|
|
||||||||
Animal: RNA Viruses |
Institute of Virology, Faculty of Veterinary Medicine, University of Zurich, Winterthurerstrasse 266a, 8057 Zurich, Switzerland1
Author for correspondence: Mahender Singh. Present address: Warwick Business School, University of Warwick, Gibbet Hill Road, Coventry CV4 7AL, UK. Fax +44 1203 52 46 43. e-mail M.Singh{at}warwick.ac.uk
| Abstract |
|---|
|
|
|---|
| Main text |
|---|
|
|
|---|
|
The I-1 ORF of PEDV is much smaller than those of BCV and MHV, whereas the combined coding capacity of all three I ORFs of PEDV equals approximately the size of BCV or MHV I ORF. It is, therefore, interesting to determine whether the small sized I ORFs of PEDV are the result of mutations during adaptation and propagation of the wt virus in cell culture. To unravel these possibilities, the 3' 1800 nucleotide (nt) sequence encompassing the entire N gene and the 3' non-translated region of wt PEDV isolate CV777 were determined. Total RNA from gut specimens collected from PEDV (CV777)-infected pigs (Bernasconi, 1996
) was isolated using the total RNA isolation reagent TRIzol (Gibco BRL). First strand cDNA, synthesized using oligo d(T)-tailed P25, was amplified using previously described primers (P23, P24, P25, P32 and P35) (Fig. 1
) and reaction conditions (Bridgen et al., 1993
). P70 was 5' GGAGCTCGTCATTAGTAACCCTA 3', P85 was 5' GGTGCCGATATCTCTCTATGC 3' and P132 was 5' ACAGCTGTTGATGGTGGTGATACG 3'. The blunt-ended PCR products were cloned (Sambrook et al., 1989
) and sequenced (Sanger et al., 1977
). Sequences were analysed using the GCG program (Devereux et al., 1984
).
The wt virus sequences were found to be identical to those of the ca virus. No additional genes were found downstream of the N gene. The three I ORFs were absolutely conserved, with the I-1 ORF starting 55 nt downstream of the N gene AUG. Thus, the propagation of the virus in cell culture did not result in any nucleotide change in this region of the genome. However, previous experiments show that the ca virus is markedly attenuated in virulence for newborn piglets as compared to the wt parent virus (Bernasconi et al., 1995
). Taken together, these observations demonstrate that the genes and gene products encoded within the 3' 1800 nt may not contribute to PEDV attenuation.
As a first step towards identification of the putative gene product of I-1 ORF, I set out to ascertain its coding potential by expressing it under control of the cytomegalovirus (CMV) immediate early promoter. For this purpose, firstly, the 1750 nt of the 3' end of the PEDV genome, including the poly(A) tail (20 bases), were assembled from two overlapping PCR products [P25/24 and P23/oligo d(T) P25] (Bridgen et al., 1993
) to obtain plasmid pKned (Fig. 1
). Secondly, cDNA representing N gene mRNA was constructed by inserting a 125 bp SacIEco64I fragment of plasmid pKnL (Tobler & Ackermann, 1995
) containing the leader sequences in pKned to obtain plasmid pMSN, which served as the parent to construct various plasmids. Subsequently, the I-1 ORF was cloned under the CMV promoter by inserting an Eco64I (blunt)BamHI fragment of pMSN [containing sequences from 39 nt downstream of the N gene start codon to the poly(A) tail] in the HindIII (blunt)BglII site of the pSCT vector (Rusconi et al., 1990
) to obtain pMC1. Plasmid pMC1 was transfected into Vero cells using the calcium phosphate method and the putative product was examined by indirect immunofluorescence using rabbit antipeptide sera developed against the peptide NH2 YERRLKSQSFQNSLNSSPV COOH, representing the C-terminal 18 residues of I-1. The I-1-specific fluorescent signals were only seen in the cytoplasm of the cells transfected with plasmid pMC1 (10% efficiency of transfection) (Fig. 2
a). Experiments with vector plasmid were negative (Fig. 2b
).
