|
|
||||||||
Plant |
Institut Jacques Monod, 2 Place Jussieu Tour 43, 75251 Paris Cedex 05, France1
Centro de Biologia Molecular e Engenharia Genética, UNICAMP, CP 6109, Campinas SP, Brazil2
Author for correspondence: Silvio Urcuqui-Inchima.Fax +33 1 44 27 35 80. e- mail urcuqui{at}ijm.jussieu.fr (On leave from the Centro Fruticola Andino, Cali, Colombia.)
| Abstract |
|---|
|
|
|---|
| Main text |
|---|
|
|
|---|
|
For the two-hybrid experiments, pGADGH-STOP (activation domain) and pLexA (DNA-binding domain; Urcuqui-Inchima et al., 1999
) were cleaved by EcoRI/BglII and EcoRI/Bam HI respectively, and purified using the QIAquick gel extraction kit (Qiagen).
The fragment corresponding to the 5'-terminal 249 nucleotides (83 amino acids) of PVY-LYE84 HC-Pro (Maia & Bernardi, 1996
) was recovered by EcoRI/SalI digestion of pT7:HC-Pro, and purified using the QIAquick gel extraction kit. To clone this region (designated PN2) into pGADGH-STOP and pLexA, we used an adapter that was obtained by annealing oligonucleotides 5' p TCGACTGTAATTAATTAA 3' and 5' pGATCT TAATTAATTACAG 3', carrying the SalI and BglII sites (underlined), and termination codons in all three reading frames. PN1, corresponding to the N-terminal 228 amino acids of PVY HC-Pro, was obtained as described previously (Urcuqui-Inchima et al., 1999
).
Four mutants with single amino acid substitutions in the N-terminal Cys-rich region of PVY HC-Pro shown in Fig. 1
were prepared. Point mutants were obtained by site-directed mutagenesis using the Transformer site-directed mutagenesis kit version 2, as specified by Clontech, with the following oligonucleotides (introduced changes underlined):
5' GATACCCCTCAGATGGTACC TGTGTAGCTGGTTTACCG 3', for mutant H23G
5' CCCTCAGATCATACCGGTGTAGCTGG 3', for mutant C 25G
5' CTACCGTGTTACGAGATAACTGCCCC 3', for mutant K 50E
5' CCGTGTTACAAGATAACGGGCCCCACCTGTGCTC 3', for mutant C53G
The mutants were initially constructed in pMal:NtHC (Maia & Bernardi, 1996
), which contains the sequence encoding the N- terminal 118 amino acids of HC-Pro between EcoRI and Dra I sites. To introduce the point mutations within full-length HC- Pro, an EcoRI/ClaI fragment spanning the Cys-rich region in pMal:HC-Pro (Maia & Bernardi, 1996
) was replaced by the corresponding and identically digested fragments from the pMal:NtHC mutants. All recombinant plasmids were sequenced to confirm the presence of the introduced mutations.
The entire cDNA of wild-type HC-Pro, and HC-Pro with single amino acid substitutions in the full-length protein at H23, C25, K50 and C53 contained in pMal:HC-Pro, were released by EcoRI/XbaI and inserted into similarly cleaved pGADGH-STOP. Each of the resulting constructs was cleaved by EcoRI/XhoI and the fragment carrying the HC-Pro gene inserted into pLexA cleaved by EcoRI/Sal I. Four PN2 point mutants were prepared by introducing the Eco RI/SalI fragments of the corresponding full-length mutants in either pLexA or pGADGH-STOP carrying the SalI/BglII adapter.
The recombinant plasmids were amplified in Escherichia coli and used to transform Saccharomyces cerevisiae L40 (Le Douarin et al., 1995
) by co-transformation as described in the Stratagene HybriZAPr 2.1 kit. Clones were plated on selective medium without Trp, Leu or His (not shown) and their ß- galactosidase activities tested on X-Gal (5-bromo-4-chloro-3-indolyl ß-d-galactopyranoside). Unrelated sequences [the human proteins Ras and Raf (Vojtek et al., 1993
) and murine laminin
1 (Chang et al., 1996
)] were used as positive or negative interaction controls respectively.
For quantitative ß-galactosidase assays, the transformed yeast colonies were cultured overnight in synthetic selective medium lacking Trp, Leu and His. The overnight cultures were diluted 10-fold with fresh medium and grown to OD600 0·4 to 0·9 before performing the quantitative assays. Cell permeabilization was performed as described by Guarente (1983)
. O- Nitrophenyl ß-d-galactopyranoside (Sigma) was the chromogenic substrate, and ß-galactosidase activity was determined as described by Miller (1972)
and expressed as Miller units.
