|
|
||||||||
Animal: RNA Viruses |
Department of Virus and Cancer, Danish Cancer Society, Gustav Wieds Vej 10, DK-8000 Aarhus C, Denmark1
George H. Whipple Laboratory for Cancer Research, Departments of Pathology, Urology and Biochemistry, University of Rochester, Box 626, Rochester, NY 14642, USA2
Author for correspondence: Xiangdong Liu.Fax +45 86 19 54 15. e-mail liu{at}virus.au.dk
| Abstract |
|---|
|
|
|---|
| Introduction |
|---|
|
|
|---|
B/Rel proteins and mediate transactivation of many cellular genes in HTLV-I-infected cells, such as IL-2R
, IL-1
, GM-CSF, c-myc and vimentin (Duyao et al., 1992
Another immediate-early gene that can be upregulated by the Tax transactivator is TR3/nur77 (the human homologue of nur77, NGFI-B, N10 and TIS1, also termed NAK-1; in this report we use TR3/nur77) (Chen et al., 1998
). TR3/nur77 has been found to be involved mainly in induction of T-cell apoptotic death (Liu et al., 1994
; Woronicz et al., 1994
). In particular, it has been shown to be activated by mitogenic serum growth factors in fibroblasts (Hazel et al., 1988
; Ryseck et al., 1989
), by nerve growth factor (NGF) and membrane depolarization in the pheochromocytoma cell line PC12 (Milbrandt, 1988
; Yoon & Lau, 1993
, 1994
) and by T-cell receptor signalling in immature thymocytes and T-cell hybridomas (Liu et al., 1994
; Woronicz et al., 1994
). Comparison of the 5'-flanking region of TR3/nur77 from different species (human, mouse and rat) shows that sequences within 250 bp of the promoter region from the transcription start site are well conserved. In this region, there are four AP-1-like elements, five consensus Sp1 motifs and also Ets, CArG and Egr motifs (Ryseck et al., 1989
; Uemura et al., 1995
; Watson & Milbrandt, 1989
). In fibroblast cells, activation of TR3/nur77 by serum growth factors requires multiple transcription elements in the 126 bp promoter sequence immediately upstream of transcription start site and involves immediate-early and delayed-early biphasic transcriptional regulation. Activation by phorbol esters requires enhancer elements between nt -126 and -72 of the promoter region (Williams & Lau, 1993
). In the rat pheochromocytoma-derived cell line PC-12, activation of TR3/nur77 by both NGF and membrane depolarization involves two AP-1-like elements and Sp1 elements between nt -60 and -30 of the promoter region. The two AP-1-like elements confer inducibility by NGF and membrane depolarization (Yoon & Lau, 1993
, 1994
). In T lymphocytes, activation of TR3/nur77 by phorbol esters requires a promoter sequence between nt -378 and -162. The exact responsive elements in this region have not been confirmed because of two controversial results (Liu et al., 1994
; Woronicz et al., 1994
). Activation of TR3/nur77 by apoptotic signals delivered through T-cell receptor signalling requires the promoter sequence between nt -322 and -151 (Liu et al., 1994
; Woronicz et al., 1994
).
We have recently analysed the differential expression and regulation by Tax of TR3/nur77, NOR-1 and NOT in HTLV-I-infected cells (Chen et al., 1998
). TR3/Nur77, NOR-1 and NOT are three closely related transcription factors that constitute the Nur77 subfamily belonging to the steroid/thyroid hormone receptor superfamily (Hazel et al., 1988
; Mages et al., 1994
; Milbrandt, 1988
; Nakai et al., 1990
; Ohkura et al., 1996
; Ryseck et al., 1989
; Watson & Milbrandt, 1989
). We have demonstrated that only TR3/nur77 is highly expressed in HTLV-I-infected cells and that Tax is able to induce TR3/nur77 expression dramatically in JPX-9 cells, in which tax expression is under the control of an inducible promoter (Nagata et al., 1989
). In continuation of our previous study, we sought to specify the mechanisms involved in Tax-regulated TR3/nur77 expression in more detail.
| Methods |
|---|
|
|
|---|
Cells.
Plasmids.
