J Gen Virol Faster Access
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via CrossRef
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Zhang, Z.
Right arrow Articles by Martineau, D.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Zhang, Z.
Right arrow Articles by Martineau, D.
Agricola
Right arrow Articles by Zhang, Z.
Right arrow Articles by Martineau, D.
Journal of General Virology (1999), 80, 3065-3072.
© 1999 Society for General Microbiology


Animal: RNA Viruses

Functional characterization of a piscine retroviral promoter

Z. Zhangb,1, E. Kim1 and D. Martineau1

Département de Pathologie et Microbiologie, Faculté de Médecine Vétérinaire, Université de Montréal, 3200 Sicotte, Saint-Hyacinthe, PQ J2S 7C5, Canada1

Author for correspondence: D. Martineau.Fax +1 450 778 8113. e-mail martinea{at}ere.umontreal.ca


   Abstract
TOP
Abstract
Introduction
Methods
Results
Discussion
References
 
Walleye dermal sarcoma virus (WDSV) is a retrovirus aetiologically associated with a multifocal skin tumour of walleye. Tumours synchronously develop on 27% of fish and regress seasonally; their severity is influenced by water temperature. To functionally characterize the LTR of WDSV, the LTR was fused to the luciferase reporter gene. WDSV LTR was found to be transcriptionally active in both fish and mammalian cells. WDSV LTR deletion mutants were constructed to identify specific regions that were functionally important in modulating viral gene expression and in temperature responsiveness. The 5' end 60 bp, which contain a putative ecdysone-response element also present in another fish retrovirus, positively modulated transcription from the WDSV LTR at 25 °C, but not at lower temperatures. A 13 bp region (nt -288 to -275) comprising a putative activator protein-1 element was necessary for maintaining WDSV LTR activity at all temperatures. In marked contrast to the short direct repeats found in mammalian retroviral LTRs, five 5 bp direct repeats (nt -336 and -272) were found to negatively regulate transcription from the WDSV LTR. A region spanning nt -440 to -218 stimulated the activity of a heterologous mammalian promoter in an orientation-dependent manner, modestly in fish cells (1·3- to 2-fold), but markedly (3·7- to 5·1-fold) in mammalian cells. Our results strongly suggest that the putative promoter elements present in the WDSV LTR function differentially in a temperature-specific manner and that complex interactions between these elements modulate WDSV LTR activity in response to temperature changes.


   Introduction
TOP
Abstract
Introduction
Methods
Results
Discussion
References
 
Walleye dermal sarcoma virus (WDSV) is an exogenous fish retrovirus aetiologically associated with a multifocal skin tumour, walleye dermal sarcoma (WDS). The disease can affect up to 27% of walleyes in North American lakes (Bowser et al., 1988Down ; Walker et al., 1969Down ; Yamamoto et al.,1976Down ; Yamamoto et al.,1985Down ). Although WDS often appears histologically malignant, the tumour is not invasive or metastatic in adult fish (Bowser et al., 1988Down ; Martineau et al.,1990Down ). Tumour prevalence varies seasonally since the neoplasm develops during the fall and synchronously regresses on most affected animals in the spring at spawning, as water temperature rises (Bowser et al.,1988Down ). This biological behaviour suggests that viral gene expression is modulated by water temperature and host hormones. Other observations also suggest that WDSV replication and viral gene expression are influenced by water temperature. Firstly, the severity of experimentally transmitted tumours is influenced by water temperature (Bowser et al., 1990Down ). Secondly, acellular homogenates prepared from tumours collected in the spring produce tumours when inoculated into fingerlings in contrast to homogenates from tumours collected in the fall that cannot produce tumours (Bowser et al., 1996Down ). Thirdly, tumour regression has been observed under experimental conditions in ponds whose temperature closely matched that of the natural environment (Bowser & Wooster, 1991Down ).

WDSV is a complex retrovirus which has three putative non-structural/accessory genes in the viral genome, designated orfA, orfB and orfC, in addition to the obligatory retroviral structural genes, gag, pol and env (Holzschu et al.,1995Down ). Like all complex retroviruses identified to date, WDSV contains two non-overlapping short open reading frames downstream of the env gene, one of which, orfA, is similar to cyclins at the amino acid sequence level. Most strikingly, an open reading frame, orfC (119 aa), is located in the leader region preceding the gag gene, a unique feature among members of the family Retroviridae.