Firstly, the two-hybrid system was used to study possible dimer formation by the N terminus (PN2) of PVY HC-Pro with itself and with wild-type HC-Pro. When tested with itself, PN2 had the same high ß- galactosidase activity as did HC-Pro tested with itself (Table 1
). Interaction between PN2 and HC-Pro depended on whether PN2 was cloned in pGADGH-STOP or pLexA: higher levels of ß-galactosidase activity were observed when PN2 and HC- Pro were cloned in pGADGH-STOP and pLexA respectively than in the converse situation.
|
The N-terminal region of HC-Pro contains the Cys-rich domain. Full- length HC-Pro with the individual point mutations was tested with wild- type HC-Pro (Table 1
). The mutation K50E had no detectable effect on self-interaction with wild-type HC-Pro. Mutation of residues H23G, C25G and C53 G strongly reduced the ß-galactosidase activity if the mutated HC- Pro was cloned in pGADGH-STOP and wild-type HC-Pro in pLexA (Table 1
). When the mutated HC-Pro were cloned in pLexA and wild- type HC-Pro in pGADGH-STOP, the ß-galactosidase activity was 2- fold lower than the activity of wild-type HC-Pro tested with itself.
To test the effect of each mutated residue in HC-Pro on self- interaction, each mutant was tested with itself and with the other mutants. The ß-galactosidase activity was close to background levels when each mutant was tested with itself except for K50 E, which was as efficient as wild-type HC-Pro with itself (Table 1
). With the exception of the K50E mutant, when each mutant was tested with each of the other mutants, activity was dramatically reduced. Interestingly, when K50E was tested with the other mutants contained in pGADGH-STOP or pLexA, ß- galactosidase activity was similar to interaction of wild-type HC-Pro tested with each mutant.
PN1 or PN2 tested with each mutated HC-Pro virtually abolished proteinprotein interaction (Table 1
). Whereas the mutation K50E did not affect self-interaction or interaction with wild-type HC-Pro, the interaction between this mutant and PN1 or PN2 was totally abolished.
The individual point mutants contained in PN2 were also tested against PN2 and each other (Table 2
). In all the cases tested, these mutants yielded ß-galactosidase activity equivalent or higher than PN2PN2 interaction, except for mutant C53G which showed a strongly reduced response.
|
In the full-length PVY HC-Pro, the single amino acid changes His23, Cys25 and Cys53 to Gly within the Cys- rich domain are critical for proteinprotein interaction (Table 1
), whereas this does not seem to be the case for the K 50E mutant. In contrast, the results obtained when the same mutations were introduced in PN2 were very different (Table 2
): only C53G showed a marked decrease in ß-galactosidase activity as compared to wild-type PN2 or the other mutants. The different behaviour of the mutants whether in full-length HC-Pro or PN2 suggests a more complex situation than anticipated. Various hypotheses can be put forward to explain these discrepancies: (i) the conformation of PN2 whether alone or in the full-length HC-Pro could be different; (ii) the conformation of the mutants could modify the interactions; (iii) the stability of the various constructs could be different; and (iv) other intra- or inter-molecular interactions could be implicated. As for potyviruses, one cannot exclude the possibility that in different potyviruses different regions of HC-Pro are required for self-interaction. Indeed, other domains have been identified in the case of Potato virus A (Guo et al .,1999
), between amino acids 112 and 135 near the N terminus, and between amino acids 329 and 457 at the C terminus.
The precise biological role of the N-terminal region of HC-Pro, in particular with respect to the capacity of this region to self- interact, remains to be established. K50 is an essential residue for transmission and infectivity (Atreya & Pirone, 1993
) but does not seem to play a role in self-interaction. On the other hand, H23, C25 and C53 are essential for the viability of TVMV (Atreya & Pirone, 1993
) whereas the entire N-terminal region of Tobacco etch virus is dispensable (Dolja et al., 1993
). Our results indicate that these amino acids are dispensable for self- interaction of the N-terminal region whereas they decrease self- interaction of the full-length protein when mutated. These results are in agreement with the suggestions (Atreya & Pirone, 1993
) that the N terminus may have important structural features for the proper folding of an active HC-Pro protein.
| Acknowledgments |
|---|
| References |
|---|
|
|
|---|
Blanc, S. , Ammar, E. D. , García-Lampasona, S. , Dolja, V. V. , Llave, C. , Baker, J. & Pirone, T. P. (1998). Mutations in the potyvirus helper component protein: effects on interactions with virions and aphid stylets. Journal of General Virology 79, 3119-3122 .[Abstract]
Chang, H. S. , Kim, N. B. & Phillips, S. L. (1996). Positive elements in the laminin
1 gene synergize to activate high level transcription during cellular differentiation. Nucleic Acids Research 24, 1360-1368 .
