J Gen Virol Email Content Delivery
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via CrossRef
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Mikkelsen, J. G.
Right arrow Articles by Pedersen, F. S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Mikkelsen, J. G.
Right arrow Articles by Pedersen, F. S.
Agricola
Right arrow Articles by Mikkelsen, J. G.
Right arrow Articles by Pedersen, F. S.
Journal of General Virology (1999), 80, 2957-2967.
© 1999 Society for General Microbiology


Animal: RNA Viruses

Forced recombination of {Psi}-modified murine leukaemia virus-based vectors with murine leukaemia-like and VL30 murine endogenous retroviruses

Jacob Giehm Mikkelsen1, Anders H. Lund1, Mogens Duch1 and Finn Skou Pedersen1,2

Department of Molecular and Structural Biology1 and Department of Medical Microbiology and Immunology,2 University of Aarhus, C. F. Moellers Allé, Bldg 130, DK-8000 Aarhus, Denmark

Author for correspondence: Finn Pedersen.Fax +45 86196500. e-mail fsp{at}mbio.aau.dk


   Abstract
TOP
Abstract
Introduction
Methods
Results
Discussion
References
 
Co-encapsidation of retroviral RNAs into virus particles allows for the generation of recombinant proviruses through events of template switching during reverse transcription. By use of a forced recombination system based on recombinational rescue of replication- defective primer binding site-impaired Akv–MLV-derived vectors, we here examine putative genetic interactions between vector RNAs and copackaged endogenous retroviral RNAs of the murine leukaemia virus (MLV) and VL30 retroelement families. We show (i) that MLV recombination is not blocked by nonhomology within the 5' untranslated region harbouring the supposed RNA dimer-forming cis -elements and (ii) that copackaged retroviral RNAs can recombine despite pronounced sequence dissimilarity at the cross-over site(s) and within parts of the genome involved in RNA dimerization, encapsidation and strand transferring during reverse transcription. We note that recombination-based rescue of primer binding site knock-out retroviral vectors may constitute a sensitive assay to register putative genetic interactions involving endogenous retroviral RNAs present in cells of various species.


   Introduction
TOP
Abstract
Introduction
Methods
Results
Discussion
References
 
Retroviruses replicate through a double-stranded DNA intermediate which is stably integrated into the host genome as proviral DNA. Upon infection of germ cells, proviruses are transmitted through the germ line and may persist as virus entities and Mendelian genes in the genome for multiple generations. Such elements of the genome, usually referred to as endogenous retroviruses (ERVs), are often replication- defective due to the accumulation of mutations and, in order to spread, rely on concomitant replication of helper viruses. ERV-derived RNA may thus hitchhike with virus particles released from the host cell (Patience et al., 1998Down ; Scadden et al., 1990Down ), provided that structural cis-elements within the ERV packaging signal facilitate recognition by the helper virus RNA encapsidation machinery. Among a panel of known murine ERVs, members of the murine leukaemia virus (MLV)-related and VL30 ERV families are selectively included in MLV virions (Chakraborty et al. , 1994Down ; Mikkelsen et al., 1996Down ; Patience et al., 1998Down ; Purcell et al., 1996Down ; Scolnick et al., 1979Down ).

Encapsidation of two genomic RNA molecules into budding retrovirus particles allows for recombination during reverse transcription within the viral core particle internalized in the cytoplasm of the newly infected cell. Retrovirus recombination occurs primarily by template switching of nascent minus-strand DNA (Anderson et al., 1998Down ; Coffin, 1979Down ; Hu & Temin, 1990aDown , bDown , 1992Down ; Hu et al., 1997Down ; Stuhlmann & Berg, 1992Down ), but may involve also events of plus-strand recombination (Junghans et al., 1982Down ; Mikkelsen et al., 1998aDown ). Coexistence and occasional copackaging of retroviral RNAs of exogenous and endogenous origin allow for the generation of recombinant proviruses harbouring sequences of both parental origins. In such a scenario, events of template switching during DNA synthesis may facilitate recombinational patch repair of virus mutations by substituting defective segments of the genome with functional sequence patches provided by the copackaged endogenous virus. Previously reported examples of ERV-based recombinational reversion include patch repair of virus mutants harbouring (i) modifications of the integrase attachment site (Colicelli & Goff, 1987aDown , bDown ; Murphy & Goff, 1994Down ); (ii) deletions within IN and PR regions of the pol gene (Martinelli & Goff, 1990Down ; Schwartzberg et al., 1985Down ); and (iii) defective primer binding sites (PBS; Mikkelsen et al., 1996Down , 1998bDown ). In addition, recombination events including both packaging construct and ERV-derived RNA have been found to result in `patch repair' of retrovirus vectors, leading to the hazardous generation of replication-competent viruses in retrovirus- based gene transfer applications (Chong et al., 1998Down ; Chong & Vile, 1996Down ; Vanin et al., 1994Down ).

RNA dimerization and encapsidation are tightly coupled events of retrovirus replication. Whereas copackaging of retroviral RNAs is a proven prerequisite for recombination (Hu & Temin, 1990aDown ), there remains an open question of whether RNA dimer formation is required for packaging and/or genetic interactions between copackaged RNAs. For all retroviruses studied, the primary determinants of RNA dimerization and encapsidation have been mapped to the packaging signal ({Psi}) within the 5' untranslated region (5' UTR) situated downstream from the PBS and upstream from the gag initiation codon. A specific stem–loop structure in the 5' UTR facilitates synthetic RNA dimer formation in vitro through intermolecular `kissing' of conserved palindromic loop motifs (Clever et al., 1996Down ; Fossé et al., 1996Down ; Girard et al. , 1995Down ; Haddrick et al., 1996Down ; Laughrea & Jetté, 1994Down ; Paillart et al., 1996bDown , 1997Down ). Within a 5' UTR recombination window, this kissing- loop sequence is a hotspot for nascent minus-strand DNA template switching between vector donor RNA and endogenous virus-derived acceptor RNA templates (Mikkelsen et al., 1996Down , 1998bDown ). Although the kissing-loop interaction may constitute only one of several intermolecular interactions required for RNA dimerization in vivo (Berkhout & van Wamel, 1996 Down ; Clever & Parslow, 1997Down ; Haddrick et al., 1996Down ; Laughrea et al., 1997Down ; Lear et al., 1995Down ; Paillart et al., 1996aDown ; Sakuragi & Panganiban, 1997Down ; Tch énio & Heidmann, 1995Down ), this result proposes that the kissing-loop sequence induces reverse transcriptase-mediated homologous recombination and raises the question of whether kissing-loop-defective viruses are less recombinogenic within the 5' UTR dimerization and recombination window. Recent findings suggest that the frequency of recombination elsewhere in the genome, within the coding regions of different human immunodeficiency virus type 1 (HIV-1) subtype RNAs, is not significantly affected by a lack of kissing-loop homology between interacting viral RNAs (St Louis et al., 1998Down ).

