD600 0·4 to 0·9 before performing the quantitative assays. Cell permeabilization was performed as described by Guarente (1983)Down . O- Nitrophenyl ß-d-galactopyranoside (Sigma) was the chromogenic substrate, and ß-galactosidase activity was determined as described by Miller (1972)Down and expressed as Miller units.

Firstly, the two-hybrid system was used to study possible dimer formation by the N terminus (PN2) of PVY HC-Pro with itself and with wild-type HC-Pro. When tested with itself, PN2 had the same high ß- galactosidase activity as did HC-Pro tested with itself (Table 1 Down). Interaction between PN2 and HC-Pro depended on whether PN2 was cloned in pGADGH-STOP or pLexA: higher levels of ß-galactosidase activity were observed when PN2 and HC- Pro were cloned in pGADGH-STOP and pLexA respectively than in the converse situation.


View this table:
[in this window]
[in a new window]
 
Table 1. Evaluation of the interactions between PVY HC-Pro and its deleted or mutated constructs

 
PN1 tested with itself produced background levels of ß- galactosidase activity, and when tested with wild-type HC-Pro it yielded higher levels of activity when it was in PGADGH-STOP (Table 1 Up), as already observed (Urcuqui-Inchima et al., 1999Down ). Interaction between PN2 and PN1 led to low ß- galactosidase activity, in particular when PN2 was inserted into pGADGH- STOP. The reason why PN1 produces such low levels of activity when tested with itself as opposed to PN2 tested with itself might be due to the presence in PN1, beyond amino acid 83, of sequences inhibiting self- interaction. Removal of these sequences in PN2 would favour interaction.

The N-terminal region of HC-Pro contains the Cys-rich domain. Full- length HC-Pro with the individual point mutations was tested with wild- type HC-Pro (Table 1Up). The mutation K50E had no detectable effect on self-interaction with wild-type HC-Pro. Mutation of residues H23G, C25G and C53 G strongly reduced the ß-galactosidase activity if the mutated HC- Pro was cloned in pGADGH-STOP and wild-type HC-Pro in pLexA (Table 1 Up). When the mutated HC-Pro were cloned in pLexA and wild- type HC-Pro in pGADGH-STOP, the ß-galactosidase activity was 2- fold lower than the activity of wild-type HC-Pro tested with itself.

To test the effect of each mutated residue in HC-Pro on self- interaction, each mutant was tested with itself and with the other mutants. The ß-galactosidase activity was close to background levels when each mutant was tested with itself except for K50 E, which was as efficient as wild-type HC-Pro with itself (Table 1 Up). With the exception of the K50E mutant, when each mutant was tested with each of the other mutants, activity was dramatically reduced. Interestingly, when K50E was tested with the other mutants contained in pGADGH-STOP or pLexA, ß- galactosidase activity was similar to interaction of wild-type HC-Pro tested with each mutant.

PN1 or PN2 tested with each mutated HC-Pro virtually abolished protein–protein interaction (Table 1Up). Whereas the mutation K50E did not affect self-interaction or interaction with wild-type HC-Pro, the interaction between this mutant and PN1 or PN2 was totally abolished.

The individual point mutants contained in PN2 were also tested against PN2 and each other (Table 2Down). In all the cases tested, these mutants yielded ß-galactosidase activity equivalent or higher than PN2–PN2 interaction, except for mutant C53G which showed a strongly reduced response.


View this table:
[in this window]
[in a new window]
 
Table 2. Evaluation of the interactions between PVY PN2 and its mutated constructs

 
The results presented here demonstrate that the 83 N-terminal amino acids of PVY HC-Pro (PN2) are sufficient for self-interaction. This is in line with previous results on Lettuce mosaic virus HC-Pro, for which the N-terminal 72 amino acids are sufficient for self- interaction (Urcuqui-Inchima et al., 1999Down ). In an attempt to identify the amino acids in HC-Pro involved in self- interaction, conserved amino acids of the Cys-rich domain were mutated both in full-length HC-Pro and in PN2. It was previously postulated that the Cys-rich domain of PVY HC-Pro could be involved in the formation of a metal-binding site (Robaglia et al., 1989Down ), and moreover well-studied examples of protein dimerization through a zinc finger have appeared (Pan et al., 1989Down ; Chantalat et al., 1999Down ).