|
To characterize the I-1 protein, total cellular proteins from PEDV-infected Vero cells were separated in SDS20% PAGE (Hofmann et al., 1993
) and immunoblotted. The I-1 antipeptide sera reacted with a protein of 12 kDa (Fig. 3a
), lane 2 that was absent from the mock-infected cells (lane 1). The genuineness of this protein as a product of I-1 ORF was confirmed by expressing the ORF in baculovirus. For this purpose the recombinant baculoviruses containing cDNA of the N gene mRNA with leader or without leader or lacking the N gene start codon were generated using previously described procedures (Singh et al., 1996
). All these viruses synthesized 12 kDa recombinant I-1 protein that migrated with the same mobility as the one made in PEDV-infected cells (Fig. 3a
, lanes 6, 7 and 8). No such product was observed in parental BacPAK6 baculovirus (Clontech) or mock-infected Sf9 cells (Fig. 3a
, lanes 4 and 5). The immunoblots restained with N protein-specific monoclonal antibodies (weak reaction) revealed a 56 kDa PEDV-specific N protein in lysates of cells infected with recombinant baculoviruses carrying N gene mRNA with or without leader (Fig. 3a
, lanes 6 and 7), showing that the protein products were specified by the PEDV sequences.
|
The deduced amino acid sequence of I-1 shows phosphorylation sites at residues 29, 58, 60 and 94. This prompted me to check for a possible phosphorylated I-1 product in PEDV-infected Vero cells grown in the presence of carrier-free [32P]orthophosphate. Total cellular proteins were separated in SDSPAGE and PEDV-specific proteins were identified by immunostaining the blots first with I-1 antibodies and then with N protein-specific antibodies. Phosphorylated proteins were detected by exposing the blots to X-ray film. Comparison of X-ray film with immunoblots revealed no 32P-labelled protein band corresponding to the size of the I-1 protein (Fig. 3c
, lane 1), while the N protein was detected as a 56 kDa phosphorylated product. Mock-infected controls did not show any of the viral proteins (Fig. 3c
, lane 2).
N gene mRNA (1900 bases) has been identified as the smallest subgenomic mRNA of PEDV (Bridgen et al., 1993
). To test whether N gene mRNA serves as a template for synthesis of the I-1 protein, plasmids carrying N gene mRNA sequences with (pMCLN) or without (pKCN) leader or carrying only I-1 ORF (pMC1) (Fig. 1
) under control of the T7 promoter were individually used for in vitro translation. Besides the 56 kDa N protein, the 12 kDa I-1 protein was also made from the plasmids pMCLN (Fig. 3b
, lane 1) and pKCN (Fig. 3b
, lane 2). The 12 kDa protein synthesized from these plasmids migrated with the same mobility as did the product from plasmid pMC1 that contained the I-1 AUG as the first available start codon (Fig. 3b
, lane 3). The reaction of I-1 antipeptide sera with in vitro-translated I-1 protein confirmed that this protein was synthesized from the I-1 ORF in N gene mRNA.
Further, the strategy of I-1 expression from N gene mRNA was investigated. It is possible that N gene mRNA undergoes editing in vivo and the I-1 ORF is brought in-frame with the N gene initiator codon or there is a ribosomal frameshifting during translation of the N gene mRNA. Synthesis of I-1 in such a manner would result in a fusion protein with amino-terminal residues from the N protein. This possibility was thought unlikely since there are no sequence motifs typical of frameshifting regions. In addition, the rabbit serum raised against a peptide covering the amino-terminal 16 residues of the N protein failed to detect I-1 in Western blots (not shown). The other possibilities could be that the N gene start codon is modified or removed, leaving the I-1 initiator as the first AUG on the mRNA or there may be a separate subgenomic mRNA for I-1. To detect such an edited or I-1-specific mRNA, total RNA isolated from the PEDV-infected cells was subjected to RTPCR. First strand cDNA was synthesized using message complementary primers P70 (located 7 nt down from the I-1 initiator) or P32 [located 92 nt upstream of the poly(A) tail] or oligo d(T)-tailed P25. PCR amplification products from combinations of primer P117 (located in the leader sequences) and P70 or P32 or P25 were directly sequenced. No changes in the sequences of PCR products were found as compared to that of N gene mRNA, indicating the absence of any type of editing in the N gene mRNA. In addition, the sequencing of PCR products of primer pairs P117/32, P117/25 and P132/25 demonstrated that N gene mRNA was the only message transcribed from the 3' end of the PEDV genome.