Construction of deletion mutants of the human TR3/nur77 promoterchloramphenicol acetyltransferase (CAT) reporter vector was described previously (Uemura et al., 1995
). pGL2-TR3P-124 was constructed by cutting p-151TR3CAT with SmaI and XmnI and inserting the promoter sequence into the SmaI site of the pGL2-basic plasmid (Promega). The correct orientation of the promoter sequence was confirmed by automated fluorescent-label sequencing. For construction of the basic luciferase (Luc) reporter vector pE1b-Luc, complementary oligonucleotides containing a minimal promoter of the adenovirus E1b gene (sense: 5' CTCGAGCTGCAGGGTATATAATGCGCCAGCTCAAGCTT) were synthesized, annealed and cloned into the XhoI/HindIII site of the pGL2-basic vector. To obtain the pE1b-NAP-Luc and pE1b-mu-NAP-Luc plasmids, complementary oligonucleotides containing a tandem repeat (underlined) of the wild-type (sense: 5' CCGGGCCTGCGTCAGTGGCGCTGCGTCACGGAGC) or mutated (sense: 5' CCGGGCCTGCAGAAGTGGCGCTGCAGAACGGAGC) NAP sites from the TR3/nur77 promoter were synthesized, annealed and cloned into the XmaI/XhoI site of pE1b-Luc. The control pCMV and Tax-expressing pCMV-Tax plasmids were described previously (Smith & Greene, 1990
).
Site-directed in vitro mutagenesis of the human TR3/nur77 promoter.
The pGL2-TR3P-124 plasmid was used as a template for construction of the mutated promoters with the QuikChange site-directed mutagenesis kit (Stratagene). The following oligonucleotides were used for mutagenesis (substituted bases are underlined): CArG-like (5' CGCCCCCACGCGCCCGCGTATGGCCAAAGCTCG), Egr (5' GCGGCCTGCGTCAGTGGATAACCCGCCCCTCCCCGTGC), Ets (5' GGCCGCCTCCCGCCCTCACCGCACCGCCCCCACG), NAP-1 (5' CGACGGGCGGCCTGCAGAAGTGGCGCCCCCGC), NAP-2 (5' GCCCCTCCCCGTGCAGAACGGAGCGCTTAAGAG), RCE (5' GGAACCGCACCGCCCAAACGCGCCCTTGTATGG) and Sp1 (5' GCCTGCGTCAGTGGCGCCCCAAACCCTCCCCGTGCGTCACGG). All mutations were confirmed by DNA sequencing.
Transfection and reporter gene analysis.
All transfection experiments were performed in 6-well plates in triplicate with serum-free Optimem medium (Life Technologies). Jurkat cells were transfected by applying 4 µl liposome reagent DMRIE-C (Life Technologies) and 4 µg plasmid to 2x106 cells. After 5 h, the cultures were replenished with fresh supplemented medium. The cultures were grown for a further 48 h. Luciferase was extracted according to the manufacturers instructions (Promega) and activity was determined by a bioluminescent assay with an automated microplate luminometer (Labsystems). CAT activity was quantified with an ELISA kit (Boehringer). Activities in individual samples were normalized on the basis of protein content, which was determined by the bicinchoninic acid protein assay (Pierce).
Preparation of nuclear extracts.
Jurkat, Molt-4, C8166-45 and MT-2 cells were washed with PBS and resuspended in buffer A [10 mM HEPESKOH, pH 7·9; 1·5 mM MgCl2; 10 mM KCl; 1 mM sodium orthovanadate; 0·5 mM DTT; 1x protease inhibitor cocktail (Boehringer); 0·3 M sucrose and 0·1% NP-40]. After incubation for 15 min on ice, plasma membrane disruption was checked under a microscope. Nuclei were collected by centrifuging at 3300 g for 15 min at 4 °C. Pelleted nuclei were resuspended in buffer C (20 mM HEPESKOH, pH 7·9; 1·5 mM MgCl2; 0·4 M NaCl; 1 mM sodium orthovanadate; 0·5 mM DTT; 0·2 mM EDTA; 1x protease inhibitor cocktail and 25% glycerol) on ice with constant shaking for 30 min. Nuclear debris was removed by centrifugation at 25000 g for 30 min. The supernatant was collected and dialysed with buffer D (20 mM HEPESKOH, pH 7·9; 50 mM KCl; 1 mM sodium orthovanadate; 0·5 mM DTT; 0·2 mM EDTA; 1x protease inhibitor cocktail and 20% glycerol) for 60 min at 4 °C with the Microdialyser System 100 (Pierce).