We have in previous work studied retrovirus recombination by a forced recombination approach based on the interaction between replication-defective MLV-based vectors and an MLV-like endogenous retrovirus (MLEV), which is encapsidated into virus particles derived from murine fibroblast-derived packaging cells (Mikkelsen et al., 1996Down , 1998aDown , b). This approach, based on single-cycle vector replication of PBS-defective vectors, allows for studies of template shifting events within the primary dimerization region, enabling us to study if alterations and nonhomologies within the primary packaging and dimerization region influence local recombination processes. Here, we examine putative genetic interactions between vector RNAs and copackaged ERV RNAs derived from MLEV and the VL30 retroelement family. Akv and MLEV harbour highly similar packaging and terminal repeat (R) sequences (Mikkelsen 1998aDown , bDown ), whereas members of the VL30 family contain packaging and R sequences that are not related to the corresponding regions of Akv (Adams et al., 1988Down ; Hodgson et al., 1990Down ). We describe modes of genetic interactions that take place in spite of dissimilarities in parts of the genome involved in intermolecular RNA recognition, encapsidation and strand transferring during reverse transcription.


   Methods
TOP
Abstract
Introduction
Methods
Results
Discussion
References
 
{blacksquare} Vector construction.
All vector constructions were derived from the Akv–MLV-based retrovirus vector tvPBSPro, harbouring the neomycin resistance gene (Lund et al., 1993Down ). The wild-type construct will here be referred to as pPBSPro244{Psi}. A kissing-loop-deficient vector, pPBSPro{Delta}KL, was generated by two-step PCR-mediated site- directed mutagenesis performed on pPBSPro244{Psi}. Briefly, the 5' LTR, PBS–Pro and part of the 5' UTR were PCR- amplified from pPBSPro244{Psi}, generating a fragment harbouring the desired 16 bp deletion within the proposed kissing-loop dimerization sequence (Girard et al., 1995Down ). The amplified sequence was cloned by standard procedures into the appropriate position of pPBSPro244{Psi}. Similarly, to create a {Psi}- defective vector, pPBSPro{Psi}-, a 183 bp sequence harbouring all putative packaging and dimerization elements was removed by PCR-mediated site-specific mutagenesis. A 22 bp linker (5' GCGGCCGCTCGCGAGCTCTAGA 3') harbouring restriction sites for NotI, NruI, SacI and XbaI was introduced at the site of the deleted {Psi} element, whereas a 33 bp Akv segment downstream from the PBS was maintained in the resulting vector to allow proper initiation of reverse transcription. To make a packagable vector which shared only limited {Psi} sequence identity with Akv, a putative packaging and dimerization element from mouse VL30 was PCR-amplified from RNA derived from virus particles produced by {Psi}-2 packaging cells (Hatzoglou et al. , 1990Down ) and cloned into NotI/XbaI- digested pPBSPro{Psi}-. Primers for amplification of VL30 {Psi} were designed on the basis of the sequence given by Adams et al. (1988)Down . The amplified 436 bp fragment (GenBank accession no. AF166260) shared 94% sequence identity with the corresponding region of a previously published VL30 sequence (Adams et al., 1988Down ). The resulting vector was designated pPBSPro436VL30{Psi}. To detect a potential effect of the restriction sites flanking a {Psi} insert in pPBSPro{Psi}- , a PCR-amplified 201 bp Akv {Psi} fragment was cloned into NotI/XbaI-digested pPBSPro{Psi}-, giving rise to pPBSPro{Psi}link. The modified PBS–Umu sequence, designed to be an unlikely match for the 3'-end of any known tRNA, was previously introduced into the wild-type vector by a two-step PCR procedure to generate pPBSUmu244{Psi} (Mikkelsen et al., 1996Down ). PBS–Pro in pPBSPro{Delta}KL and pPBSPro436VL30{Psi} was similarly replaced by the PBS–Umu modification to generate pPBSUmu{Delta}KL and pPBSUmu436VL30{Psi}.

{blacksquare} Cells, transfections and virus infections.
{Psi}-2 packaging cells (Mann et al., 1983Down ) and NIH 3T3 target cells were grown in Dulbecco's modified Eagle medium with Glutamax-1 supplemented with 10% newborn calf serum, 100 U/ml penicillin and 100 µg/ml streptomycin. Cells were incubated at 37 °C in 90% relative humidity and 5·7% CO 2. Transfections of {Psi}-2 cells and selection for stably integrated vectors have been described previously (Mikkelsen et al. , 1996Down ). Briefly, 10 µg vector plasmid DNA was transfected into {Psi}-2 cells seeded at 5x103 cells/cm 2 on the day before transfection. Two days after transfection, G418-containing medium was added to select for stably integrated vectors. G418-resistant colonies appearing after 12 days of selection were pooled. To measure transductional efficiencies, viruses were harvested from medium left on confluent cultures of stably integrated producer cells for 24 h. Virus-containing medium was centrifuged, filtered, serially diluted and transferred to recipient cells (NIH 3T3 cells seeded at 5x103 cells/cm2 1 day prior to infection) in the presence of Polybrene (6 µg/ml). Selective medium was added 2 days after infection and resistant colonies were counted, individually isolated and expanded after 10 days of G418-selection.

{blacksquare} Proviral DNA sequence analysis.
Genomic DNA from G418-resistant clones was prepared as previously described (Lund et al., 1993Down ). Sequence analysis of individual transduced vector sequences was performed on a PCR product encompassing part of the 5' LTR, the PBS, the 5' UTR and the upstream part of the neo gene. PCR was performed with the following oligonucleotides: ON1 (5' TTCATAAGGCTTAGCCAGCTAACTGCAG 3'), matching Akv MLV positions 7838–7865 (Van Beveren et al., 1985Down ), and ON2 (5' GGCGCCCCTGCGCTGACAGCCGGAACAC 3'), matching neo positions 1656–1683 (Beck et al., 1982Down ). The resulting PCR product was sequenced by use of an upstream primer (ON3, 5' TCCGAATCGTGGTCTCGCTGATCCTTGG 3') matching Akv MLV positions 69–96 (Van Beveren et al., 1985Down ), and for relevant clones using a downstream primer (ON4, 5' CTTCCTTTAGCAGCCCTTGCGC 3') matching neo positions 1223–1244 (Auerswald et al., 1981Down ). The 3' LTR of transduced proviruses harbouring the originally mutated PBS–Umu was PCR-amplified with a primer (ON5, 5' GGGACCTTGCACAGATAGCGTG 3') matching neo positions 3008–3029 and a primer (ON6, 5' AATGAAAGACCCCCGAGG 3') specifically recognizing MLEV/VL30 molecular markers within U5 (a region corresponding to positions 127–144 in Akv–MLV; Van Beveren et al., 1985Down ). Amplified fragments were sequenced with ON6.