Thus, the successful expression of I ORFs would require either reinitiation of translation or internal entry of ribosomes in N gene mRNA. The expression pattern of I-1 from unedited N gene mRNA suggests that PEDV, like BCV (Senanayake & Brian, 1997
), may use the leaky scanning model for the synthesis of I-1 protein. Since the N gene start codon is in suboptimal context (UUUAUGG), some of the 40S ribosomal subunits would bypass it to start translation at a downstream AUG (Kozak, 1989
). In that case, the expression of I-1 from an initiator in the weakest primary sequence context (UCUAUGC) would require an appropriately positioned downstream secondary structure in the N gene mRNA. A stemloop structure seems to be formed 20 nt downstream of the I-1 start codon. Such a stemloop structure located 14 nt downstream of start codon has been shown to facilitate translation initiation from an AUG in unfavourable contexts and even from non-AUG codons (Kozak, 1990
). No IRES-specific sequences, essential for direct internal entry of 40S ribosomes, were observed in the N gene mRNA, thus, obviating I-1 synthesis by internal initiation of translation. Alternatively, I-1 may also be expressed from N gene mRNA by ribosome shunting (Yueh & Schneider, 1996
). However, experiments were not performed to prove or disprove these possibilities.
The exact function of coronavirus I ORFs and their proteins is not known except for MHV I protein, which is a constituent of the virion (Fischer et al., 1997
). The BCV I protein is only suggested to be part of the virion (Senanayake et al., 1992
). In contrast, the PEDV I-1 protein was not present in detectable amounts in virions. However, presence of I-1 in a low copy number in virions cannot be ruled out, suggesting that I-1 could be a structural protein. Although I-1 sequences carry various protease signature patterns and potential phosphorylation sites, in my experiments I-1 was not detected as a phosphorylated protein. The I-2 and I-3 ORF products were not detected in virus-infected cells (not shown). Further experiments involving disruption of I ORF initiation and stop codons or early termination of I ORFs without disturbing the N gene function are envisaged to show whether the I ORFs and their products are a requirement for virus viability.
| Acknowledgments |
|---|
These studies were supported by Swiss National Science Foundation grants no. 31-37418.93 and 31-43503.95.
| References |
|---|
|
|
|---|
Bernasconi, C., Guscetti, F., Utiger, A., Van Reeth, K., Ackermann, M. & Pospischil, A. (1995). Experimental infections of gnotobiotic piglets with a cell culture adapted porcine epidemic diarrhoea virus: clinical, histopathological and immunohistochemical findings. In Immunobiology of Viral Infections, pp. 542-546. Edited by M. Schwyzer & M. Ackermann. Lyon, France: Fondation Marcel Mérieux.
Bridgen, A., Duarte, M., Tobler, K., Laude, H. & Ackermann, M. (1993). Sequence determination of the nucleocapsid protein gene of the porcine epidemic diarrhoea virus confirms that this virus is a coronavirus related to human coronavirus 229E and porcine transmissible gastroenteritis virus. Journal of General Virology 74, 1795-1804.
Devereux, J., Haeberli, P. & Smithies, O. (1984). A comprehensive set of sequence analysis programs for the VAX. Nucleic Acids Research 12, 387-395.
Duarte, M. & Laude, H. (1994). Sequence of the spike protein of the porcine epidemic diarrhoea virus. Journal of General Virology 75, 1195-1200.
Duarte, M., Tobler, K., Bridgen, A., Rasschaert, D., Ackermann, M. & Laude, H. (1994). Sequence analysis of the porcine epidemic diarrhea virus genome between the nucleocapsid and spike protein genes reveals a polymorphic ORF. Virology 198, 466-476.[Medline]
Fischer, F., Peng, D., Hingley, S., Weiss, S. & Masters, P. (1997). The internal open reading frame within the nucleocapsid gene of mouse hepatitis virus encodes a structural protein that is not essential for viral replication. Journal of Virology 71, 996-1003.[Abstract]
Hofmann, M. & Wyler, R. (1988). Propagation of the virus of porcine epidemic diarrhea in cell culture. Journal of Clinical Microbiology 26, 2235-2239.