Gel-shift and supershift analyses.
Nuclear extracts (10 µg) were incubated with 500010000 c.p.m. (0·5 ng) 32P-labelled NAP oligonucleotides (see below), 0·5 µg poly(dIdC) and 1 µg BSA in binding buffer (12 mM HEPESKOH, pH 7·9; 60 mM NaCl; 1 mM MgCl2; 1 mM DTT and 12% glycerol) in 10 µl final volume for 25 min at 37 °C. For competition analysis, a 50-fold molar excess of cold double-stranded oligonucleotides was added to the reaction mixture and incubated for 20 min on ice before the addition of the 32P-labelled NAP probe. The oligonucleotides and their corresponding sequences were (binding motifs are underlined): NAP (5' TCGAGCTCTCCATGCGTCACGGAGCGC 3'), mu-NAP (5' CCGGGCCTGCAGAAGTGGCGC 3'), AP-1 (5' CTAGTGATGAGTCAAGCCGGATC 3'), AP-2 (5' GATCGAACTGACCGCCCGCGGGCCCGT 3'), CREB (5' GATTGGCTGACGTCAGAGAGCT 3'), Sp1 (5' GATCGATCGGGGCGGGGCGATC 3'), NF-
B (5' GATCGAGGGGACTTTCCCTAGC 3') and Oct-1 (5' GATCGAATGCAAATCACTAGCT 3').
For supershift analysis, 1 µg anti-CREB, anti-CREM, anti-ATF1, anti-ATF2, anti-ATF3, anti-ATF4(CREB2), anti-c-jun, anti-junB, anti-junD, anti-c-fos, anti-fosB, anti-fra1 or anti-fra2 antibody (all purchased from Santa Cruz Biotechnology) was incubated with 10 µg nuclear extract in 10 µl volume after the addition of NAP probe to the reaction mixture for 25 min at 37 °C. The complexes were resolved by electrophoresis in a 4% polyacrylamide gel (1:40 bisacrylamide/acrylamide) in 0·25x TBE buffer at 4 °C and visualized with an InstantImager (Packard Instruments).
| Results |
|---|
|
|
|---|
|
|
Tax-responsiveness of the NAP elements in a heterologous minimal promoter
In order to characterize further the functional responsiveness of the two NAP elements to Tax transactivation, these two NAP elements and mutated NAP elements with surrounding sequence from the TR3/nur77 promoter were cloned into the pE1b-luc reporter vector, which contains a basal E1b promoter sequence (pE1b-NAP-luc and pE1b-mu-NAP-luc). Co-transfection of pE1b-NAP-luc with Tax showed an increase in luciferase activity of around 7-fold and co-transfection with the mutant NAP reporter (pE1b-mu-NAP-luc) did not show any induction, which indicated the specific response of the NAP elements (Fig. 3
). This result further supported the independent Tax responsiveness of these two NAP elements in Tax-regulated TR3/nur77 expression.
|
|
B, Sp1 or Oct-1 probes (Fig. 5A
|
| Discussion |
|---|
|
|
|---|
B, SRF, Ets, Sp1 and NF-Y (Dittmer et al., 1997
In a literature search, we found that the fra-1 and proenkephalin genes are also regulated by Tax through identical NAP elements (Low et al., 1994
; Tsuchiya et al., 1993
). The NAP element (TGCGTCA) has also been designated as the CRE-2 or FAP element (Hai & Curran, 1991
; Velcich & Ziff, 1990
; Yoon & Lau, 1993
, 1994
). It closely resembles the consensus AP-1 element (TGAG/CTCA) and the CRE sequence (TGACGTCA). The two NAP elements in the TR3/nur77 promoter are flanked by GC-rich sequences. Recent results of analysis of Tax-mediated HTLV-I LTR activity demonstrated that GC-rich sequences flanking the CRE motif of the HTLV-I LTR are crucial for TaxCREBDNA ternary complex assembly and that Tax can interact directly with the flanking GC-rich sequences (Lenzmeier et al., 1998
). The GC-rich sequences flanking the NAP motifs in the TR3/nur77 promoter may thus provide direct interaction with the Tax protein. In our work, we have shown that a DNA probe containing the NAP motif and the flanking GC-rich sequence forms a specific DNAprotein-binding complex in Tax-expressing, HTLV-I-infected cells. This specific binding could be competed for efficiently by the consensus AP-1 and CRE elements, showing that the proteins forming a complex with the NAP element may belong to the AP-1 and/or CREB/ATF transcription factor families. As we have shown here, JunD is a part of this complex. JunD is expressed constitutively at high levels in T cells and other tissues (Chiu et al., 1989