{blacksquare} Generation and PCR-based screening of colony pools.
In some experiments, colonies of recipient cells appearing after infection and subsequent G418-selection were pooled to allow for a PCR- based screening for recombinant proviruses among a large number of transduced proviral sequences. Genomic DNA was prepared from individually expanded colony pools each obtained by pooling of all G418- resistant colonies (on average 25 colonies for PBSUmu244{Psi} and nine colonies for PBSUmu{Delta}KL) obtained on a single plate. In PCR amplifications specific for Akv–MLEV and Akv–VL30 recombinants, the neo-specific ON2 was used together with ON7 (5' GTCTTTCATTTGGAGGTCCCA 3'), matching MLEV-derived PBS–Gln (Mikkelsen et al., 1996Down ), and ON8 (5' TGGTGCATTGGCCGGG 3'), matching mouse VL30-derived PBS–Gly (Adams et al., 1988Down ). ON9 (5' GCCCGGGTACCCGTATTC 3') and ON10 (5' GCCCGGGTACCCGTATTC 3'), specifically recognizing PBS–Umu and an MLEV marker within R (Mikkelsen et al., 1998aDown ), respectively, were used to screen for Akv–MLEV recombinants that harboured PBS–Umu. ON11 (5' TCAGACACTCAAGTCCCGGGAC 3'), matching VL30 U5 positions 449–470 (Adams et al., 1988Down ), was used together with ON5 to specifically amplify 3' LTRs harbouring VL30- derived sequences.


   Results
TOP
Abstract
Introduction
Methods
Results
Discussion
References
 
{Psi}-modified vectors
Four different {Psi}-modified vector constructs harbouring the wild- type PBS–Pro were generated (Fig. 1Down), all derived from an Akv–MLV- based vector containing the neomycin resistance gene. This vector, designated pPBSPro244{Psi}, harbours {Psi} and R regions both similar to the corresponding regions of MLEV and distinct from the analogous cis-acting regions in endogenous VL30. A {Psi}-deficient vector, pPBSPro{Psi}-, was generated by replacing a 183 bp 5' UTR sequence harbouring all essential packaging and dimerization elements with a 22 bp cloning linker sequence. In this vector, a 33 bp Akv segment downstream from the PBS was maintained to allow proper initiation of reverse transcription. To make a packagable vector which shared {Psi}-similarity with endogenous VL30 and only limited similarity with the corresponding region in the MLEV recombination partner, a putative packaging and dimerization element from mouse VL30 was PCR-amplified from RNA in virus particles produced by {Psi}-2 packaging cells (Hatzoglou et al., 1990Down ) and cloned into the linker of pPBSPro{Psi}-. The resulting vector, pPBSPro436VL30{Psi}, harboured within the introduced 436 bp VL30 fragment sequences compatible with a triple GACG stem–loop structure which is likely required for proper RNA encapsidation in analogy with the conserved double GACG stem–loop structure found in spleen necrosis virus (Yang & Temin, 1994Down ) and MLV (Mougel et al., 1996Down ). As a control, a PCR- amplified 201 bp Akv 5' UTR fragment was recloned into the {Psi}-deficient vector to generate pPBSPro276{Psi}link (Fig. 1 Down). Finally, a kissing-loop-deficient Akv {Psi}-based vector, pPBSPro{Delta}KL, was generated to test the effect of removing the primary recombinogenic site of the MLV 5' UTR. In this vector, a 16 bp deletion encompassing the 6 bp loop sequence and the residues forming the upper stem (5 bp on each side of the loop sequence) was introduced.



View larger version (17K):
[in this window]
[in a new window]
 
Fig. 1. Design and replication efficiencies of {Psi}- modified vector constructs. All vectors were generated from pPBSPro244{Psi} (vector referred to as tvPBSPro in Mikkelsen et al. , 1998bDown ) as described in Methods. Dark grey box in pPBSPro{Psi}- represents a 22 bp linker sequence introduced at the site of the 183 bp {Psi} deletion. Light grey box downstream from linker sequences indicates an Akv {Psi} sequence which is also included in the PCR-amplified 201 bp Akv {Psi} fragment recloned into pPBSPro{Psi}- to generate pPBSPro276{Psi}link. As a result, this vector harbours two 18 bp repeats flanking the XbaI site. Nucleotide position numbers indicated below constructs refer to distance from the Akv transcription start site. Transduction efficiencies given as colony-forming units per ml of virus-containing medium transferred from stably transfected {Psi}- 2 packaging cells to NIH 3T3 target cells (CFU/ml) were determined as previously described (Mikkelsen et al., 1998bDown ). Titres obtained for pPBSPro244{Psi}, pPBSPro{Psi}- , pPBSPro276{Psi}link, pPBSPro436VL30{Psi} and pPBSPro{Delta}KL were based on 9, 5, 4, 3 and 2 experiments, respectively.

 
Transduction of the {Psi}-deficient vector, PBSPro{Psi}- , was strongly diminished as compared to the wild-type vector (Fig. 1Up). Functionality of the vector was partly restored by reinsertion of the original MLV {Psi} into the linker of pPBSPro{Psi} -. PBSPro276{Psi}link thus replicated one order of magnitude less efficiently than the wild-type vector, most likely due to the presence of the linker in a critical position of the leader region or, alternatively, due to complications in RNA folding caused by the 18 bp direct repeat flanking the XbaI site (Fig. 1 Up). A transduction titre 200-fold lower than the wild-type vector was obtained for the vector harbouring the inserted VL30 {Psi} sequence. This titre, comparable with the titre of PBSPro276{Psi}link, demonstrated the functionality of the VL30-derived 5' UTR insertion. The transduction efficiency of the kissing-loop-deficient vector was reduced approximately 60-fold relative to the wild-type vector, in agreement with the notion that the MLV kissing-loop sequence is involved in but not essential for virus replication (Mougel et al., 1996Down ; Fisher & Goff, 1998Down ).

Recombinational rescue of PBS- and {Psi}-modified vectors detected by single-colony analysis
To examine the effect of altering {Psi} on forced recombination with endogenous viral RNA derived from MLEV and VL30 retroelements, the PBS–Pro sequences of wild-type, VL30{Psi}-harbouring and kissing- loop-deficient vectors were modified to PBS–Umu, designed to be an unlikely match for any known tRNA molecule (Mikkelsen et al., 1996Down ). PBS–Umu vectors were stably transfected into {Psi}-2 cells and viruses transferred to NIH 3T3 cells. We have previously found that the replication efficiency of PBS-modified vectors is reduced five orders of magnitude as compared to the wild- type (Mikkelsen et al., 1996Down ). It was therefore found less relevant to study transduction of a {Psi}-deficient vector harbouring severe modifications also within the PBS.