To understand the mechanisms behind the seasonal tumour development and regression induced by WDSV, we have functionally characterized the long terminal repeat (LTR) of WDSV by constructing a WDSV LTR–luciferase reporter construct and 5' deletion mutants. Based on data from transient transfection studies, we identified several regions within the U3 region of the WDSV LTR that have positive or negative effects on viral promoter transcriptional activity.


   Methods
TOP
Abstract
Introduction
Methods
Results
Discussion
References
 
{blacksquare} Cell culture.
For transient transfection assays, W12 cells derived from WDS tissue were utilized (D. Martineau & P. R. Bowser, unpublished). No WDSV sequence has been detected in these cells using Southern blot and PCR (unpublished data). The cells were cultured in MEM (Hanks’ buffer), supplemented with 0·3 g/l NaHCO3, 10% foetal bovine serum (FBS), 100 U/ml penicillin, 100 µg/ml streptomycin and 2 mM l-glutamine. Cells were seeded in sealed flasks and grown as monolayers at 7, 15, 20 and 25 °C without a CO2 supplement.

NIH 3T3 cells obtained from ATCC were cultured in DMEM, supplemented with 10% FBS and 50 µg/ml gentamycin, and were maintained at 37 °C with 5% CO2.

{blacksquare} Identification of transcription factor elements by DNA sequence analysis.
The University of Wisconsin Genetic Computer Group Find program was used to identify putative transcription factor elements (TFEs). The locations and sequences of potential TFEs identified by this analysis are presented in Fig. 1Down. The consensus sequences on which these TFEs are based are presented in Table 1Down, where the coordinates of each TFE are denoted as the first base of the sequence relative to the viral transcription start site in WDSV 5' LTR.



View larger version (22K):
[in this window]
[in a new window]
 
Fig. 1. (a) Structure and putative transcription factor elements (TFEs) in WDSV LTR. Numbers indicate nucleotide positions relative to the viral transcription start site (+1). Potential regulatory elements with a perfect match are in bold and those with one base mismatch are underlined. Short direct repeats are underlined and numbers of direct repeated base pairs are indicated below. r, Reverse orientation. (b) Putative TFEs present in WDSV LTR and SnRV LTR U3 regions. The transcriptional start site is indicated (+1). r, Reverse orientation.

 

View this table:
[in this window]
[in a new window]
 
Table 1. Transcription factor elements present in walleye dermal sarcoma virus (WDSV) and Snakehead retrovirus (SnRV) LTRs

 
{blacksquare} Vector construction.
The firefly (Photinus pyralis) luciferase gene was used as a reporter gene to monitor transcriptional activity of the WDSV LTR in transfected cells. To construct a WDSV LTR luciferase reporter gene vector, two primers, LTR-F (forward, 5' CTCGGTACCAAATGAGAAACTAA 3') and LTR-R (reverse, 5' CGGAAGCTTTGTTAATTCAAATT 3') were used to amplify the WDSV LTR (590 bp) by PCR. The 5' end of the primer LTR-F contained a KpnI site and the 5' end of the primer LTR-R contained a HindIII site. A viral molecular clone derived from a tumour was used as a template (Martineau et al.,1992Down ). The PCR amplicon was directly cloned into the KpnI and HindIII sites of pGL2-Basic (promoterless luciferase reporter gene expression vector; Promega). This plasmid, containing the entire WDSV LTR, was designated pLTR (Fig. 2Down). A nested set of deletion LTR mutants was generated as follows. pLTRwas digested with KpnI to generate a 3' end overhang within the polylinker along with CelII to create a 5' end overhang at nt -398 of the LTR. Exonuclease III was employed to generate 5' end sequential deletions downstream of the CelII site. In addition, several endonuclease sites within the U3 region along with the SmaI site in the vector polylinker were used to generate additional 5' end deletion mutants. These included: NdeI, generating the mutant p-275; BanI for p-223; HincII for p-161; NsiI for p-89; and DdeI for p-43. The junctions of all deletion mutants with plasmid sequences were confirmed by dideoxynucleotide sequencing. The mutants were designated according to the deletion site within U3 (Fig. 2Down).