; Hirai et al., 1989
; Farina et al., 1993
). Unmodified and in the absence of other factors, JunD forms unstable complexes with DNA (Nakabeppu & Nathans, 1989
; Ryder et al., 1989
). JunD can form heterodimers with ATF3 and bind to the NAP element in vitro (Hai & Curran, 1991
). Earlier work by Low et al. (1994)
showed that ATF3 can collaborate with Tax in regulation of proenkephalin expression in F9 cells. Recombinant Tax protein can increase in vitro binding of ATF3 to the NAP element dramatically. However, the authors did not provide any data that showed ATF3 binding in vivo to the NAP element in HTLV-I-infected cells. Our gel-shift analysis indicated that none of the characterized Fos family members (c-Fos, FosB, Fra1 or Fra2) or CREB/ATF members (CREB, CREM, ATF1, ATF2, ATF3, ATF4 and B-ATF) are components of this NAP-binding complex and that none of them collaborates with JunD in response to Tax transactivation of TR3/nur77 expression in F9 cells (data not shown).
The work of Yoon & Lau (1993
, 1994
) showed that TR3/nur77 can also be induced transiently by NGF and membrane depolarization in PC12 cells through the two NAP elements. JunD can also stimulateTR3/nur77 expression in PC-12 cells, and a JunD dominant-negative mutant blocks TR3/nur 77 activation by NGF and membrane depolarization. However, JunD alone does not bind to the NAP element. Also, these authors could not define a specific JunD partner in response to NGF and membrane depolarization. Earlier work showed that an uncharacterized protein distinct from either Fos, Jun or other known proteins forms a complex with JunD that can be induced rapidly in T cells by phorbol esters in the absence of protein synthesis (Gardner et al., 1994
; Farina et al., 1993
). Because unstimulated T cells do not express four characterized Fos-related proteins (c-Fos, FosB, Fra1 and Fra2), it is impossible for JunD to form heterodimers with these proteins to regulate expression of immediate-early genes during the immediate-early stage of T-cell stimulation. Our ongoing work also suggests that a new protein, different from any currently characterized AP-1 or CREB/ATF transcription factor, is a component of the NAP-binding complex in HTLV-I-infected cells. It seems that this uncharacterized JunD-binding protein can form a heterodimer with JunD to bind specifically to the NAP element in response to diverse stimuli.
| Acknowledgments |
|---|
| References |
|---|
|
|
|---|
Chen, X. L., Zachar, V., Chang, C. S., Ebbesen, P. & Liu, X. D. (1998). Differential expression of Nur77 family members in human T-lymphotropic virus type 1-infected cells: transactivation of the TR3/nur77 gene by Tax protein. Journal of Virology 72, 6902-6906.
Chiu, R., Angel, P. & Karin, M. (1989). Jun-B differs in its biological properties from, and is a negative regulator of, c-Jun. Cell 59, 979-986.[Medline]
Dittmer, J., Pise-Masison, C. A., Clemens, K. E., Choi, K. S. & Brady, J. N. (1997). Interaction of human T-cell lymphotropic virus type I Tax, Ets1, and Sp1 in transactivation of the PTHrP P2 promoter. Journal of Biological Chemistry 272, 4953-4958.
Duyao, M. P., Kessler, D. J., Spicer, D. B., Bartholomew, C., Cleveland, J. L., Siekevitz, M. & Sonenshein, G. E. (1992). Transactivation of the c-myc promoter by human T cell leukemia virus type 1 tax is mediated by NF
B. Journal of Biological Chemistry 267, 16288-16291.
Farina, A. R., Davis-Smyth, T., Gardner, K. & Levens, D. (1993). An early response of an AP1junD complex during T-cell activation. Journal of Biological Chemistry 268, 26466-26475.
Franchini, G. (1995). Molecular mechanisms of human T-cell leukemia/lymphotropic virus type I infection. Blood 86, 3619-3639.