As expected, the transduction efficiency was strongly reduced for all PBS/{Psi}-modified vectors (Fig. 2Down). We previously found that the mutated and defective PBS in vectors similar to PBSUmu244{Psi} in 32 out of 60 analysed transduction events was repaired during transduction to perfectly match the 3'-end of a glutamine tRNA primer (Mikkelsen et al., 1996Down ). Sequence analysis of the PBS–Gln-harbouring proviruses demonstrated that PBS-modified vectors were transduced through initial priming of cDNA synthesis on a copackaged PBS–Gln-containing MLEV transcript. Following interstrand minus-strand strong-stop transfer and continued minus- strand DNA synthesis through the selective marker gene, template switching was selectively observed during minus-strand synthesis within the 5' UTR to obtain the perfect PBS–Gln complementarity facilitating second-strand transfer (Fig. 3aDown).



View larger version (19K):
[in this window]
[in a new window]
 
Fig. 2. Transduction of PBS- and {Psi}-modified MLV vectors. Wild-type PBS–Pro sequences were in Akv{Psi}-, VL30{Psi}- and Akv{Psi}{Delta}KL-based vectors exchanged with the nonfunctional PBS–Umu by site-specific mutagenesis. Ratios of transduced PBS sequences are given as numbers of transduced proviral sequences, PBS–Gln (from MLEV) (Mikkelsen et al., 1996Down ), PBS–Gly (from endogenous VL30) or PBS–Umu (from vector) relative to the total number of single colonies analysed. The transduction pathway was determined by sequencing of relevant proviral segments (see text for details). The recombination partners are given in parentheses below types of recombination. `Unknown' refers to hitherto unidentified rescue pathways.

 


View larger version (25K):
[in this window]
[in a new window]
 
Fig. 3. Models for recombination-based rescue of PBS-mutated vectors. Co-encapsidation of vector and ERV-derived RNA may lead to exchange of viral genetic information during reverse transcription (RT- recombination) within the target cell, resulting in generation of a recombinant provirus harbouring sequences derived from both parental RNAs. In all models shown, minus-strand DNA synthesis is initiated from a functional ERV-derived PBS sequence. (a) 5' UTR minus- strand recombination between Akv vector PBSUmu244{Psi} (or PBSUmu{Delta}KL) and MLEV (Mikkelsen et al., 1996Down ); second-strand transfer facilitated by complementary PBS–Gln sequences. (b) 5' UTR minus-strand recombination between PBSUmu436VL30{Psi} and endogenous VL30; second-strand transfer mediated by complementary PBS–Gly sequences. (c) and (d) Recombination between Akv vectors PBSUmu244{Psi} (or PBSUmu{Delta}KL) and PBSUmu436VL30{Psi} and MLEV facilitated by read-through of PBS–Umu and second-strand transfer mediated by complementary R–U5 sequences (Mikkelsen et al., 1998aDown ). Genetic compositions of recombinant proviruses are indicated at the bottom of each panel. Thin and thick lines indicate RNA and DNA, respectively. DNA derived from vector and endogenous virus sequences is indicated by black and grey lines, respectively. PBS–Umu, PBS–Gln and PBS–Gly are represented by dark grey, white and light grey boxes, respectively. Large open box represents the neo gene. The VL30 packaging/dimerization element (VL30 {Psi}) is indicated by a light grey box inserted into vector 5' UTR.

 
In this study, 19, 8 and 11 individually transduced proviruses originating from transfer of PBSUmu244{Psi}, PBSUmu{Delta}KL and PBSUmu436VL30{Psi}, respectively were analysed (Fig. 2Up). The upstream LTR, PBS and 5' UTR of these proviral sequences were PCR-amplified by use of primers matching Akv U3 and neo sequences and resulting products were sequenced with nested primers. A total of five transduced proviruses were found to harbour a PBS derived from an endogenous virus through a mechanism involving 5' UTR minus-strand recombination (Fig. 2Up, transduction pathways a1, b1 and c1). For PBSUmu244{Psi} and PBSUmu{Delta}KL, MLEV served as the PBS donor in patch repair of the PBS mutation (Fig. 3aUp), whereas endogenous VL30 was identified as the recombination partner and donor of PBS–Gly in transduction of Umu436VL30{Psi} (Fig. 3bUp).

According to the generally accepted model for reverse transcription (Gilboa et al., 1979Down ), R and U5 regions copied during minus-strand strong-stop DNA synthesis are transferred to the 3'-end of the genome and eventually duplicated to constitute R and U5 of both proviral LTRs. In agreement with this scheme, the composition of R and U5 in the transduced proviral 3' LTR directly demonstrates the identity of the viral RNA used as template for initiation of reverse transcription. The remaining proviruses which harboured the original mutated PBS–Umu and, thus, were negative for template switching in the 5' UTR, were analysed by PCR to delineate the origin of sequences in the 3' LTR. Amplifications were performed with primers matching neo and specific MLEV/VL30 U5 genetic marker positions, and the resulting amplified 3' LTR fragments were subsequently sequenced. For PBSUmu244{Psi}, PBSUmu{Delta}KL and PBSUmu436VL30{Psi} 1 of 16 (a2), 3 of 7 ( b2) and 2 of 10 (c2) analysed proviruses, respectively, were found to harbour sequences of MLEV origin in the 3' LTR (Fig. 2Up). These recombinant PBS–Umu- containing proviruses were generated by initiation of minus-strand DNA synthesis on MLEV, interstrand minus-strand transfer, continued minus- strand synthesis through the marker gene and read-through of the mutated PBS (Fig. 3cUp, dUp). We have previously shown that second-strand transfer in this scenario is mediated by complementary R–U5 sequences (Mikkelsen et al., 199aDown ).

For each vector construct, several transduced proviruses were found not to harbour sequences of MLEV or VL30 origin (Fig. 2Up, a3Up, b3Up and c3Up), indicating that these proviruses were transduced through as yet unknown pathways that may not necessarily involve specific genetic interactions with heterologous ERVs. The frequency by which recombination-dependent and -independent transduction pathways appear is strongly influenced by the expression levels of vector and ERV RNAs in the packaging cells and may therefore vary in independent experiments. In none of the cases analysed had {Psi}-modified vector constructs recombined with a copackaged {Psi}- deficient packaging construct RNA as we have previously seen for vectors harbouring the entire 476 bp Akv 5' UTR (Mikkelsen et al., 1998bDown ).