In the full-length PVY HC-Pro, the single amino acid changes His23, Cys25 and Cys53 to Gly within the Cys- rich domain are critical for protein–protein interaction (Table 1 Up), whereas this does not seem to be the case for the K 50E mutant. In contrast, the results obtained when the same mutations were introduced in PN2 were very different (Table 2 Up): only C53G showed a marked decrease in ß-galactosidase activity as compared to wild-type PN2 or the other mutants. The different behaviour of the mutants whether in full-length HC-Pro or PN2 suggests a more complex situation than anticipated. Various hypotheses can be put forward to explain these discrepancies: (i) the conformation of PN2 whether alone or in the full-length HC-Pro could be different; (ii) the conformation of the mutants could modify the interactions; (iii) the stability of the various constructs could be different; and (iv) other intra- or inter-molecular interactions could be implicated. As for potyviruses, one cannot exclude the possibility that in different potyviruses different regions of HC-Pro are required for self-interaction. Indeed, other domains have been identified in the case of Potato virus A (Guo et al .,1999Down ), between amino acids 112 and 135 near the N terminus, and between amino acids 329 and 457 at the C terminus.

The precise biological role of the N-terminal region of HC-Pro, in particular with respect to the capacity of this region to self- interact, remains to be established. K50 is an essential residue for transmission and infectivity (Atreya & Pirone, 1993Down ) but does not seem to play a role in self-interaction. On the other hand, H23, C25 and C53 are essential for the viability of TVMV (Atreya & Pirone, 1993Down ) whereas the entire N-terminal region of Tobacco etch virus is dispensable (Dolja et al., 1993Down ). Our results indicate that these amino acids are dispensable for self- interaction of the N-terminal region whereas they decrease self- interaction of the full-length protein when mutated. These results are in agreement with the suggestions (Atreya & Pirone, 1993Down ) that the N terminus may have important structural features for the proper folding of an active HC-Pro protein.


   Acknowledgments
 
S.U.-I. is grateful to Colciencias (Colombia) and the French `Ministère des Affaires Etrang ères' for fellowships, and thanks Claude Vuillaume (CIRAD, Guadeloupe) for his constant encouragement and interest in this work. I.G.M. thanks the Brazilian agencies CNPq and FAPESP for postdoctoral fellowships. The Institut Jacques Monod is an `Institut Mixte, CNRS – Universités Paris VI et VII'.


   References
TOP
Abstract
Main text
References
 
Atreya, C. D. & Pirone, T. P. (1993). Mutational analysis of the helper component-proteinase gene of a potyvirus: effects of amino acid substitutions, deletions, and gene replacement on virulence and aphid transmissibility. Proceedings of the National Academy of Sciences, USA 90, 11919-11923 .[Abstract/Free Full Text]

Blanc, S. , Ammar, E. D. , García-Lampasona, S. , Dolja, V. V. , Llave, C. , Baker, J. & Pirone, T. P. (1998). Mutations in the potyvirus helper component protein: effects on interactions with virions and aphid stylets. Journal of General Virology 79, 3119-3122 .[Abstract]

Chang, H. S. , Kim, N. B. & Phillips, S. L. (1996). Positive elements in the laminin {gamma}1 gene synergize to activate high level transcription during cellular differentiation. Nucleic Acids Research 24, 1360-1368 .[Abstract/Free Full Text]

Chantalat, L. , Leroy, D. , Fihol, O. , Nueda, A. , Benitez, M. J. , Chambaz, E. M. , Cochet, C. & Dideberg, O. (1999). Crystal structure of the human protein kinase CK2 regulatory subunit reveals its zinc finger-mediated dimerization. EMBO Journal 18, 2930-2940 .[Medline]

Dolja, V. V. , Herndon, K. L. & Carrington, J. C. (1993). Spontaneous mutagenesis of a plant potyvirus genome after insertion of a foreign gene. Journal of Virology 67, 5968-5975 .[Abstract/Free Full Text]