Franklin, A. A., Kubik, M. F., Uittenbogaard, M. N., Brauweiler, A., Utaisincharoen, P., Matthews, M. A. H., Dynan, W. S., Hoeffler, J. P. & Nyborg, J. K. (1993). Transactivation by the human T-cell leukemia virus Tax protein is mediated through enhanced binding of activating transcription factor-2 (ATF-2) response and cAMP element-binding protein (CREB). Journal of Biological Chemistry 268, 21225-21231.
Fujii, M., Niki, T., Mori, T., Matsuda, T., Matsui, M., Nomura, N. & Seiki, M. (1991). HTLV-1 Tax induces expression of various immediate early serum responsive genes. Oncogene 6, 1023-1029.[Medline]
Fujii, M., Tsuchiya, H., Chuhjo, T., Akizawa, T. & Seiki, M. (1992). Interaction of HTLV-1 Tax1 with p67SRF causes the aberrant induction of cellular immediate early genes through CArG boxes. Genes & Development 6, 2066-2076.
Fujii, M., Chuhjo, T., Minamino, T., Masaaki, N., Miyamoto, K. I. & Seiki, M. (1995). Identification of the Tax interaction region of serum response factor that mediates the aberrant induction of immediate early genes through CArG boxes by HTLV-I Tax. Oncogene 11, 7-14.[Medline]
Gardner, K., Moore, T. C., Davis-Smyth, T., Krutzsch, H. & Levens, D. (1994). Purification and characterization of a multicomponent AP-1·junD complex from T cells. Journal of Biological Chemistry 269, 32963-32971.
Gessain, A., Barin, F., Vernant, J. C., Gout, O., Maurs, L., Calender, A. & de The, G. (1985). Antibodies to human T-lymphotropic virus type-I in patients with tropical spastic paraparesis. Lancet ii, 407410.
Good, L., Maggirwar, S. B., Harhaj, E. W. & Sun, S. C. (1997). Constitutive dephosphorylation and activation of a member of the nuclear factor of activated T cells, NF-AT1, in Tax-expressing and type I human T-cell leukemia virus-infected human T cells. Journal of Biological Chemistry 272, 1425-1428.
Hai, T. & Curran, T. (1991). Cross-family dimerization of transcription factors Fos/Jun and ATF/CREB alters DNA binding specificity. Proceedings of the National Academy of Sciences, USA 88, 3720-3724.
Harada, S., Koyanagi, Y. & Yamamoto, N. (1985). Infection of HTLV-III/LAV in HTLV-I-carrying cells MT-2 and MT-4 and application in a plaque assay. Science 229, 563-566.
Hazel, T. G., Nathans, D. & Lau, L. F. (1988). A gene inducible by serum growth factors encodes a member of the steroid and thyroid hormone receptor superfamily. Proceedings of the National Academy of Sciences, USA 85, 8444-8448.
Heinemeyer, T., Wingender, E., Reuter, I., Hermjakob, H., Kel, A. E., Kel, O. V., Ignatieva, E. V., Ananko, E. A., Podkolodnaya, O. A., Kolpakov, F. A., Podkolodny, N. L. & Kolchanov, N. A. (1998). Databases on transcriptional regulation: TRANSFAC, TRRD and COMPEL. Nucleic Acids Research 26, 362-367.
Hirai, S. I., Ryseck, R. P., Mechta, F., Bravo, R. & Yaniv, M. (1989). Characterization of junD: a new member of the jun proto-oncogene family. EMBO Journal 8, 1433-1439.[Medline]
Hirai, H., Fujisawa, J., Suzuki, T., Ueda, K., Muramatsu, M., Tsuboi, A., Arai, N. & Yoshida, M. (1992). Transcriptional activator Tax of HTLV-1 binds to the NF-
B precursor p105. Oncogene 7, 1737-1742.[Medline]
Hirai, H., Suzuki, T., Fujisawa, J., Inoue, J. & Yoshida, M. (1994). Tax protein of human T-cell leukemia virus type I binds to the ankyrin motifs of inhibitory factor
B and induces nuclear translocation of transcription factor NF-
B proteins for transcriptional activation. Proceedings of the National Academy of Sciences, USA 91, 3584-3588.