Rare recombination events detected by PCR screening of colony pools
Since the VL30 {Psi}-based PBS–Umu vector may be rescued through 5' UTR minus-strand recombination with endogenous VL30 (Fig. 3bUp), we next set out to elucidate whether Akv {Psi}-based vectors (PBSUmu244{Psi} and PBSUmu{Delta}KL) in rare cases can be rescued through genetic interactions with copackaged endogenous VL30 RNA. To this end, we performed multiple transduction series of Akv-derived vectors harbouring PBS–Umu and subsequently pooled all G418-resistant NIH 3T3 colonies appearing on individual plates. For PBSUmu244{Psi}, 31 colony pools were obtained, each generated from a single plate containing on average 25 G418-resistant colonies per plate. For PBSUmu{Delta}KL, on average nine G418-resistant colonies appeared on 27 plates (Table 1Down). Genomic DNA was prepared from each colony pool and a PCR-based screening of G418-resistant colony pools was employed to detect recombination with endogenous viruses MLEV and VL30, respectively (Table 1Down).


View this table:
[in this window]
[in a new window]
 
Table 1. Recombinant proviral fragments obtained by PCR- based screening of colony pools

 
In initial control experiments, colony pools were screened by PCR with MLEV- and vector-specific primers to detect rescue of PBS-impaired vectors by genetic interactions with MLEV. With primers matching PBS–Gln and sequences within neo, template switching within the 5' UTR (Fig. 3aUp) was registered in 15 out of 31 pools (representing almost 800 transduction events; 31x25 colonies, Table 1Up) for PBSUmu244{Psi} and in eight out of 27 pools (approximately 250 transduction events; 27x9 colonies, Table 1Up) for PBSUmu{Delta}KL. Proviruses that originate through PBS read-through and subsequent R–U5-mediated second-strand transfer (Fig. 3cUp) are most often characterized by harbouring the original mutated PBS flanked upstream by ERV-derived R and U5 sequences (Mikkelsen et al., 1998aDown ). By use of primers specifically matching PBS–Umu and genetic MLEV markers within the R region, several examples of such recombinant proviruses could as expected be found among the transduced proviral sequences (Table 1Up).

To test for exchange of the impaired PBS of Akv {Psi}-based vectors with PBS–Gly as a result of recombination with endogenous VL30 RNA, all colony pools were PCR-screened with primer sets matching (i) VL30 PBS–Gly and neo and (ii) neo and VL30 3' U5, respectively. In one case (one out of a total of more than 1000 transduction events, 31x25+27x9 colonies; Table 1 Up), we found evidence for 5' UTR minus-strand recombination between the kissing-loop-deficient vector and copackaged endogenous VL30 (Table 1Up). Sequence analysis of the obtained 450 bp PCR-amplified fragment revealed that template switching in this case had occurred from a donor position within the Tn5 fragment 141 nucleotides upstream from the neo start codon to an acceptor site within VL30 153 nucleotides downstream from the glycine PBS (Fig. 4Down, left panel). Transfer of the nascent minus strand coincided with a 2 nt sequence identity between donor and acceptor templates. We conclude from this observation that recombination within the 5' UTR may be detected, although a combined effect of heterologous packaging and dimerization signals, distinct Akv and VL30 R regions, and lack of profound sequence identity within the 5' UTR make this type of VL30-based recombinational repair less frequent.



View larger version (23K):
[in this window]
[in a new window]
 
Fig. 4. Nonhomologous minus-strand recombination. Schematic representation of template switching events and position of cross-over sites identified by PCR-screening of colony pools (Table 1Up ). Minus-strand DNA synthesis is initiated on copackaged endogenous VL30 RNA. Following homologous transfer of minus-strand strong-stop DNA, nonhomologous template switching is forced prior to copying of neo. Details of the strand transfer reaction are given in the right panel (3' UTR minus-strand recombination). PBS–Gly complementarity in the second-strand transfer of reverse transcription is obtained by nonhomologous strand transfer within the 5' UTR after copying of the neo gene. Cross-over occurs from a donor template site within the bacterial Tn5 promoter upstream of neo to an acceptor site within the VL30 {Psi} region (details given in the left panel; 5' UTR minus-strand recombination). VL30 sequences given in left and right panels were obtained by RT–PCR on virion RNA followed by sequence analysis and were from Adams et al. (1988)Down , respectively. Relevant sequences of donor and acceptor templates and the recombinant proviral sequences are given at the bottom of each panel. Hatched boxes indicate the 2 nt sequence identity regions at the cross-over sites. Thin lines, RNA; thick lines, DNA; dotted lines, template shift.

 
Sequences of VL30 origin within the 3' LTR were detected in one of 31 PBSUmu244{Psi} colony pools (Table 1Up) and in one of 27 PBSUmu{Delta}KL pools (Table 1Up and Fig. 4 Up), indicative of initiation of minus-strand DNA synthesis on VL30 and transfer of resulting strong-stop DNA to the 3'-end of either vector or VL30 RNA. Sequence analysis of the amplified provirus fragments showed that the VL30 3'-end in both cases served as acceptor template in transfer of VL30-derived minus-strand strong-stop DNA, possibly reflecting that transfer to the nonhomologous R region of Akv was disfavoured. Intrastrand transfer was thus followed by a template switch to allow minus-strand synthesis through the neo gene (Fig. 4Up, right panel). Also in this event of nonhomologous recombination, 2 nt sequence identity between donor and acceptor template mediated strand transfer (Fig. 4Up). Endogenous VL30-derived PBS–Gly and 3' LTR sequences were detected within the same pool of colonies. Considering the rarity of recombination with VL30, these sequences most likely originated from the same provirus generated by 5' UTR minus-strand recombination with VL30.


   Discussion
TOP
Abstract
Introduction
Methods
Results
Discussion
References
 
Within the framework of a defined recombination system, we seek in this report to determine whether template switching between retrovirus- derived sequences can be modulated by altering structural features of the primary packaging and dimerization element. We show that PBS- modified MLV vectors harbouring Akv- or VL30-derived {Psi} elements, some deficient of the kissing-loop dimerization domain, are rescued by initiation of reverse transcription on MLEV or VL30 genomic RNAs copackaged with vector RNA into {Psi}-2-derived virus particles and subsequent (i) template switching of growing minus-strand DNA within the 5' UTR or (ii) read-through of the PBS followed by R–U5- mediated second-strand transfer.