View larger version (39K):
[in this window]
[in a new window]
 
Fig. 2. (a) Schematic presentation of pLTR and deletion mutants. The entire WDSV LTR was inserted into pGL2-Basic plasmid, upstream of the firefly luciferase gene. This plasmid was designated pLTR. The two sites (KpnI and CelII) used for the generation of the LTR 5' deletion mutants are shown. Numbers on the left of the diagram show the 5' deletion sites. The various sequential deletion mutants are designated (right of the diagram) according to the position of their 5' ends (left of the diagram). Reporter gene construction is described in Methods. (b) Luciferase activity directed in fish cells (W12) by WDSV LTR and deletion mutants at different temperatures. W12 cells were transfected at 25 °C in serum-free transfection medium and split into four equal parts post-transfection, and cultured at different temperatures in growth medium for 24 h (black bars, 25 °C; dark grey bars, 20 °C; light grey bars, 15 °C; white bars, 7 °C). Results reported in the histogram are from one experiment representative of three independent transfection assays (luciferase activity expressed as relative light units).

 
To characterize a putative temperature-response region of WDSV LTR, the primer LTR-A (5' AAATAGAGAAACTAATTTTTG 3'), located between nt -440 and -424, and the primer U3-R (5' ATCTGGCACCATGCTGATCTGG 3'), located between nt -239 and -218, were employed to PCR-amplify a 223 bp fragment from a full-length WDSV provirus clone. This PCR product was purified from an agarose gel and cloned into the SmaI site upstream of the simian virus 40 (SV-40) early promoter present in the pGL2-Control vector (Promega) in two orientations (Fig. 3Down).



View larger version (20K):
[in this window]
[in a new window]
 
Fig. 3. (a) Schematic presentation of the construction of chimeric promoters used to study the effects of a putative WDSV LTR temperature-response region. A putative temperature-response region spanning nt -440 to -218 in the U3 of WDSV LTR was cloned upstream of the SV-40 early promoter in both orientations in the vector pGL2. The chimeric promoters were designated pSV40/LTR-F (forward orientation) and pSV40/LTR-R (reverse orientation). (b, c) Effect of a putative temperature-response region placed upstream of the SV-40 early promoter in fish cells (W12) (b) and mammalian cells (NIH 3T3) (c) cultured at different temperatures. (b) The chimeric promoters were introduced into W12 cells at 25 °C. The SV-40 early promoter alone was used as a negative control. The transfected cells were subsequently incubated at different temperatures for 24 h (black bars, 25 °C; dark grey bars, 20 °C; light grey bars, 15 °C; white bars, 7 °C). The effect of this putative temperature-response region on the SV-40 early promoter activity was examined by measuring the reporter gene luciferase activity (expressed as relative light units). Data presented in the histogram are from one experiment representative of four independent experiments. (c) The chimeric promoters were introduced into NIH 3T3 cells at 37 °C. The SV-40 early promoter alone was used as a negative control. Transfected cells were allowed to grow at both 37 °C (shaded bars) and 25 °C (white bars) for 24 h. The effect of this putative temperature-response region on the SV-40 early promoter activity was examined by measuring the activity of the luciferase reporter gene expressed as relative light units. Results reported in the histogram are from one experiment representative of three independent experiments.

 
The luciferase reporter gene vector pActin was derived from the plasmid pFV6a-CAT, generously provided by P. B. Hackett (University of Minnesota). pFV6a-CAT contains the carp {beta}-actin promoter, the first intron of the carp {beta}-actin gene and the poly(A) signal of SV-40. pActin was constructed by replacing the CAT gene BamHI/SpeI fragment with the 2·7 kb luciferase gene BamHI/NheI fragment from pGL2-Basic. pMMTV was generated from the vector pMSG (Pharmacia Biotech) containing the mouse mammary tumour virus (MMTV) promoter and enhancer sequences. The 2·7 kb BamHI/NheI luciferase gene fragment was inserted downstream of the MMTV promoter in pMSG. W12 cells were transfected in triplicate with pGL2-Basic, pLTR and pActin, as described above, and incubated at 7, 10, 15, 20 and 25 °C. Protein concentrations were measured by the method of Bradford (Bio-Rad Protein Assay) and analysed by one-way ANOVA (P=0·05).