Lenzmeier, B. A., Giebler, H. A. & Nyborg, J. K. (1998). Human T-cell leukemia virus type 1 Tax requires direct access to DNA for recruitment of CREB binding protein to the viral promoter. Molecular and Cellular Biology 18, 721-731.
Leung, K. & Nabel, G. J. (1988). HTLV-1 transactivator induces interleukin-2 receptor expression through an NF-kappa B-like factor. Nature 333, 776-778.[Medline]
Lilienbaum, A. & Paulin, D. (1993). Activation of the human vimentin gene by the Tax of human T-cell leukemia virus. I. Mechanism of regulation by the NF-kappa B transcription factor. Journal of Biological Chemistry 268, 2180-2188.
Liu, Z. G., Smith, S. W., McLaughlin, K. A., Schwartz, L. M. & Osborne, B. A. (1994). Apoptotic signals delivered through the T-cell receptor of a T-cell hybrid require the immediate-early gene nur77. Nature 367, 281-284.[Medline]
Low, K. G., Chu, H. M., Schwartz, P. M., Daniels, G. M., Melner, M. H. & Comb, M. J. (1994). Novel interactions between human T-cell leukemia virus type I Tax and activating transcription factor 3 at a cyclic AMP-responsive element. Molecular and Cellular Biology 14, 4958-4974.
Mages, H. W., Rilke, O., Bravo, R., Senger, G. & Kroczek, R. A. (1994). NOT, a human immediate-early response gene closely related to the steroid/thyroid hormone receptor NAK1/TR3. Molecular Endocrinology 8, 1583-1591.
Milbrandt, J. (1988). Nerve growth factor induces a gene homologous to the glucocorticoid receptor gene. Neuron 1, 183-188.[Medline]
Mori, N. & Prager, D. (1996). Transactivation of the interleukin-1
promoter by human T-cell leukemia virus type I and type II Tax proteins. Blood 87, 3410-3417.
Nagata, K., Ohtani, K., Nakamura, M. & Sugamura, K. (1989). Activation of endogenous c-fos proto-oncogene expression by human T-cell leukemia virus type I-encoded p40tax protein in the human T-cell line, Jurkat. Journal of Virology 63, 3220-3226.
Nakabeppu, Y. & Nathans, D. (1989). The basic region of Fos mediates specific DNA binding. EMBO Journal 8, 3833-3841.[Medline]
Nakai, A., Kartha, S., Sakurai, A., Toback, F. G. & DeGroot, L. J. (1990). A human early response gene homologous to murine nur77 and rat NGFI-B, and related to the nuclear receptor superfamily. Molecular Endocrinology 4, 1438-1443.
Nimer, S. D., Gasson, J. C., Hu, K., Smalberg, I., Williams, J. L., Chen, I. S. & Rosenblatt, J. D. (1989). Activation of the GM-CSF promoter by HTLV-I and -II tax proteins. Oncogene 4, 671-676.[Medline]
Ohkura, N., Ito, M., Tsukada, T., Sasaki, K., Yamaguchi, K. & Miki, K. (1996). Structure, mapping and expression of a human NOR-1 gene, the third member of the Nur77/NGFI-B family. Biochimica et Biophysica Acta 1308, 205-214.[Medline]
Osame, M., Usuku, K., Izumo, S., Ijichi, N., Amitani, H., Igata, A., Matsumoto, M. & Tara, M. (1986). HTLV-I associated myelopathy, a new clinical entity. Lancet i, 10311032.
Pise-Masison, C. A., Dittmer, J., Clemens, K. E. & Brady, J. N. (1997). Physical and functional interaction between the human T-cell lymphotropic virus type 1 Tax1 protein and the CCAAT binding protein NF-Y. Molecular and Cellular Biology 17, 1236-1243.
Poiesz, B. J., Ruscetti, F. W., Gazdar, A. F., Bunn, P. A., Minna, J. D. & Gallo, R. C. (1980). Detection and isolation of type C retrovirus particles from fresh and cultured lymphocytes of a patient with cutaneous T-cell lymphoma. Proceedings of the National Academy of Sciences, USA 77, 7415-7419.
Reddy, T. R., Tang, H., Li, X. & Wong-Staal, F. (1997). Functional interaction of the HTLV-1 transactivator Tax with activating transcription factor-4 (ATF4). Oncogene 14, 2785-2792.[Medline]
Ryder, K., Lanahan, A., Perez-Albuerne, E. & Nathans, D. (1989). jun-D: a third member of the jun gene family. Proceedings of the National Academy of Sciences, USA 86, 1500-1503.