Chantalat, L. , Leroy, D. , Fihol, O. , Nueda, A. , Benitez, M. J. , Chambaz, E. M. , Cochet, C. & Dideberg, O. (1999). Crystal structure of the human protein kinase CK2 regulatory subunit reveals its zinc finger-mediated dimerization. EMBO Journal 18, 2930-2940 .[Medline]
Dolja, V. V. , Herndon, K. L. & Carrington, J. C. (1993). Spontaneous mutagenesis of a plant potyvirus genome after insertion of a foreign gene. Journal of Virology 67, 5968-5975 .
Guarente, L. (1983). Yeast promoters and lacZ fusions designed to study expression of cloned genes in yeast. Methods in Enzymology 101, 181-191.[Medline]
Guo, D. , Merits, A. & Saarma, M. (1999). Self-association and mapping of interaction domains of helper component-proteinase of potato A potyvirus. Journal of General Virology 80, 1127-1131 .[Abstract]
Le Douarin, B. , Zechel, C. , Garnier, J. M. , Lutz, Y. , Tora, L. , Pierrat, P. , Heery, D. , Gronemeyer, H. , Chambon, P. & Losson, R. (1995). The N-terminal part of TIF1, a putative mediator of the ligand-dependent activation function (AF-2) of nuclear receptors, is fused to B-raf in the oncogenic protein T18. EMBO Journal 14, 2020-2033 .[Medline]
Maia, I. G. & Bernardi, F. (1996). Nucleic acid-binding properties of a bacterially expressed potato virus Y helper component-proteinase. Journal of General Virology 77, 869-877.
Maia, I. G. , Haenni, A.-L. & Bernardi, F. (1996). Potyviral HC-Pro: a multifunctional protein. Journal of General Virology 77, 1335-1341 .
Miller, J. H. (1972). Experiments in Molecular Genetics. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory.
Pan, T. , Giedroc, D. P. & Coleman, J. E. (1989). 1H NMR studies of T4 gene 32 protein: effects of zinc removal and reconstitution. Biochemistry 28, 8828-8832 .[Medline]
Riechmann, J. L. , Laín, S. & García, J. A. (1992). Highlights and prospects of potyvirus molecular biology. Journal of General Virology 73, 1-16.
Robaglia, C. , Durand-Tardif, M. , Tronchet, M. , Boudazin, G. , Astier-Manifacier, S. & Casse-Delbart, F. (1989). Nucleotide sequence of potato virus Y (N strain) genomic RNA. Journal of General Virology 70, 935-947.
Thornbury, D. W. , Hellmann, G. M. , Rhoads, R. E. & Pirone, T. P. (1985). Purification and characterization of potyvirus helper component. Virology 144, 260-267.
Urcuqui-Inchima, S. , Walter, J. , Drugeon, G. , German-Retana, S. , Haenni, A.-L. , Candresse, T. , Bernardi, F. & Le Gall, O. (1999). Potyvirus helper component- proteinase self-interaction in the yeast two-hybrid system and delineation of the interaction domain involved. Virology 258, 95-99.[Medline]
Vojtek, A. B. , Hollenberg, S. M. & Cooper, J. A. (1993). Mammalian Ras interacts directly with the serine/threonine kinase Raf. Cell 74, 205-214.[Medline]
Received 11 May 1999;
accepted 30 July 1999.
This article has been cited by other articles:
![]() |
A. Valli, G. Dujovny, and J. A. Garcia Protease Activity, Self Interaction, and Small Interfering RNA Binding of the Silencing Suppressor P1b from Cucumber Vein Yellowing Ipomovirus J. Virol., January 15, 2008; 82(2): 974 - 986. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Plisson, M. Drucker, S. Blanc, S. German-Retana, O. Le Gall, D. Thomas, and P. Bron Structural Characterization of HC-Pro, a Plant Virus Multifunctional Protein J. Biol. Chem., June 20, 2003; 278(26): 23753 - 23761. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| INT J SYST EVOL MICROBIOL | MICROBIOLOGY | J GEN VIROL |
| J MED MICROBIOL | ALL SGM JOURNALS | |