{blacksquare} Cell transfection and luciferase assay.
Plasmids used for DNA transfection were prepared using Qiagen columns following the supplier’s protocol. Transfection was carried out with the LipofectAMINE reagent (2 mg/ml) (GIBCO BRL). To achieve the highest transfection efficiency, several parameters including the amounts of DNA and LipofectAMINE reagent, cell density, transfection time and post-transfection expression time were optimized. Briefly, 5x105 cells/cm2 were seeded in 6-well plates the day before transfection. Plasmid DNA (1 µg) and LipofectAMINE reagent (6 µl) in each well were complexed in twelve 75 mm sterile tubes for 45 min at room temperature in 0·2 ml (for each well) of MEM without serum and antibiotics. During lipid/DNA complex formation, the cells were washed once with 2 ml serum-free MEM medium. For each transfection, 0·8 ml serum-free MEM was added to the tubes containing the lipid/DNA complexes. The transfection medium containing lipid/DNA complexes was then overlaid on the cells. The cells were incubated at 25 °C for 9 h. Following incubation, 1 ml growth medium containing 20% FBS was introduced into each well without removing the transfection mixture and incubation was carried out for 12 h. The transfection medium was then replaced with fresh, complete medium containing 10% FBS. The transfected cells were allowed to grow for 24 h and were harvested for luciferase assays.

For the functional assays at various temperatures, cells were transfected at 25 °C, kept for 6 h without serum, and were allowed to grow at the selected temperatures (25, 20, 15 and 7 °C). For the luciferase assay, the medium was removed from the transfected cells followed by a single wash with PBS. The cells were trypsinized and pelleted by centrifugation at 800 g for 5 min. The pellets were then washed once with 1 ml PBS. Following the washing, the cells were lysed with 100 µl reporter gene lysis buffer (Promega) at room temperature for 30 min. Cell lysis solution (50 µl) was used to perform the luciferase assay in a LUMAT LB 9501/16 (Berthold). Each assay was carried out with 100 µl luciferin substrate solution using 10 s for light counting time.

Three separate experiments were carried out in fish cells (W12 cells) to assay WDSV LTR and deletion mutants at various temperatures; two experiments were carried out in triplicate and one experiment in duplicate. Four separate experiments were carried out in fish cells in triplicate and three separate experiments were carried out in mammalian cells (NIH 3T3 cells) in triplicate to assay chimeric promoters composed of the WDSV LTR 5' end and the SV-40 minimal early promoter.


   Results
TOP
Abstract
Introduction
Methods
Results
Discussion
References
 
Potential TFEs are present in the U3 of WDSV LTR
We identified several additional putative TFEs [CCAAT transcription factor/nuclear factor-1 (CTF/NF-1), cAMP-responsive element (CRE), E-boxes, transcription enhancer factor 1 (TEF1)] in U3 in addition to those already reported (Holzschu et al.,1995Down ) (Table 1Up; Fig. 1Up). The WDSV LTR U3 region contains putative binding sites for transcription factors, several of which exactly match those of known transcription elements [activator protein-1 (AP-1), AP-3, glucocorticoid-response element (GRE), leukaemia virus factor a-Moloney murine leukaemia virus (LVa-Mo-MuLV), transcription factor IID (TFIID), TATA] while others, such as the ecdysone-response element (EcRE), have 1 bp mismatch (Table 1Up; Fig. 1Up). Six potential E-box elements (CANNTG) are scattered within the U3 region, some of which overlap with other TFEs. The first E-box element overlaps with the CRE element, and the second E-box element overlaps with the AP-1 element. The last E-box located between nt -106 and -101 overlaps with a putative LVa motif element. In addition, three types of short direct repeats are present in the U3 region. The first one is present five times and is composed of a pentanucleotide imperfect direct repeat (TRTGT) located between nt -337 and -272. The second type is present twice and is a 10 bp direct repeat starting at positions -316 and -277, and embraces one 5 bp direct repeat. The last type is present three times and is composed of an imperfect 15 bp direct repeat located between positions -82 and -36 (Fig. 1Up) (Holzschu et al., 1995Down ). Comparison of WDSV LTR with the LTR of Snakehead fish retrovirus (SnRV; Hart et al.,1996Down ) showed that several TFEs such as GRE, LVa, EcRE consensus (reverse sequence, direct repeats) and AP-1 are located at almost identical positions in the two LTRs.