Ryseck, R. P., Macdonald-Bravo, H., Mattei, M. G., Ruppert, S. & Bravo, R. (1989). Structure, mapping and expression of a growth factor inducible gene encoding a putative nuclear hormonal binding receptor. EMBO Journal 8, 3327-3335.[Medline]
Salahuddin, S. Z., Markham, P. D., Wong-Staal, F., Franchini, G., Kalyanaraman, V. S. & Gallo, R. C. (1983). Restricted expression of human T-cell leukemialymphoma virus (HTLV) in transformed human umbilical cord blood lymphocytes. Virology 129, 51-64.[Medline]
Smith, M. R. & Greene, W. C. (1990). Identification of HTLV-I tax trans-activator mutants exhibiting novel transcriptional phenotypes. Genes & Development 4, 1875-1885.
Suzuki, T., Hirai, H., Fujisawa, J. I., Fujita, T. & Yoshida, M. (1993a). A trans-activator Tax of human T-cell leukemia virus type 1 binds to NF-
B p50 and serum response factor (SRF) and associates with enhancer DNAs of the NF-
B site and CArG box. Oncogene 8, 2391-2397.[Medline]
Suzuki, T., Fujisawa, J. I., Toita, M. & Yoshida, M. (1993b). The trans-activator Tax of human T-cell leukemia virus type 1 (HTLV-1) interacts with cAMP-responsive element (CRE) binding and CRE modulator proteins that bind to the 21-base-pair enhancer of HTLV-1. Proceedings of the National Academy of Sciences, USA 90, 610-614.
Tanaka, Y., Yoshida, A., Takayama, Y., Tsujimoto, H., Tsujimoto, A., Hayami, M. & Tozawa, H. (1990). Heterogeneity of antigen molecules recognized by anti-tax1 monoclonal antibody Lt-4 in cell lines bearing human T cell leukemia virus type I and related retroviruses. Japanese Journal of Cancer Research 81, 225-231.[Medline]
Trejo, S. R., Fahl, W. E. & Ratner, L. (1996). c-sis/PDGF-B promoter transactivation by the Tax protein of human T-cell leukemia virus type 1. Journal of Biological Chemistry 271, 14584-14590.
Trejo, S. R., Fahl, W. E. & Ratner, L. (1997). The Tax protein of human T-cell leukemia virus type 1 mediates the transactivation of the c-sis/platelet-derived growth factor-B promoter through interactions with the zinc finger transcription factors Sp1 and NGFI-A/Egr-1. Journal of Biological Chemistry 272, 27411-27421.
Tsuchiya, H., Fujii, M., Niki, T., Tokuhara, M., Matsui, M. & Seiki, M. (1993). Human T-cell leukemia virus type 1 Tax activates transcription of the human fra-1 gene through multiple cis elements responsive to transmembrane signals. Journal of Virology 67, 7001-7007.
Uemura, H., Mizokami, A. & Chang, C. S. (1995). Identification of a new enhancer in the promoter region of the human TR3 orphan receptor gene, a member of the steroid receptor superfamily. Journal of Biological Chemistry 270, 5427-5433.
Velcich, A. & Ziff, E. B. (1990). Functional analysis of an isolated fos promoter element with AP-1 site homology reveals cell type-specific transcriptional properties. Molecular and Cellular Biology 10, 6273-6282.
Watson, M. A. & Milbrandt, J. (1989). The NGFI-B gene, a transcriptionally inducible member of the steroid receptor gene superfamily: genomic structure and expression in rat brain after seizure induction. Molecular and Cellular Biology 9, 4213-4219.
Williams, G. T. & Lau, L. F. (1993). Activation of the inducible orphan receptor gene nur77 by serum growth factors: dissociation of immediate-early and delayed-early responses. Molecular and Cellular Biology 13, 6124-6136.
Woronicz, J. D., Calnan, B., Ngo, V. & Winoto, A. (1994). Requirement for the orphan steroid receptor Nur77 in apoptosis of T-cell hybridomas. Nature 367, 277-281.[Medline]
Yoon, J. K. & Lau, L. F. (1993). Transcriptional activation of the inducible nuclear receptor gene nur77 by nerve growth factor and membrane depolarization in PC12 cells. Journal of Biological Chemistry 268, 9148-9155.
Yoon, J. K. & Lau, L. F. (1994). Involvement of JunD in transcriptional activation of the orphan receptor gene nur77 by nerve growth factor and membrane depolarization in PC12 cells. Molecular and Cellular Biology 14, 7731-7743.
Yoshida, M. (1996). Multiple targets of HTLV-1 for dysregulation of host cells. Seminars in Virology 7, 349-360.
Zhao, L. J. & Giam, C. Z. (1992). Human T-cell lymphotropic virus type I (HTLV-I) transcriptional activator, Tax, enhances CREB binding to HTLV-I 21-base-pair repeats by proteinprotein interaction. Proceedings of the National Academy of Sciences, USA 89, 7070-7074.
Received 31 March 1999;
accepted 9 August 1999.
This article has been cited by other articles:
![]() |
G P Taylor Molecular aspects of HTLV-I infection and adult T-cell leukaemia/lymphoma J. Clin. Pathol., December 1, 2007; 60(12): 1392 - 1396. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Martinez-Gonzalez and L. Badimon The NR4A subfamily of nuclear receptors: new early genes regulated by growth factors in vascular cells Cardiovasc Res, February 15, 2005; 65(3): 609 - 618. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Waldele, G. Schneider, T. Ruckes, and R. Grassmann Interleukin-13 Overexpression by Tax Transactivation: a Potential Autocrine Stimulus in Human T-Cell Leukemia Virus-Infected Lymphocytes J. Virol., June 15, 2004; 78(12): 6081 - 6090. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. W. Tullai, M. E. Schaffer, S. Mullenbrock, S. Kasif, and G. M. Cooper Identification of Transcription Factor Binding Sites Upstream of Human Genes Regulated by the Phosphatidylinositol 3-Kinase and MEK/ERK Signaling Pathways J. Biol. Chem., May 7, 2004; 279(19): 20167 - 20177. [Abstract] [Full Text] [PDF] |
||||
![]() |
J.-W. Choi, S. C. Park, G. H. Kang, J. O. Liu, and H.-D. Youn Nur77 Activated by Hypoxia-Inducible Factor-1{alpha} Overproduces Proopiomelanocortin in von Hippel-Lindau-Mutated Renal Cell Carcinoma Cancer Res., January 1, 2004; 64(1): 35 - 39. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Chen, S. Ma, B. Li, T. Fink, V. Zachar, M. Takahashi, J. Cuttichia, L.-C. Tsui, P. Ebbesen, and X. Liu Transcriptional activation of immediate-early gene ETR101 by human T-cell leukaemia virus type I Tax J. Gen. Virol., December 1, 2003; 84(12): 3203 - 3214. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Basbous, C. Arpin, G. Gaudray, M. Piechaczyk, C. Devaux, and J.-M. Mesnard The HBZ Factor of Human T-cell Leukemia Virus Type I Dimerizes with Transcription Factors JunB and c-Jun and Modulates Their Transcriptional Activity J. Biol. Chem., October 31, 2003; 278(44): 43620 - 43627. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. O. Kim, K. Ono, P. S. Tobias, and J. Han Orphan Nuclear Receptor Nur77 Is Involved in Caspase-independent Macrophage Cell Death J. Exp. Med., June 2, 2003; 197(11): 1441 - 1452. [Abstract] [Full Text] [PDF] |
||||
![]() |
K.-H. Song, K. Lee, and H.-S. Choi Endocrine Disrupter Bisphenol A Induces Orphan Nuclear Receptor Nur77 Gene Expression and Steroidogenesis in Mouse Testicular Leydig Cells Endocrinology, June 1, 2002; 143(6): 2208 - 2215. [Abstract] [Full Text] [PDF] |
||||
![]() |
K.-H. Song, J.-I. Park, M.-O. Lee, J. Soh, K. Lee, and H.-S. Choi LH Induces Orphan Nuclear Receptor Nur77 Gene Expression in Testicular Leydig Cells Endocrinology, December 1, 2001; 142(12): 5116 - 5123. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| INT J SYST EVOL MICROBIOL | MICROBIOLOGY | J GEN VIROL |
| J MED MICROBIOL | ALL SGM JOURNALS | |