In single-cycle vector replication, deletion of the MLV kissing-loop leads to a 70- and 20-fold titre reduction for PBS–Pro and PBS–Umu vectors, respectively. Previous studies of RNA dimer formation have suggested that the kissing stem–loop in MLV and HIV-1 is crucial for dimerization in vitro (Clever et al. , 1996Down ; Girard et al., 1995Down ; Laughrea & Jetté, 1994Down ; Paillart et al., 1994Down ; Prats et al., 1990Down ; Skripkin et al., 1994Down ), but not essential for virus replication in vivo (Berkhout & van Wamel, 1996Down ; Clever & Parslow, 1997Down ; Haddrick et al. , 1996Down ; Paillart et al., 1996aDown ). It remains uncertain whether RNA dimerization is crucial for packaging and whether copackaged monomers subsequently may serve as functional substrates for reverse transcription and recombination. We show here that homologous recombination between Akv and MLEV can occur within the 5' UTR despite kissing-loop nonhomology, supporting the notion that the kissing-loop, albeit serving as a recombination hotspot sequence within the 5' UTR window (Mikkelsen et al., 1996Down , 1998bDown ), is not an essential cis-element for retrovirus recombination. Also, we demonstrate that virus genomes harbouring distinct {Psi} regions may interact through events of R–U5- mediated second-strand transfer, suggesting that a lack of identity within the putative packaging and dimerization elements of heterologous recombination partners (Akv–VL30 and VL30–MLEV, respectively), does not impede a recombination-based exchange of genetic information at alternative sites of the two copackaged genomes. Interestingly, St Louis et al. (1998)Down recently reported that nonhomology within kissing-loop sequences of different HIV-1 subtypes does not constitute a major obstacle to recombination following postulated RNA heterodimer formation, and thus that a direct loop–loop interaction is not a prerequisite for template switching at alternative sites of the genome. If dimer formation is indeed required for RNA packaging, these and our findings may infer that intermolecular RNA interactions elsewhere in the genome outside the leader region can assist or partly assume a heterodimerization function, facilitating in the present report Akv vector recombination with MLEV or VL30. Previous work with HIV-1- and MLV-based systems seems to support this notion (Berkhout & van Wamel, 1996Down ; Tchénio & Heidmann, 1995Down ).

One single event of 5' UTR minus-strand recombination with endogenous VL30 was detected by PCR screening of more than 1000 transduced Akv 244{Psi} and {Delta}KL proviruses. This provirus was generated by synthesis of minus-strand strong stop on VL30, intrastrand transfer, nonhomologous switching of the nascent minus-strand to the vector, subsequent copying of neo, and nonhomologous template switching within the 5' UTR to obtain perfect PBS complementarity in second-strand transfer (Fig. 4Up). The recombinant provirus was characterized by sequence analysis of PCR amplicons generated from the same colony pool in two distinct PCR reactions used in screening of multiple transduced sequences (Table 1Up) and we can therefore rule out that the detected event was a result of recombination during PCR amplification. This finding thus indicates that a modification of the PBS can be overcome by a transductional repair pathway involving (i) copackaging of two heterologous RNA templates, (ii) homologous intramolecular minus-strand strong-stop transfer, and (iii) nonhomologous template switching events downstream from neo and subsequently within the 5' UTR.

Torrent et al. (1994)Down previously reported that a small packaging signal derived from rat VL30 facilitates efficient encapsidation of recombinant RNA into MLV particles. Insertion of non- murine heterologous packaging and dimerization sequences into retrovirus vectors may improve safety by rendering the vectors less recombinogenic. Nonhomologous minus-strand DNA transfer has previously been found to mediate recombination between distinct viruses harbouring similar packaging signals and divergent R regions (Yin et al., 1997Down ). In addition, vector RNAs harbouring encapsidation elements of distinct retrovirus origins have been found to interact genetically during minus-strand synthesis, suggesting that homology within the presumed primary dimerization region is dispensable for the generation of recombinant proviruses (Yin & Hu, 1997Down ). Expanding on these crucial observations, we show here that copackaging of {Psi}- and R-distinct retrovirus-derived sequences followed by two events of nonhomologous template switching can lead to the generation of PBS-repaired Akv–VL30 chimaeric proviruses. This example of complex genetic interactions during reverse transcription illustrates how recombination between unrelated retrovirus species harbouring distinct PBS, {Psi} elements and R regions may have contributed to retrovirus evolution. In consideration of the lack of sequence similarity between Akv and VL30, any two copackaged retrovirus-derived sequences will probably be able to interact genetically and, at present, there remains an open question of whether a specific dimerization process is required for this interaction. Based on these observations, it seems unlikely that specific alterations introduced into a retrovirus vector are capable of rendering the vector nonrecombinogenic without disturbing crucial cis-acting functions required for efficient vector transduction.

The possibility exists that development and outgrowth of novel replication-competent retroviruses occur through recombination between viruses that replicate or are present endogenously in different animal species. Creation of such chimaeric viruses requires co-encapsidation of heterologous viral RNAs and subsequent recombination during reverse transcription. We believe that forced recombinational rescue of PBS- impaired retrovirus vectors constitutes a powerful tool to investigate whether retroviruses of different species interact genetically and hold the potential to form novel biologically active retroviruses. Forced recombination assays may thus be utilized to study rare genetic interactions between heterologous RNAs as well as to detect unknown ERV sequences (e.g. in human cells) that harbour functional cis- elements, some of which may constitute important sequence patches in repair of retrovirus vectors.


   Acknowledgments
 
We thank Jane Jensen for technical assistance. This work was supported by the Danish Biotechnology Programme, the Danish Cancer Society, the Danish Natural Sciences and Medical Research Councils, the Karen Elise Jensen Foundation, and contracts Biotech CT95-0100 and Biomed2 CT95-0675 of the European Commission.


   Footnotes
 
The GenBank accession number of the VL30 {Psi} fragment reported in this paper is AF166260.


   References
TOP
Abstract
Introduction
Methods
Results
Discussion
References
 
Adams, S. E. , Ratthjen, D. D. , Stanway, C. A. , Fulton, C. A. , Malin, M. H. , Wilson, W. , Odgen, T. , King, L. , Kingsman, S. & Kingsman, A. J. (1988). Complete nucleotide sequence of mouse VL30 retroelement. Molecular and Cellular Biology 8, 2989-2998.[Abstract/Free Full Text]

Anderson, J. A. , Teufel, R. J.II , Yin, P. D. & Hu, W.-S. (1998). Correlated template-switching events during minus-strand DNA synthesis: a mechanism for high interference during retroviral recombination. Journal of Virology 72, 1186-1194 .[Abstract/Free Full Text]

Auerswald, E. A. , Ludwig, G. & Schaller, H. (1981). Structural analysis of Tn5. Cold Spring Harbor Symposia on Quantitative Biology 45, 107-113.