Effects of 5' progressive deletions on WDSV LTR-directed luciferase activity
There were no statistically significant differences between protein concentrations of W12 cells transfected with different constructs (pGL2-Basic, pLTR and pActin) or incubated at various temperatures (7, 10, 15, 20 and 25 °C). To investigate the cis-acting regulatory elements present in U3, the effect of sequential, progressive deletions on the LTR-directed luciferase activity was examined. Each mutant was assayed for its ability to direct the synthesis of a reporter gene product, firefly luciferase, following transfection of constructs into W12 cells cultured at various temperatures. The full-length LTR was active in W12 cells and in NIH 3T3 cells (Figs 2Up and 3Up). In W12 cells kept at 25 °C, LTR-directed luciferase activity was 3·4- to 6·9-fold higher than that of the carp {beta}-actin promoter. Both WDSV-LTR and the carp {beta}-actin promoter were most active at 25 °C and showed the same pattern of temperature-dependent activity.

In cells kept at 25 °C, deletion of the 5' 60 bp (p-380) of the LTR (containing four potential transcription regulatory elements; Table 1Up, Fig. 1Up), decreased luciferase activity levels 1·2- to 2·3-fold compared to the full-length LTR. In cells kept at lower temperatures, luciferase activity levels remained unchanged. A similar temperature-specific pattern was shown by mutants p-380 to p-336.

Removal of 8, 3 and 22 additional bp (p-372, p-369 and p-347, respectively), which deleted potential AP-1-SV-40, CRE and the first E-box elements, did not affect luciferase activity. Removal of a further 4 bp (p-343), resulting in the disruption of a putative TEF1 binding site, increased luciferase activity 1·4- to 2·7-fold at all temperatures. Removal of an additional 7 bp (p-336) decreased luciferase activity (1·3- to 7·2-fold) at all temperatures. Deletion of the first two of five 5 bp direct repeats (p-325) increased luciferase activity 3- to 7-fold at 25 °C, 1·9- to 4-fold at 20 °C, 2- to 8-fold at 15 °C and 2·2- to 4·8-fold at 7 °C.

Deletion of two additional 5 bp direct repeats (p-288) decreased the luciferase activity 1·1- to 2·2-fold. Deletion of a potential AP-1 element (p-275) and most of the second E-box sequence decreased the luciferase activity 1·7- to 3·3-fold at 25 °C, 2·3- to 3·1-fold at 20 °C, 1·5- to 2·9-fold at 15  °C and 2- to 3·1-fold at 7 °C. Further deletions (p-223 to p-89) produced a gradual decrease in luciferase activity, with p-89 showing the lowest level. Removal of the adjacent three 15 bp direct repeats (p-43) slightly increased luciferase activity compared to that of p-89.

Effects of U3 5' half on SV-40 promoter activity
Based on the presence of temperature-specific promoter elements in the 5' half of WDSV U3, experiments were conducted to determine whether this region can confer temperature responsiveness to a heterologous promoter. Two chimeric promoters were constructed by inserting the 5' half of WDSV U3 (nt -440 to -218), upstream of the SV-40 early promoter in both orientations. The resulting constructs were introduced into W12 cells and transfected cells were allowed to grow at different temperatures. Surprisingly, the 5' half of U3 inserted in the forward orientation slightly (1·3- to 2-fold) increased the SV-40 early promoter activity at 20 °C in fish cells when compared to the SV-40 early promoter alone (Fig. 3Up) while in the reverse orientation, the 5' half of U3 slightly decreased (10–50%) luciferase activity at all temperatures (Fig. 3Up).

To determine whether this LTR region is functional in mammalian cells, these chimeric promoters were transfected into NIH 3T3 cells allowed to grow either at 37 °C or at 25 °C after transfection. Compared to the luciferase activity directed by the SV-40 early promoter alone, the insertion of this region in a forward orientation resulted in a 3·7- to 5·1-fold increase at 37 °C and in a lesser increase (1·4- to 4·2-fold) at 25 °C (Fig. 3Up), whereas the same fragment in the reverse orientation had no effect (0·65- to 1·6-fold).