Hofmann, M. A., Senanayake, S. D. & Brian, D. A. (1993). A translation-attenuating intraleader open reading frame is selected on coronavirus mRNAs during persistent infection. Proceedings of the National Academy of Sciences, USA 90, 11733-11737.
Kapke, P. A. & Brian, D. A. (1986). Sequence analysis of the porcine transmissible gastroenteritis coronavirus nucleocapsid protein gene. Virology 151, 41-49.[Medline]
Kozak, M. (1989). The scanning model for translation: an update. Journal of Cell Biology 108, 229-241.
Kozak, M. (1990). Downstream secondary structure facilitates recognition of initiator codons by eukaryotic ribosomes. Proceedings of the National Academy of Sciences, USA 87, 8301-8305.
Rusconi, S., Severne, Y., Georgiev, O., Galli, I. & Wieland, S. (1990). A novel expression assay to study transcriptional activators. Gene 89, 211-221.[Medline]
Sambrook, J., Fritsch, E. F. & Maniatis, T. (1989). Molecular Cloning: A Laboratory Manual, 3rd edn. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory.
Sanger, F., Nicklen, S. & Coulson, A. R. (1977). DNA sequencing with chain-terminating inhibitors. Proceedings of the National Academy of Sciences, USA 74, 5463-5467.
Senanayake, S. & Brian, D. (1997). Bovine coronavirus I protein synthesis follows ribosomal scanning on the bicistronic N mRNA. Virus Research 48, 101-105.[Medline]
Senanayake, S. D., Hofmann, M. A., Maki, J. L. & Brian, D. A. (1992). The nucleocapsid protein gene of bovine coronavirus is bicistronic. Journal of Virology 66, 5277-5283.
Singh, M., Fraefel, C., Bello, L. J., Lawrence, W. C. & Schwyzer, M. (1996). Identification and characterization of BICP27, an early protein of bovine herpesvirus 1 which may stimulate mRNA 3' processing. Journal of General Virology 77, 615-625.
Tobler, K. & Ackermann, M. (1995). PEDV leader sequence and junction sites. Advances in Experimental Medicine and Biology 380, 541-542.[Medline]
Utiger, A., Tobler, K., Bridgen, A. & Ackermann, M. (1995). Identification of the membrane protein of porcine epidemic diarrhoea virus. Virus Genes 10, 137-148.[Medline]
Vennema, H., Heijnen, L., Rottier, P. J., Horzinek, M. C. & Spaan, W. J. (1992a). A novel glycoprotein of feline infectious peritonitis coronavirus contains a KDEL-like endoplasmic reticulum retention signal. Journal of Virology 66, 4951-4956.
Vennema, H., Rossen, J. W., Wesseling, J., Horzinek, M. C. & Rottier, P. J. (1992b). Genomic organization and expression of the 3' end of the canine and feline enteric coronaviruses. Virology 191, 134-140.[Medline]
Yueh, A. & Schneider, R. J. (1996). Selective translation initiation by ribosome jumping in adenovirus-infected and heat-shocked cells. Genes & Development 10, 1557-1567.
Received 23 February 1999;
accepted 29 April 1999.
This article has been cited by other articles:
![]() |
C. M. Jonassen, T. Kofstad, I.-L. Larsen, A. Lovland, K. Handeland, A. Follestad, and A. Lillehaug Molecular identification and characterization of novel coronaviruses infecting graylag geese (Anser anser), feral pigeons (Columbia livia) and mallards (Anas platyrhynchos) J. Gen. Virol., June 1, 2005; 86(6): 1597 - 1607. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| INT J SYST EVOL MICROBIOL | MICROBIOLOGY | J GEN VIROL |
| J MED MICROBIOL | ALL SGM JOURNALS | |