Beck, E. , Ludwig, G. , Auerswald, E. A. , Reiss, B. & Schaller, H. (1982). Nucleotide sequence and exact localization of the neomycin phosphotransferase gene from transposon Tn5. Gene 19, 327-336.[Medline]

Berkhout, B. & van Wamel, J. L. B. (1996). Role of the DIS hairpin in replication of human immunodeficiency virus type 1. Journal of Virology 70, 6723-6732 .[Abstract/Free Full Text]

Chakraborty, A. K. , Zink, M. A. & Hodgson, C. P. (1994). Transmission of endogenous VL30 retrotransposons by helper cells used in gene therapy. Cancer Gene Therapy 1, 113-118.[Medline]

Chong, H. & Vile, R. G. (1996). Replication-competent retrovirus produced by a `split-function' third generation amphotropic packaging cell line. Gene Therapy 3, 624-629.[Medline]

Chong, H. , Starkey, W. & Vile, R. G. (1998). A replication-competent retrovirus arising from a split-function packaging cell line was generated by recombination events between the vector, one of the packaging constructs, and endogenous retroviral sequences. Journal of Virology 72, 2663-2670 .[Abstract/Free Full Text]

Clever, J. L. & Parslow, T. G. (1997). Mutant human immunodeficiency virus type 1 genomes with defects in RNA dimerization and encapsidation. Journal of Virology 71, 3407-3414 .[Abstract]

Clever, J. L. , Wong, M. L. & Parslow, T. G. (1996). Requirements for kissing-loop-mediated dimerization of human immunodeficiency virus RNA. Journal of Virology 70, 5902-5908 .[Abstract]

Coffin, J. M. (1979). Structure, replication, and recombination of retrovirus genomes: some unifying hypotheses. Journal of General Virology 42, 1-26.[Abstract/Free Full Text]

Colicelli, J. & Goff, S. P. (1987a). Identification of endogenous retroviral sequences as potential donors for recombinational repair of mutant retroviruses: positions of crossover points. Virology 160, 518 -522.[Medline]

Colicelli, J. & Goff, S. P. (1987b). Isolation of a recombinant murine leukemia virus utilizing a new primer tRNA. Journal of Virology 57, 37-45.

Fisher, J. & Goff, S. P. (1998). Mutational analysis of stem–loops in the RNA packaging signal of the Moloney murine leukemia virus. Virology 244, 133-145.[Medline]

Fossé, P. , Motté, N. , Roumier, A. , Gabus, C. , Muriaux, D. , Darlix, J.-L. & Paoletti, J. (1996). A short autocomplementary sequence plays an essential role in avian sarcoma-leukosis virus RNA dimerization. Biochemistry 35, 16601-16609 .[Medline]

Gilboa, E. , Mitra, S. W. , Goff, S. & Baltimore, D. (1979). A detailed model for reverse transcription and tests of crucial aspects. Cell 18, 93-100.[Medline]

Girard, P.-M. , Bonnet-Mathonière, B. , Muriaux, D. & Paoletti, J. (1995). A short autocomplementary sequence in the 5' leader region is responsible for dimerization of MoMuLV genomic RNA. Biochemistry 34, 9785-9794 .[Medline]

Haddrick, M. , Lear, A. L. , Cann, A. J. & Heaphy, S. (1996). Evidence that a kissing loop structure facilitates genomic RNA dimerisation in HIV-1. Journal of Molecular Biology 259, 58-68.[Medline]

Hatzoglou, M. , Hodgson, C. P. , Mularo, F. & Hanson, R. W. (1990). Efficient packaging of a specific VL30 retroelement by {Psi}2 cells which produce MoMLV recombinant retroviruses. Human Gene Therapy 1, 385-397.[Medline]

Hodgson, C. P. , Fisk, R. Z. , Arora, P. & Chotani, M. (1990). Nucleotide sequence of mouse virus- like (VL30) retrotransposon BVL-1. Nucleic Acids Research 18, 673.[Free Full Text]

Hu, W.-S. & Temin, H. M. (1990a). Genetic consequences of packaging two RNA genomes in one retroviral particle: pseudoploidy and high rate of genetic recombination. Proceedings of the National Academy of Sciences, USA 87, 1556 -1560.[Abstract/Free Full Text]

Hu, W.-S. & Temin, H. M. (1990b). Retroviral recombination and reverse transcription. Science 250, 1227 -1233.[Abstract/Free Full Text]

Hu, W.-S. & Temin, H. M. (1992). Effect of gamma radiation on retroviral recombination. Journal of Virology 66, 4457-4463 .[Abstract/Free Full Text]

Hu, W.-S. , Bowman, E. H. , Delviks, K. A. & Pathak, V. K. (1997). Homologous recombination occurs in a distinct retroviral subpopulation and exhibits high negative interference. Journal of Virology 71, 6028-6036 .[Abstract]

Junghans, R. P. , Boone, L. R. & Skalka, A. M. (1982). Retroviral DNA H structures: displacement–assimilation model for recombination. Cell 30, 53-62.[Medline]

Laughrea, M. & Jetté, L. (1994). A 19- nucleotide sequence upstream of the 5' major splice donor is part of the dimerization domain of human immunodeficiency virus 1 genomic RNA. Biochemistry 33, 13464-13474 .[Medline]

Laughrea, M. , Jetté, L. , Mak, J. , Kleiman, L. , Liang, C. & Wainberg, M. A. (1997). Mutations in the kissing-loop hairpin of human immunodeficiency virus type 1 reduce viral infectivity as well as genomic RNA packaging and dimerization. Journal of Virology 71, 3397-3406 .[Abstract]

Lear, A. L. , Haddrick, M. & Heaphy, S. (1995). A study of the dimerization of Rous sarcoma virus RNA in vitro and in vivo. Virology 212, 47-57.[Medline]

Lund, A. H. , Duch, M. , Lovmand, J. , Jørgensen, P. & Pedersen, F. S. (1993). Mutated primer binding sites interacting with different tRNAs allow efficient murine leukemia virus replication. Journal of Virology 67, 7125-7130 .[Abstract/Free Full Text]

Mann, R. , Mulligan, R. C. & Baltimore, D. (1983). Construction of a retrovirus packaging mutant and its use to produce helper-free defective retrovirus. Cell 33, 153-159.[Medline]

Martinelli, S. C. & Goff, S. P. (1990). Rapid reversion of a deletion mutation in Moloney murine leukemia virus by recombination with a closely related endogenous provirus. Virology 174, 135-144.[Medline]

Mikkelsen, J. G. , Lund, A. H. , Kristensen, K. D. , Duch, M. , Sørensen, M. S. , Jørgensen, P. & Pedersen, F. S. (1996). A preferred region for recombinational patch repair in the 5' untranslated region of primer binding site-impaired murine leukemia virus vectors. Journal of Virology 70, 1439-1447 .[Abstract]

Mikkelsen, J. G. , Lund, A. H. , Dybkær, K. , Duch, M. & Pedersen, F. S. (1998a). Extended minus strand DNA as template for R–U5-mediated second strand transfer in recombinational rescue of PBS-modified retroviral vectors. Journal of Virology 72, 2519 -2525.[Abstract/Free Full Text]

Mikkelsen, J. G. , Lund, A. H. , Duch, M. & Pedersen, F. S. (1998b). Recombination in the 5' leader of murine leukemia virus is accurate and influenced by sequence identity with a strong bias toward the kissing-loop dimerization region. Journal of Virology 72, 6967 -6978.[Abstract/Free Full Text]

Mougel, M. , Zhang, Y. & Barklis, E. (1996). Cis-active structural motifs involved in specific encapsidation of Moloney murine leukemia virus RNA. Journal of Virology 70, 5043-5050 .[Abstract/Free Full Text]