Functional analysis of a putative GRE in the U3 of WDSV LTR
As sequence analysis of the LTR revealed the presence of a putative GRE in the U3 region of WDSV LTR, this putative element was functionally examined in NIH 3T3 cells, which express the glucocorticoid receptor (GR) (Hatzoglou et al.,1991Down ). The luciferase reporter gene under the control of the MMTV promoter was used as a positive control. The plasmid pLTR containing the entire WDSV LTR was transfected into NIH 3T3 cells. Dexamethasone increased the MMTV promoter activity 10-fold, whereas treatment with progesterone did not affect it (Fig. 4Down). In contrast, dexamethasone and progesterone had no effect on WDSV LTR-directed luciferase activity in NIH 3T3 cells.



View larger version (15K):
[in this window]
[in a new window]
 
Fig. 4. Functional analysis of a putative GRE in the U3 of WDSV LTR. NIH 3T3 cells were transfected with pLTR and pMMTV. Transfected cells were then treated with dexamethasone (10-6 M; grey bars) or progesterone (10-7 M; white bars) for 24 h (control, black bars). The function of the putative GRE on the U3 of WDSV LTR was examined by measuring trans-activation of promoter activity directing the expression of the luciferase reporter gene (luciferase activity expressed as relative light units).

 

   Discussion
TOP
Abstract
Introduction
Methods
Results
Discussion
References
 
To date, no pathogenic fish retroviruses have been propagated in cultured cells. WDSV is the first fish retrovirus whose LTR has been functionally characterized in vitro. Fish and mammalian cells were found to support efficient expression of the luciferase reporter gene driven by the WDSV LTR. Thus, the inability to grow WDSV in cultured cells is probably not due to an intrinsic inability of the WDSV LTR to direct transcriptional activity. Rather, it may be due to viral or cellular factors that have negative effects on cell growth and/or promoter activity. orfA, one of the three accessory genes present in the WDSV genome, could be one of these factors since it inhibits the expression of various eukaryotic promoters, and negatively affects cell growth (Zhang & Martineau, 1999Down ).

We have used a transient expression assay to study the effects of sequential deletions of the U3 region on the transcriptional activity of WDSV LTR. In fish cells, deletion of the first 60 bp significantly decreased luciferase activity levels only at 25 °C, that is in a temperature-specific manner. Thus, this region, which contains four putative TFEs (Table 1Up, Fig. 1Up) and a potential EcRE (1 bp mismatch) in tandem repeat, modulates the levels of viral gene expression in a temperature-specific manner. A putative EcRE is also present as an overlapping repeat at the same position in SnRV, the only other fish retrovirus whose nucleotide sequence has been determined (Table 1Up; Fig. 1Up) (Hart et al., 1996Down ), and at the 5' end of the regulatory region (-770 to -760) of the temperature-induced carp myosin-heavy-chain gene. In the latter gene, disruption of the putative EcRE abolishes temperature response (Gauvry et al., 1996Down ). Considered together, the conservation of this putative element in the same orientation and in the same position in two viruses whose hosts are widely different, and in the regulatory region of a fish cellular gene, along with the involvement of EcRE in the regulation of heat-shock protein expression in insect cells (Dobens et al.,1991Down ) suggest that this element could be functional and could be involved in temperature response in both viruses. Additional mutagenesis studies specifically targeting the potential EcRE will be necessary to confirm this hypothesis.

Several reasons could explain the lack of response to dexamethasone or progesterone treatments in NIH 3T3 cells. Firstly, only the consensus core of the GRE is present in the WDSV LTR and, thus, this putative GRE could be non-functional. Secondly, the GRE consensus present in the WDSV LTR could be the core of a fish-specific GRE that is not recognized by the activated mammalian GR. Lastly, GREs, often present in retroviral enhancers, are not all activated by dexamethasone, probably because contextual sequences impair GRE recognition by the activated GR (Golemis et al.,1989Down ). Whether the putative eukaryotic transcription binding element CTF/NF-1 is functional in fish cells remains to be determined. In addition, considering the unique physiological characteristics of fish, we cannot rule out the possibility that other unidentified transcriptional regulatory elements are present in this region.