Guarente, L. (1983). Yeast promoters and lacZ fusions designed to study expression of cloned genes in yeast. Methods in Enzymology 101, 181-191.[Medline]

Guo, D. , Merits, A. & Saarma, M. (1999). Self-association and mapping of interaction domains of helper component-proteinase of potato A potyvirus. Journal of General Virology 80, 1127-1131 .[Abstract]

Le Douarin, B. , Zechel, C. , Garnier, J. M. , Lutz, Y. , Tora, L. , Pierrat, P. , Heery, D. , Gronemeyer, H. , Chambon, P. & Losson, R. (1995). The N-terminal part of TIF1, a putative mediator of the ligand-dependent activation function (AF-2) of nuclear receptors, is fused to B-raf in the oncogenic protein T18. EMBO Journal 14, 2020-2033 .[Medline]

Maia, I. G. & Bernardi, F. (1996). Nucleic acid-binding properties of a bacterially expressed potato virus Y helper component-proteinase. Journal of General Virology 77, 869-877.[Abstract/Free Full Text]

Maia, I. G. , Haenni, A.-L. & Bernardi, F. (1996). Potyviral HC-Pro: a multifunctional protein. Journal of General Virology 77, 1335-1341 .[Abstract/Free Full Text]

Miller, J. H. (1972). Experiments in Molecular Genetics. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory.

Pan, T. , Giedroc, D. P. & Coleman, J. E. (1989). 1H NMR studies of T4 gene 32 protein: effects of zinc removal and reconstitution. Biochemistry 28, 8828-8832 .[Medline]

Riechmann, J. L. , Laín, S. & García, J. A. (1992). Highlights and prospects of potyvirus molecular biology. Journal of General Virology 73, 1-16.[Abstract/Free Full Text]

Robaglia, C. , Durand-Tardif, M. , Tronchet, M. , Boudazin, G. , Astier-Manifacier, S. & Casse-Delbart, F. (1989). Nucleotide sequence of potato virus Y (N strain) genomic RNA. Journal of General Virology 70, 935-947.[Abstract/Free Full Text]

Thornbury, D. W. , Hellmann, G. M. , Rhoads, R. E. & Pirone, T. P. (1985). Purification and characterization of potyvirus helper component. Virology 144, 260-267.

Urcuqui-Inchima, S. , Walter, J. , Drugeon, G. , German-Retana, S. , Haenni, A.-L. , Candresse, T. , Bernardi, F. & Le Gall, O. (1999). Potyvirus helper component- proteinase self-interaction in the yeast two-hybrid system and delineation of the interaction domain involved. Virology 258, 95-99.[Medline]

Vojtek, A. B. , Hollenberg, S. M. & Cooper, J. A. (1993). Mammalian Ras interacts directly with the serine/threonine kinase Raf. Cell 74, 205-214.[Medline]

Received 11 May 1999; accepted 30 July 1999.


This article has been cited by other articles:


Home page
J. Virol.Home page
A. Valli, G. Dujovny, and J. A. Garcia
Protease Activity, Self Interaction, and Small Interfering RNA Binding of the Silencing Suppressor P1b from Cucumber Vein Yellowing Ipomovirus
J. Virol., January 15, 2008; 82(2): 974 - 986.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
C. Plisson, M. Drucker, S. Blanc, S. German-Retana, O. Le Gall, D. Thomas, and P. Bron
Structural Characterization of HC-Pro, a Plant Virus Multifunctional Protein
J. Biol. Chem., June 20, 2003; 278(26): 23753 - 23761.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via CrossRef
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Urcuqui-Inchima, S.
Right arrow Articles by Bernardi, F.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Urcuqui-Inchima, S.
Right arrow Articles by Bernardi, F.
Agricola
Right arrow Articles by Urcuqui-Inchima, S.
Right arrow Articles by Bernardi, F.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
INT J SYST EVOL MICROBIOL MICROBIOLOGY J GEN VIROL
J MED MICROBIOL ALL SGM JOURNALS