Murphy, J. E. & Goff, S. P. (1994). Forced integration of Moloney murine leukemia virus DNA with a mutant integration site occurs through recombination with VL30 DNA. Virology 204, 458-461.[Medline]

Paillart, J.-C. , Marquet, R. , Skripkin, E. , Ehresmann, B. & Ehresmann, C. (1994). Mutational analysis of the bipartite dimer linkage structure of human immunodeficiency virus type 1 genomic RNA. Journal of Biological Chemistry 269, 27486-27493 .[Abstract/Free Full Text]

Paillart, J.-C. , Berthoux, L. , Ottman, M. , Darlix, J.-L. , Marquet, R. , Ehresmann, B. & Ehresmann, C. (1996a). A dual role of the putative dimerization initiation site of human immunodeficiency virus type 1 in genomic RNA packaging and proviral DNA synthesis. Journal of Virology 70, 8348 -8354.[Abstract]

Paillart, J.-C. , Skripkin, E. , Ehresmann, B. , Ehresmann, C. & Marquet, R. (1996b). A loop–loop `kissing' complex is the essential part of the dimer linkage of genomic HIV-1 RNA. Proceedings of the National Academy of Sciences, USA 93, 5572 -5577.[Abstract/Free Full Text]

Paillart, J.-C. , Westhof, E. , Ehresmann, C. , Ehresmann, B. & Marquet, R. (1997). Non-canonical interactions in a kissing-loop complex: the dimerization initiation site of HIV-1 genomic RNA. Journal of Molecular Biology 270, 36-49.[Medline]

Patience, C. , Takeuchi, Y. , Cosset, F.-L. & Weiss, R. A. (1998). Packaging of endogenous retroviral sequences in retroviral vectors produced by murine and human packaging cells. Journal of Virology 72, 2671-2676 .[Abstract/Free Full Text]

Prats, A.-C. , Roy, C. , Wang, P. , Erard, M. , Housset, V. , Gabus, C. , Paoletti, C. & Darlix, J.-L. (1990). cis elements and trans -acting factors involved in dimer formation of murine leukemia virus RNA. Journal of Virology 64, 774-783.[Abstract/Free Full Text]

Purcell, D. F. , Broscius, C. M. , Vanin, E. F. , Buckler, C. E. , Nienhuis, A. W. & Martin, M. A. (1996). An array of murine leukemia virus-related elements is transmitted and expressed in a primate recipient of retroviral gene transfer. Journal of Virology 70, 887-897.[Abstract]

St Louis, D. C. , Gotte, D. , Sanders-Buell, E. , Ritchey, D. W. , Salminen, M. O. , Carr, J. K. & McCutchan, F. E. (1998). Infectious molecular clones with the nonhomologous dimer initiation sequences found in different subtypes of human immunodeficiency virus type 1 can recombine and initiate a spreading infection in vitro. Journal of Virology 72, 3991-3998 .[Abstract/Free Full Text]

Sakuragi, J.-I. & Panganiban, A. T. (1997). Human immunodeficiency virus type 1 RNA outside the primary encapsidation and dimer linkage region affects RNA dimer stability in vivo. Journal of Virology 71, 3250-3254 .[Abstract]

Scadden, D. T. , Fuller, B. & Cunningham, J. M. (1990). Human cells infected with retrovirus vectors acquire an endogenous murine provirus. Journal of Virology 64, 424-427.[Abstract/Free Full Text]

Schwartzberg, P. , Colicelli, J. & Goff, S. P. (1985). Recombination between a defective retrovirus and homologous sequences in host DNA: reversion by patch repair. Journal of Virology 53, 719-726.[Abstract/Free Full Text]

Scolnick, E. M. , Vass, W. C. , Howk, R. S. & Duesberg, P. H. (1979). Defective retrovirus- like 30S RNA species of rat and mouse cells are infectious if packaged by type C helper virus. Journal of Virology 29, 964-972.[Abstract/Free Full Text]

Skripkin, E. , Paillart, J.-C. , Marquet, R. , Ehresmann, B. & Ehresmann, C. (1994). Identification of the primary site of the human immunodeficiency virus type 1 RNA dimerization in vitro . Proceedings of the National Academy of Sciences, USA 91, 4945-4949 .[Abstract/Free Full Text]

Stuhlmann, H. & Berg, P. (1992). Homologous recombination of copackaged retrovirus RNAs during reverse transcription. Journal of Virology 66, 2378-2388 .[Abstract/Free Full Text]

Tchénio, T. & Heidmann, T. (1995). The dimerization/packaging sequence is dispensable for both the formation of high-molecular-weight RNA complexes within retroviral particles and the synthesis of proviruses of normal structure. Journal of Virology 69, 1079-1084 .[Abstract]

Torrent, C. , Gabus, C. & Darlix, J.-L. (1994). A small and efficient dimerization/packaging signal of rat VL30 RNA and its use in murine leukemia virus–VL30-derived vectors for gene transfer. Journal of Virology 68, 661-667.[Abstract/Free Full Text]

Van Beveren, C. , Coffin, J. & Hughes, S. (1985). Nucleotide sequences complemented with functional and structural analysis. In RNA Tumor Viruses, pp. 790-805. Edited by R. Weiss, N. Teich, H. Varmus & J. Coffin. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory Press.

Vanin, E. F. , Kaloss, M. , Broscius, C. & Nienhuis, A. W. (1994). Characterization of replication-competent retroviruses from nonhuman primates with virus- induced T-cell lymphomas and observations regarding the mechanism of oncogenesis. Journal of Virology 68, 4241-4250 .[Abstract/Free Full Text]

Yang, S. & Temin, H. M. (1994). A double hairpin structure is necessary for the efficient encapsidation of spleen necrosis virus retroviral RNA. EMBO Journal 13, 713-726.[Medline]

Yin, P. D. & Hu, W.-S. (1997). RNAs from genetically distinct retroviruses can copackage and exchange genetic information in vivo. Journal of Virology 71, 6237-6242 .[Abstract]

Yin, P. D. , Pathak, V. K. , Rowan, A. E. , Teufel, R. J.II & Hu, W.-S. (1997). Utilization of nonhomologous minus- strand DNA transfer to generate recombinant retroviruses. Journal of Virology 71, 2487-2494 .[Abstract]

Received 13 April 1999; accepted 26 July 1999.


This article has been cited by other articles:


Home page
J. Virol.Home page
J. G. Mikkelsen, A. H. Lund, M. Duch, and F. S. Pedersen
Mutations of the Kissing-Loop Dimerization Sequence Influence the Site Specificity of Murine Leukemia Virus Recombination In Vivo
J. Virol., January 1, 2000; 74(2): 600 - 610.
[Abstract] [Full Text]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted