J Gen Virol Try Microbiology Online
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via CrossRef
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Petrik, J.
Right arrow Articles by Alexander, G. J. M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Petrik, J.
Right arrow Articles by Alexander, G. J. M.
Agricola
Right arrow Articles by Petrik, J.
Right arrow Articles by Alexander, G. J. M.
Journal of General Virology (1999), 80, 3109-3113.
© 1999 Society for General Microbiology


Animal: RNA Viruses

Human hepatic glyceraldehyde-3-phosphate dehydrogenase binds to the poly(U) tract of the 3' non-coding region of hepatitis C virus genomic RNA

Juraj Petrik1, Hayley Parkerb,1 and Graeme J. M. Alexander2

Departments of Haematology1 and Medicine2, University of Cambridge, School of Clinical Medicine, Cambridge, UK

Author for correspondence: Juraj Petrik. Present address: Edinburgh and South East Scotland Blood Transfusion Service, Royal Infirmary, Lauriston Place, Edinburgh EH3 9HB, UK.Fax +44 131 5365352.


   Abstract
TOP
Abstract
Main text
References
 
The unique poly(U/UC) tract, the middle part of the tripartite 3' non-coding region (3'NCR) of hepatitis C virus (HCV) genomic RNA, may represent a recognition signal for the HCV replicase complex. In this study, several proteins binding specifically to immobilized ribooligonucleotide r(U)25 mimicking this structure were identified using cytosolic extracts from HCV-negative or -positive liver explants, and a prominent 36 kDa protein was studied further. Competition experiments including homoribopolymers revealed binding affinities in the order: oligo/poly(U)>>(A)>>(C)>>(G). The protein was identified as glyceraldehyde-3-phosphate dehydrogenase (GAPDH), a multifunctional protein known to bind RNA. GAPDH bound efficiently to the full-length HCV RNA and binding to various 3'NCR constructs revealed critical dependence upon the presence of the middle part of the 3'NCR. Polypyrimidine tract-binding protein, described previously to bind the 3'NCR, did not bind efficiently to the middle part of 3'NCR and was captured from liver extracts in considerably smaller quantities.


   Main text
TOP
Abstract
Main text
References
 
The mechanisms underlying the development of chronic hepatitis following hepatitis C virus (HCV) infection remain unclear, with little known about replication of the 9·4 kb plus-polarity HCV RNA genome. The lack of a robust in vitro HCV replication system is one reason for this lack of clarity. HCV encodes three or four structural and six or seven non-structural (NS) proteins, which may interact with viral RNA (e.g. core protein; non-structural protein NS3 with protease, NTPase and helicase activities; NS4b and NS5a, components of the replicase complex; and NS5b, the RNA-dependent RNA polymerase) (Clarke, 1997Down ; Major & Feinstone, 1997Down ). The tripartite 3' non-coding region (3'NCR) of HCV RNA (Tanaka et al., 1995Down ; Kolykhalov et al., 1996Down ) is unique among viruses, containing a variable length poly(U/UC) tract. It is a candidate for sequence/structural recognition and/or assembly signal for components of the replicase complex, which is usually located in the 3'NCR of positive-strand genomic RNA viruses and interacts with viral and cellular proteins constituting the complex (Kusov et al., 1996Down ; Yu & Leibowitz, 1995Down ; Todd et al., 1995Down ).

Several cellular proteins interacting with HCV RNA 3'NCR were identified in extracts of uninfected or untransfected cell lines using UV-cross-linking or gel-retardation techniques and one has been characterized repeatedly as polypyrimidine tract-binding protein (PTB) (Tsuchihara et al., 1997Down ; Ito & Lai, 1997Down , 1999Down ; Chung & Kaplan, 1999Down ). We used an alternative RNA capture system (Petrik et al., 1997Down ), with immobilized ribooligonucleotides or in vitro RNA transcripts corresponding to various combinations of the 3'NCR components and modified to bind proteins from HCV-infected or control cytosolic liver explant extracts.

Liver tissue (D. G. D. Wight), stored at -70 °C, prepared with ice-cold homogenization buffer (0·3 M sucrose, 4 mM CaCl2, 1 mM PMSF) and a Dounce homogenizer, was centrifuged at 300 g (pellet discarded), 1600 g (nuclear pellet) and 10000 g resulting in a cytosolic extract (supernatant). Total protein concentration was measured and aliquots containing usually 25 µg of total protein were used for capture.

Initial experiments targeted the middle part of tripartite 3'NCR [poly(U/UC) tract] mimicked by a 5' biotinylated ribooligonucleotide r(U)25 [synthesized with its counterpart r(A)25 in the MRC, LMB, Cambridge, UK] immobilized on streptavidine-coated paramagnetic particles (S-PMP; Promega). After washing and r(U)25-binding, the S-PMP were resuspended in 2x TTGED (20 mM Tris–HCl pH 8·0, 0·01% Triton X-100, 10% glycerol, 1 mM EDTA, 1 mM DTT, 1 mM PMSF) containing 100 mM NaCl unless specified otherwise. An equal volume of the cytoplasmic extract diluted with homogenization buffer was added. After 30 min incubation at 4 °C with gentle mixing and two 5 min washing steps with 1x TTGED–50 mM NaCl, bound proteins were eluted with SDS–PAGE loading buffer (Novex), by heating for 10 min at 70 °C and analysed on Bis–Tris NuPage gels (Novex; 10%) with Mes running buffer. Eluted proteins were detected by silver staining.

Fig. 1Down shows r(U)25-captured proteins from cytosolic extracts of two controls and three HCV-positive liver explants. There were at least six proteins binding to r(U)25 specifically compared to background captured on S-PMP without ligand. All the proteins were cellular since they were also present in control samples.



View larger version (92K):
[in this window]
[in a new window]
 
Fig. 1. r(U)25-capture of proteins from HCV-positive and control liver explants. (a) SDS–PAGE and silver staining of proteins captured specifically on 0·7 pmol per sample of biotinylated r(U)25 S-PMP from cytosolic extracts of control (lanes 1, 2) or HCV-positive (lanes 3–5) liver explants. A prominent protein chosen for further analysis (•) co-migrated with the 36 kDa molecular mass marker (lane M). Asterisks mark proteins down-regulated and arrows mark those up-regulated in HCV-positive samples. (b) An example of a capture background on S-PMP without immobilized capture probe.

 
The prominent r(U)25-binding 36 kDa protein was studied in more detail. In order to determine its binding specificity, protein capture was undertaken using biotinylated r(U)25 and its complement, r(A)25, immobilized on S-PMP, using cytosolic extract from a representative sample (Fig. 2Down). The 36 kDa protein bound r(A)25 less efficiently than r(U)25. In competition experiments in which cytosolic extract was preincubated for 15 min at 4 °C with 50-fold excess of ribohomopolymers [poly(A), (C), (G), (U); NCI] prior to capture, poly(U) and poly(A) abrogated the 36 kDa protein capture almost completely, the effect of poly(C) was partial and that of poly(G) minimal. Comparison of the amount of the 36 kDa protein binding to equimolar quantities of r(U)25 and r(A)25 respectively revealed a higher affinity of this protein for r(U)25. We concluded that the homooligomer/polymer binding affinities of the 36 kDa protein were oligo/poly(U)>>(A)>>(C)>>(G).



View larger version (80K):
[in this window]
[in a new window]
 
Fig. 2. The effect of pre-incubation with ribohomopolymers on capture of the 36 kDa protein. Proteins were captured using 0·7 pmol per sample of biotinylated r(U)25 and r(A)25 immobilized on S-PMP, after pre-incubation of a cytosolic extract with 50-fold excess of ribohomopolymers as indicated, and analysed by SDS–PAGE and silver staining. M, molecular mass markers.

 
To identify the 36 kDa protein, N-terminal sequencing (Nucleic Acid and Protein Synthesis Facility, Department of Biochemistry, University of Cambridge, UK) was carried out. A complete match of the first 19 residues identified the protein as human hepatic glyceraldehyde-3-phosphate dehydrogenase (GAPDH) (Petrik et al., 1998Down ), a multifunctional cellular protein occurring in several molecular forms and numerous isoforms with varied function (Glaser & Gross, 1995Down ; Saunders et al., 1999Down ). GAPDH, a key enzyme of glycolysis, interacts with other proteins, including actin (Mejean et al., 1989Down ) and tubulin (Huitorel & Pantaloni, 1985Down ), as well as RNA, including viral RNAs (Singh & Green, 1993Down ; Nagy & Rigby, 1995Down ; De et al., 1996Down ), and exhibits RNA helix-destabilizing activity (Karpel & Burchard, 1981Down ; Schultz et al., 1996Down ).

To determine GAPDH binding specificity we prepared plasmid constructs containing various combinations of 3'NCR parts. Fragments corresponding to HCV 3'NCR region 1 (3'NCR1), a consensus sequence of the 40 nucleotide region following the stop codon, from several isolates (Yamada et al., 1996Down ) and the 101 nucleotide conserved region (3'NCR3) were cloned after annealing synthetic oligonucleotides containing extra sequences, complementary to the overhangs of HindIII/EcoRI-digested TOPO 2.1 plasmid. For the amplification of the remaining five regions of 3'NCR we used DNA of plasmid p90/HCVFL long pU (p90) containing a full-length HCV cDNA clone (Kolykhalov et al., 1997Down ; provided by C. Rice). PCR products were subsequently cloned into a PCR 2.1 TOPO vector (Invitrogen). Primers used: for amplification of complete 3'NCR1+2+3 containing a short extra NS5b sequence, primers C3S2 (TGTGCGTCGTGCCGCGACCGCACG) and 4158, corresponding to the 3' end of the conserved 3'NCR3 region (ACATGATCTGCAGAGAGGCC); for amplification of complete 3'NCR1+2+3, primers 2546 (AGGTTGGGGTAAACACTCCG) and 4158; for amplification of 3'NCR1+2, primers 2546 and 2548 (CACCATTAAAGAAGGAAGGA); for amplification of 3'NCR2+3, primers 2547 (GCCATTTCCTGTTTTTTTTT) and 4158; for amplification of 3'NCR2, primers 2547 and 2548. As a control we used plasmid containing a 120 nucleotide sequence of 18S RNA. For in vitro transcription plasmid p90 was digested with MluI and all other plasmids with HindIII. Transcription used the T7 and T3 Ampliscribe kit (Epicentre), including or omitting biotin-UTP (Boehringer Mannheim, 1/20 of the concentration of other NTPs) in the ribonucleotide mix. Biotinylated RNA transcripts (0·7 pmol unless stated otherwise) were used for protein capture and non-biotinylated transcripts for competition experiments. For protein capture, in addition to TTGED–50 mM NaCl buffer, we also used HTGEM (10 mM HEPES pH 7·9, 0·1 mM EDTA, 0·01% Triton X-100, 10% glycerol, 2 mM MgCl2) containing 25 mM KCl, similar to buffers used for gel-retardation or UV-cross-linking studies (Furuya & Lai, 1993Down ; Kusov et al., 1996Down ; Schultz et al., 1996Down ; Ito & Lai, 1997Down ). GAPDH capture with both buffer systems was similar.

Apart from binding to r(U)25 (Fig. 3aDown, lane 4), GAPDH bound strongly to all capture probes containing 3'NCR2 (lanes 3, 6–9), but not to 3'NCR1 or 3'NCR3 or control rRNA (Fig. 3aDown, lanes 2, 5, 11). GAPDH also bound strongly to the full-length HCV RNA transcript. The binding was specific, with inhibition of capture on the complete 3'NCR1+2+3 probe specifically by a 10-fold excess of non-biotinylated 3'NCR transcripts containing 3'NCR2 (lanes 3, 6–9 in Fig. 3dDown). Binding was also inhibited by r(U)25 oligo (Fig. 3dDown, lane 4) and by full-length HCV RNA (Fig. 3dDown, lane 10). Amounts of S-PMP, capture probe and cytosolic extract were reduced in this experiment by a factor of five in order to include a 10-fold excess of some competing probes. Correspondingly, the GAPDH bands in Fig. 3(d)Down are weaker than in Fig. 3(c)Down. Immunodetection after protein transfer onto a PVDF membrane (Immobilon P; Millipore) using a Novex gel/transfer system and incubation with anti-GAPDH monoclonal antibody (Chemicon) and anti-mouse IgG–HRP conjugate (Sigma) confirmed the identity of captured GAPDH. After washing the membrane was developed using the ECL system (Amersham) and exposed to X-ray film (Fig. 3cDown). Only oligo/poly(U)-containing capture probes bound GAPDH.



View larger version (81K):
[in this window]
[in a new window]
 
Fig. 3. Liver protein capture with various probes. SDS–PAGE of proteins captured from a cytosolic extract on S-PMP without a probe (lane 1) or with approximately 0·7 pmol of immobilized in vitro RNA transcripts of 3'NCR1 (lane 2); 3'NCR2 (lane 3); r(U)25 (lane 4); 3'NCR3 (lane 5); 3'NCR1+2 (lane 6); 3'NCR2+3 (lane 7); 3'NCR1+2+3 with extra NS5 sequences (lane 8); 3'NCR1+2+3 (lane 9); full-length HCV RNA (lane 10); control RNA, a fragment of the 18S rRNA (lane 11). (a) Silver-stained gel. (b) Western blot of identical samples detected using polyclonal rabbit PTB antibody (Hunt & Jackson, 1999Down ) and anti-rabbit IgG–HRP conjugate (Sigma). (c) Western blot of identical samples detected using the anti-GAPDH monoclonal antibody (Chemicon) and anti-mouse IgG–HRP conjugate (Sigma). (d) Capture on biotinylated immobilized 3'NCR1+2+3 RNA (approximately 0·14 pmol per sample). Reactions were prepared without competing non-biotinylated transcript (lane 1) or in the presence of 10-fold excess of competing non-biotinylated transcripts. Competing RNAs in lanes 2–11 correspond to their biotinylated counterparts used for capture in (a)–(c). Detection as in (c).

 
This finding contrasts with PTB (Fig. 3bUp), which has been described previously to bind to HCV 3'NCR and, more specifically, to loops SL2 and SL3 of the conserved 3'NCR3 (Ito & Lai, 1997Down ; Chung & Kaplan, 1999Down ). Using polyclonal rabbit PTB antibody (R. J. Jackson and S. L. Hunt) and anti-rabbit–HRP (Sigma), PTB binding to complete 3'NCR1+2+3 and 3'NCR2+3 (Fig. 3bUp, lanes 9 and 7) but not to r(U)25 or 3'NCR2 (Fig. 3bUp, lanes 3 and 4) was found. PTB did not seem to bind a full-length HCV RNA transcript (Fig. 3bUp, lane 10), but at the same time we failed to detect binding to the conserved 3'NCR3. However, the quantities of PTB captured from liver explant extracts were generally far smaller compared to GAPDH (Fig. 3aUp; also, the exposure times needed for chemiluminescent detection of GAPDH and PTB on identical immunoblots shown in Fig. 3bUp and cUp differed considerably), perhaps due to the fact that extracts were cytosolic and PTB concentrations in extracts from cell lines and liver explants may differ.

The binding of PTB and another protein (p35) to the HCV 3'NCR was described in detail recently. The binding pattern of p35 described by Luo (1999)Down was similar to that for GAPDH described herein, but p35 was not characterized further. Gontarek et al. (1999)Down identified the 3'NCR-binding p35 protein detected by UV-cross-linking from HepG2 extracts as heterogeneous nuclear ribonucleoprotein C (hnRNP C). This is slightly surprising as hnRNP C (C1/C2) has a molecular mass of 41–43 kDa (Dreyfuss et al., 1993Down ; Sella et al., 1999Down ) and is one of few hnRNPs which are confined to the nucleus (Dreyfuss et al., 1993Down ). In our cytosolic liver explant extracts the nuclei were removed and we should not have detected hnRNP C even if it had affinity to HCV 3'NCR. Similarly, the procedure used by Gontarek et al. (1999)Down should have provided a post-nuclear supernatant. Nevertheless, in some capture experiments we observed another protein of similar size obscured partly by GAPDH. As GAPDH has a molecular mass of 36 kDa, there may be another binding protein with a molecular mass of approximately 35 kDa.

In this paper we utilized human liver explant extracts to capture proteins, which is a more authentic system than using extracts from uninfected cell lines and, in the absence of a reproducible in vitro HCV replication system, represents an opportunity to compare HCV-positive and control samples. All the captured proteins were of cellular origin, present in both HCV-positive and control samples, but some were expressed at different levels. This finding needs to be confirmed in a larger series of samples and at the RNA level. Streptavidine/biotin-mediated capture on paramagnetic particles has advantages over UV-cross-linking, allowing more rigorous washing procedures and more flexibility in downstream processing.

GAPDH was shown to interact with viral RNAs (De et al., 1996Down ; Schultz et al., 1996Down ). It is intriguing that there is abundant cellular protein in cytosolic extracts of human liver tissue, which binds tightly to the HCV 3'NCR structure close to, or at, the replicase complex assembly site and that this protein has been shown to possess RNA helix destabilizing activity.

The replicase complex should contain viral proteins, most notably NS5b (RNA-dependent RNA polymerase) and NS3, which has RNA helicase activity. Both of these proteins have also been shown to bind tightly to poly(U) (Kanai et al., 1995Down ; Behrens et al., 1996Down ; Morgenstern et al., 1997Down ) and the relative order of polynucleotide affinity for NS3 helicase in the latter study [poly(U)>>poly(A)>>poly(C)>>poly(G)] was identical to that demonstrated for GAPDH. However, under the conditions used in this study we were unable to detect captured proteins present exclusively in HCV-positive extracts. It is possible that differences between the concentrations of abundant cellular proteins such as GAPDH or PTB and viral proteins would be extensive.

The physiological relevance of proteins binding to 3'NCR including GAPDH and their effect on minus-strand RNA synthesis need to be assessed in vivo . In the chimpanzee model (Yanagi et al., 1999Down ) the importance of the poly(U/UC) together with the conserved region was confirmed using various HCV RNA mutants. Chimpanzees inoculated with RNA mutants lacking either of these regions failed to develop infection. Further, more detailed studies of viral–cellular protein interactions involved in HCV RNA replication may provide a suitable target for therapeutic intervention.


   Acknowledgments
 
The authors wish to thank Dr C. Rice (Washington University, St Louis, MO, USA) for the plasmid p90 containing full-length HCV cDNA, D. G. D. Wight (Department of Pathology, University of Cambridge, UK) for providing liver explants and R. J. Jackson and S. L. Hunt (Department of Biochemistry, University of Cambridge, UK) for providing the PTB antibody.


   Footnotes
 
b Present address: Clinical Virology & Surrogates Unit, GlaxoWellcome R&D, Medicines Research Centre, Gunnels Wood Road, Stevenage, Herts SG1 2NY, UK. Back


   References
TOP
Abstract
Main text
References
 
Behrens, S.-E., Tomei, L. & De Francesco, R. (1996). Identification and properties of the RNA-dependent RNA polymerase of hepatitis C virus. EMBO Journal 15, 12-22.[Medline]

Chung, R. T. & Kaplan, L. M. (1999). Heterogeneous nuclear ribonucleoprotein I (hnRNP-I/PTB) selectively binds to the conserved 3' terminus of hepatitis C viral RNA. Biochemical and Biophysical Research Communications 254, 351-362.[Medline]

Clarke, B. (1997). Molecular virology of hepatitis C virus. Journal of General Virology 78, 2397-2410.[Medline]

De, B. P., Gupta, S., Zhao, H., Drazba, J. A. & Banerjee, A. K. (1996). Specific interaction in vitro and in vivo of glyceraldehyde-3-phosphate dehydrogenase and LA protein with cis-acting RNAs of human parainfluenza virus type 3. Journal of Biological Chemistry 271, 24728-24735.[Abstract/Free Full Text]

Dreyfuss, G., Matunis, M. J., Pinol-Roma, S. & Burd, C. G. (1993). hnRNP proteins and the biogenesis of mRNA. Annual Review of Biochemistry 62, 289-321.[Medline]

Furuya, T. & Lai, M. M. C. (1993). Three different cellular proteins bind to complementary sites on the 5'-end-positive and 3'-end-negative strands of mouse hepatitis virus RNA. Journal of Virology 67, 7215-7222.[Abstract/Free Full Text]

Glasser, P. E. & Gross, R. W. (1995). Rapid plasmenylethanolamine-selective fusion of membrane bilayers catalyzed by an isoform of glyceraldehyde-3-phosphate dehydrogenase: discrimination between glycolytic and fusogenic roles of individual isoforms. Biochemistry 34, 12193-12203.[Medline]

Gontarek, R. R., Gutshall, L. L., Herold, K. M., Tsai, J., Sathe, G. M., Mao, J., Prescott, C. & Del Vecchio, A. M. (1999). hnRNP C and polypyrimidine tract-binding protein specifically interact with the pyrimidine-rich region within the 3'NTR of the HCV RNA genome. Nucleic Acids Research 27, 1457-1463.[Abstract/Free Full Text]

Huitorel, P. & Pantaloni, D. (1985). Bundling of microtubules by glyceraldehyde-3-phosphate dehydrogenase and its modulation by ATP. European Journal of Biochemistry 150, 265-269.

Hunt, S. L. & Jackson, R. J. (1999). Polypyrimidine-tract binding protein (PTB) is necessary, but not sufficient, for efficient internal initiation of translation of human rhinovirus-2 RNA. RNA 5, 344-359.[Abstract]

Ito, T. & Lai, M. M. C. (1997). Determination of the secondary structure of and cellular protein binding to the 3'-untranslated region of the hepatitis C virus RNA genome. Journal of Virology 71, 8698-8706.[Abstract]

Ito, T. & Lai, M. M. C. (1999). An internal polypyrimidine-tract-binding protein-binding site in the hepatitis C virus RNA attenuates translation, which is relieved by the 3'-untranslated sequence. Virology 254, 288-296.[Medline]

Kanai, A., Tanabe, K. & Kohara, M. (1995). Poly(U) binding activity of hepatitis C virus NS3 protein, a putative RNA helicase. FEBS Letters 376, 221-224.[Medline]

Karpel, R. L. & Burchard, A. C. (1981). A basic isozyme of yeast glyceraldehyde-3-phosphate dehydrogenase with nucleic acid helix-destabilizing activity. Biochimica et Biophysica Acta 654, 256-267.[Medline]

Kolykhalov, A. A., Feinstone, S. M. & Rice, C. M. (1996). Identification of a highly conserved sequence element at the 3' terminus of hepatitis C virus genome RNA. Journal of Virology 70, 3363-3371.[Abstract]

Kolykhalov, A. A., Agapov, E. V., Blight, K. J., Mihalik, K., Feinstone, S. M. & Rice, C. M. (1997). Transmission of hepatitis C by intrahepatic inoculation with transcribed RNA. Science 277, 570-574.[Abstract/Free Full Text]

Kusov, Y., Weitz, M., Dollenmeier, G., Gauss-Muller, V. & Siegl, G. (1996). RNA–protein interactions at the 3' end of the hepatitis A virus RNA. Journal of Virology 70, 1890-1897.[Abstract]

Luo, G. (1999). Cellular proteins bind to the poly(U) tract of the 3' untranslated region of hepatitis C virus RNA genome. Virology 256, 105-118.[Medline]

Major, M. E. & Feinstone, S. M. (1997). The molecular virology of hepatitis C. Hepatology 25, 1527-1538.[Medline]

Mejean, C., Pons, F., Benyamin, Y. & Roustan, C. (1989). Antigenic probes locate binding sites for the glycolytic enzymes glyceraldehyde-3-phosphate dehydrogenase, aldolase and phosphofructokinase in the actin monomer in microfilaments. Biochemical Journal 264, 671-677.[Medline]

Morgenstern, K. A., Landro, J. A., Hsiao, K., Lin, C., Gu, Y., Su, M. S.-S. & Thomson, J. A. (1997). Polynucleotide modulation of the protease, nucleoside triphosphatase, and helicase activities of a hepatitis C virus NS3–NS4A complex isolated from transfected COS cells. Journal of Virology 71, 3767-3775.[Abstract]

Nagy, E. & Rigby, W. F. C. (1995). Glyceraldehyde-3-phosphate dehydrogenase selectively binds AU-rich RNA in the NAD+-binding region (Rossmann fold). Journal of Biological Chemistry 270, 2755-2763.[Abstract/Free Full Text]

Petrik, J., Pearson, G. M. J. & Allain, J.-P. (1997). High throughput PCR detection of HCV based on semiautomated multisample RNA capture. Journal of Virological Methods 64, 147-159.[Medline]

Petrik, J., Parker, H. & Alexander, G. J. M. (1998). Interactions of hepatitis C virus RNA non-coding regions with liver cell proteins. Hepatology 28, 363A (Abstract).

Saunders, P. A., Chen, R. W. & Chuang, D. M. (1999). Nuclear translocation of glyceraldehyde-3-phosphate dehydrogenase isoforms during neuronal apoptosis. Journal of Neurochemistry 72, 925-932.[Medline]

Schultz, D. E., Hardin, C. C. & Lemon, S. M. (1996). Specific interaction of glyceraldehyde 3-phosphate dehydrogenase with the 5'-nontranslated RNA of hepatitis A virus. Journal of Biological Chemistry 271, 14134-14142.[Abstract/Free Full Text]

Sella, O., Gerlitz, G., Le, S. Y. & Elroy-Stein, O. (1999). Differentiation-induced internal translation of c-sis mRNA: analysis of the cis elements and their differentiation-linked binding to the hnRNP C protein. Molecular and Cellular Biology 19, 5429-5440.[Abstract/Free Full Text]

Singh, R. & Green, M. R. (1993). Sequence-specific binding of transfer RNA by glyceraldehyde-3-phosphate dehydrogenase. Science 259, 365-368.[Abstract/Free Full Text]

Tanaka, T., Kato, N., Cho, M.-J. & Shimotohno, K. (1995). A novel sequence found at the 3' terminus of hepatitis C virus genome. Biochemical and Biophysical Research Communications 215, 744-749.[Medline]

Todd, S., Nguyen, J. H. C. & Semler, B. L. (1995). RNA–protein interactions directed by the 3' end of human rhinovirus genomic RNA. Journal of Virology 69, 3605-3614.[Abstract]

Tsuchihara, K., Tanaka, T., Hijikata, M., Kuge, S., Toyoda, H., Nomoto, A., Yamamoto, N. & Shimotohno, K. (1997). Specific interaction of polypyrimidine tract-binding protein with the extreme 3'-terminal structure of hepatitis C virus genome, the 3'X. Journal of Virology 71, 6720-6726.[Abstract]

Yamada, N., Tanihara, K., Takada, A., Yorihuzi, T., Tsutsumi, M., Shimomura, H., Tsuji, T. & Date, T. (1996). Genetic organization and diversity of the 3' noncoding region of the hepatitis C virus genome. Virology 223, 255-261.[Medline]

Yanagi, M., St Claire, M., Emerson, S. U., Purcell, R. H. & Bukh, J. (1999). In vivo analysis of the 3' untranslated region of the hepatitis C virus after in vitro mutagenesis of an infectious cDNA clone. Proceedings of the National Academy of Sciences, USA 96, 2291-2295.[Abstract/Free Full Text]

Yu, W. & Leibowitz, J. L. (1995). Specific binding of host cellular proteins to multiple sites within the 3' end of mouse hepatitis virus genomic RNA. Journal of Virology 69, 2016-2023.[Abstract]

Received 1 April 1999; accepted 5 August 1999.


This article has been cited by other articles:


Home page
Mol Cancer ResHome page
Y. Zhou, X. Yi, J. B. Stoffer, N. Bonafe, M. Gilmore-Hebert, J. McAlpine, and S. K. Chambers
The Multifunctional Protein Glyceraldehyde-3-Phosphate Dehydrogenase Is Both Regulated and Controls Colony-Stimulating Factor-1 Messenger RNA Stability in Ovarian Cancer
Mol. Cancer Res., August 1, 2008; 6(8): 1375 - 1384.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
S. You and C. M. Rice
3' RNA Elements in Hepatitis C Virus Replication: Kissing Partners and Long Poly(U)
J. Virol., January 1, 2008; 82(1): 184 - 195.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
G. Randall, M. Panis, J. D. Cooper, T. L. Tellinghuisen, K. E. Sukhodolets, S. Pfeffer, M. Landthaler, P. Landgraf, S. Kan, B. D. Lindenbach, et al.
Cellular cofactors affecting hepatitis C virus infection and replication
PNAS, July 31, 2007; 104(31): 12884 - 12889.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. ProteomicsHome page
D. Harris, Z. Zhang, B. Chaubey, and V. N. Pandey
Identification of Cellular Factors Associated with the 3'-Nontranslated Region of the Hepatitis C Virus Genome
Mol. Cell. Proteomics, June 1, 2006; 5(6): 1006 - 1018.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
J. Graff, H. Nguyen, C. Kasorndorkbua, P. G. Halbur, M. St. Claire, R. H. Purcell, and S. U. Emerson
In Vitro and In Vivo Mutational Analysis of the 3'-Terminal Regions of Hepatitis E Virus Genomes and Replicons
J. Virol., January 15, 2005; 79(2): 1017 - 1026.
[Abstract] [Full Text] [PDF]


Home page
J. Gen. Virol.Home page
N. El-Hage and G. Luo
Replication of hepatitis C virus RNA occurs in a membrane-bound replication complex containing nonstructural viral proteins and RNA
J. Gen. Virol., October 1, 2003; 84(10): 2761 - 2769.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
L. J. Stuyver, T. R. McBrayer, P. M. Tharnish, A. E. A. Hassan, C. K. Chu, K. W. Pankiewicz, K. A. Watanabe, R. F. Schinazi, and M. J. Otto
Dynamics of Subgenomic Hepatitis C Virus Replicon RNA Levels in Huh-7 Cells after Exposure to Nucleoside Antimetabolites
J. Virol., October 1, 2003; 77(19): 10689 - 10694.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
E. Evguenieva-Hackenberg, E. Schiltz, and G. Klug
Dehydrogenases from All Three Domains of Life Cleave RNA
J. Biol. Chem., November 22, 2002; 277(48): 46145 - 46150.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
S. K. Nanda and J. L. Leibowitz
Mitochondrial Aconitase Binds to the 3' Untranslated Region of the Mouse Hepatitis Virus Genome
J. Virol., April 1, 2001; 75(7): 3352 - 3362.
[Abstract] [Full Text]


Home page
J. Virol.Home page
T. Pietschmann, V. Lohmann, G. Rutter, K. Kurpanek, and R. Bartenschlager
Characterization of Cell Lines Carrying Self-Replicating Hepatitis C Virus RNAs
J. Virol., February 1, 2001; 75(3): 1252 - 1264.
[Abstract] [Full Text]


Home page
J. Virol.Home page
J. Wood, R. M. Frederickson, S. Fields, and A. H. Patel
Hepatitis C Virus 3'X Region Interacts with Human Ribosomal Proteins
J. Virol., February 1, 2001; 75(3): 1348 - 1358.
[Abstract] [Full Text]


Home page
Cold Spring Harb Symp Quant BiolHome page
J.S. KIEFT, A. GRECH, P. ADAMS, and J.A. DOUDNA
Mechanisms of Internal Ribosome Entry in Translation Initiation
Cold Spring Harb Symp Quant Biol, January 1, 2001; 66(0): 277 - 284.
[Abstract] [PDF]


Home page
J. Virol.Home page
M. Yi, D. E. Schultz, and S. M. Lemon
Functional Significance of the Interaction of Hepatitis A Virus RNA with Glyceraldehyde 3-Phosphate Dehydrogenase (GAPDH): Opposing Effects of GAPDH and Polypyrimidine Tract Binding Protein on Internal Ribosome Entry Site Function
J. Virol., July 15, 2000; 74(14): 6459 - 6468.
[Abstract] [Full Text]


Home page
J. Gen. Virol.Home page
R. Bartenschlager and V. Lohmann
Replication of hepatitis C virus
J. Gen. Virol., July 1, 2000; 81(7): 1631 - 1648.
[Full Text]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via CrossRef
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Petrik, J.
Right arrow Articles by Alexander, G. J. M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Petrik, J.
Right arrow Articles by Alexander, G. J. M.
Agricola
Right arrow Articles by Petrik, J.
Right arrow Articles by Alexander, G. J. M.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
INT J SYST EVOL MICROBIOL MICROBIOLOGY J GEN VIROL
J MED MICROBIOL ALL SGM JOURNALS