Further removal of 44 bp did not significantly alter WDSV LTR activity (p-380 to p-344). This suggests that the motifs present in this region (CRE, E-box) do not play a major role in transcription under the conditions used in this study. Seven base pairs located between nt -343 and -336 positively modulated luciferase activity at all temperatures since deletion of this region decreased luciferase activity. Although no putative transcriptional motifs were found within this region, as yet unidentified transcriptional motifs specific to fish might be present.

Short direct repeats are often associated with enhancing the transcriptional activity of retroviral LTRs (Barnhart et al.,1997Down ). For instance, Tax activates human T-lymphotropic virus type 1 transcription through DNA sequences present in U3 known as the Tax-responsive elements which consist of three copies of an imperfect 21 bp repeat (Brady et al., 1987Down ). In WDSV, however, deletion of the first two 5 bp repeats present between nt -336 and -325 increased luciferase activity at all temperatures, implying that these repeats have a negative effect on viral gene expression.

Removal of 13 bp between nt -288 and -275 markedly decreased luciferase activity, suggesting that this region is important to maintain basal levels of transcription at all temperatures. The deleted region encompasses a perfectly matched AP-1 element overlapping an E-box, the fifth 5 bp repeat and the second 10 bp repeat. AP-1 elements have been involved in positively regulating many eukaryotic genes. The U3 region of many retroviruses contains AP-1 elements which positively modulate viral gene expression (Weng et al.,1995Down ). In SnRV, a bona fide AP-1 element is also present in an almost identical position, also in proximity of a putative TEF1 element (Table 1Up; Fig. 1Up) (Hart et al.,1996Down ). These similarities support the proposal that the putative AP-1 element present in WDSV LTR is functional and plays a crucial role in WDSV expression. Site-specific mutagenesis experiments will be necessary, however, to confirm that AP-1, alone or with an overlapping element, plays a major role in maintaining basal transcriptional activity.

Insertion of a U3 fragment (-440 to -275) containing several potential regulatory elements upstream of the SV-40 early promoter increased the activity of that promoter in an orientation-dependent manner. This finding implies that promoter elements located within this region act positively on the transcription machinery of both poikilotherm and homeotherm animals.

The results presented here represent the first functional analysis of a fish retrovirus LTR and provide insight into the temperature/hormone-dependence of WDSV transcripts. These studies also provide the basis for more detailed study of transcriptional regulation from this interesting and complex retrovirus.


   Acknowledgments
 
We thank Dr. J. S. Mymryk, University of Western Ontario, for reviewing the manuscript and for helpful discussion. This work was supported by Grant OGPO 138236 from the Natural Sciences and Engineering Research Council of Canada (NSERC) and by grant 95-NC-1238 from FCAR to D.M.


   Footnotes
 
b Present address: Department of Oncology, The University of Western Ontario, London Regional Cancer Centre, 790 Commissioners Road East, London, Ontario N6A 4L6, Canada. Back


   References
TOP
Abstract
Introduction
Methods
Results
Discussion
References
 
Barnhart, M. K., Connor, L. M. & Marriott, S. J. (1997). Function of the human T-cell leukemia virus type 1 21-base-pair repeats in basal transcription. Journal of Virology 71, 337-344.[Abstract]

Bowser, P. R. & Wooster, G. A. (1991). Regression of dermal sarcoma in adult walleyes. Journal of Aquatic Animal Health 3, 147-150.

Bowser, P. R., Wolfe, M. J., Forney, J. L. & Wooster, G. A. (1988). Seasonal prevalence of skin tumors from walleye (Stizostedion vitreum) from Oneida Lake, New York. Journal of Wildlife Diseases 24, 292-298.[Abstract]

Bowser, P. R., Martineau, D. & Wooster, G. A. (1990). Effects of water temperature on experimental transmission of dermal sarcoma in fingerling walleyes Stizostedion vitreum. Journal of Aquatic Animal Health 2, 157-161.

Bowser, P. R., Wooster, G. A., Quackenbush, S. L., Casey, R. N. & Casey, J. W. (1996). Comparison of fall and spring tumors as inocula for experimental transmission of walleye dermal sarcoma. Journal of Aquatic Animal Health 8, 78-81.

Brady, J., Jeang, K. T., Duvall, J. & Khoury, G. (1987). Identification of p40x-responsive regulatory sequences within the human T-cell leukemia virus type I long terminal repeat. Journal of Virology 61, 2175-2181.[Abstract/Free Full Text]

Dobens, L., Rudolph, K. & Berger, E. M. (1991). Ecdysterone regulatory elements function as both transcriptional activators and repressors. Molecular & Cellular Biology 11, 1846-1853.[Abstract/Free Full Text]

Gauvry, L., Ennion, S., Hansen, E., Butterworth, P. & Goldspink, G. (1996). The characterization of the 5' regulatory region of a temperature-induced myosin-heavy-chain gene associated with myotomal muscle growth in the carp. European Journal of Biochemistry 236, 887-894.[Medline]

Golemis, E., Li, Y., Fredrickson, T. N., Hartley, J. W. & Hopkins, N. (1989). Distinct segments within the enhancer region collaborate to specify the type of leukemia induced by nondefective Friend and Moloney viruses. Journal of Virology 63, 328-337.[Abstract/Free Full Text]

Hart, D., Frerichs, G. N., Rambaut, A. & Onions, D. E. (1996). Complete nucleotide sequence and transcriptional analysis of snakehead fish retrovirus. Journal of Virology 70, 3606-3616.[Abstract]

Hatzoglou, M., Bosch, F., Park, E. A. & Hanson, R. W. (1991). Hormonal control of interacting promoters introduced into cells by retroviruses. Journal of Biological Chemistry 266, 8416-8425.[Abstract/Free Full Text]

Holzschu, D. L., Martineau, D., Fodor, S. K., Vogt, V. M., Bowser, P. R. & Casey, J. W. (1995). Nucleotide sequence and protein analysis of a complex piscine retrovirus, walleye dermal sarcoma virus. Journal of Virology 69, 5320-5331.[Abstract]

Martineau, D., Bowser, P. R., Wooster, G. & Forney, J. L. (1990). Histologic and ultrastructural studies of dermal sarcoma of walleye (Pisces: Stizostedion vitreum). Veterinary Pathology 27, 340-346.[Abstract]

Martineau, D., Bowser, P. R., Renshaw, R. R. & Casey, J. W. (1992). Molecular characterization of a unique retrovirus associated with a fish tumor. Journal of Virology 66, 596-599.[Abstract/Free Full Text]

Walker, R. (1969). Virus associated with epidermal hyperplasia in fish. National Cancer Institute Monograph 31, 195-207.

Weng, H., Choi, S. Y. & Faller, D. V. (1995). The Moloney leukemia retroviral long terminal repeat trans-activates AP-1-inducible genes and AP-1 transcription factor binding. Journal of Biological Chemistry 270, 13637-13644.[Abstract/Free Full Text]

Yamamoto, T., Macdonald, R. D., Gillespie, D. C. & Kelly, R. K. (1976). Viruses associated with lymphocystis disease and dermal sarcoma of walleye (Stizostedion vitreum vitreum). Journal of Fisheries Research of Canada 33, 2408-2419.

Yamamoto, T., Kelly, R. K. & Nielsen, O. (1985). Morphological differentiation of virus-associated skin tumors of walleye (Stizostedion vitreum vitreum). Fish Pathology 20, 361-372.

Zhang, Z. & Martineau, D. (1999). Walleye dermal sarcoma virus: OrfA N-terminal end inhibits the activity of a reporter gene directed by eukaryotic promoters and has a negative effect on the growth of fish and mammalian cells. Journal of Virology 73 (in press).

Received 19 May 1999; accepted 30 August 1999.


This article has been cited by other articles:


Home page
J. Virol.Home page
B. W. Hronek, A. Meagher, J. Rovnak, and S. L. Quackenbush
Identification and Characterization of cis-Acting Elements Residing in the Walleye Dermal Sarcoma Virus Promoter
J. Virol., July 15, 2004; 78(14): 7590 - 7601.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via CrossRef
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Zhang, Z.
Right arrow Articles by Martineau, D.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Zhang, Z.
Right arrow Articles by Martineau, D.
Agricola
Right arrow Articles by Zhang, Z.
Right arrow Articles by Martineau, D.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
INT J SYST EVOL MICROBIOL MICROBIOLOGY J GEN VIROL
J MED MICROBIOL ALL SGM JOURNALS