J Gen Virol Try IJSEM Online
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via CrossRef
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Vartanian, J.-P.
Right arrow Articles by Meyerhans, A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Vartanian, J.-P.
Right arrow Articles by Meyerhans, A.
Agricola
Right arrow Articles by Vartanian, J.-P.
Right arrow Articles by Meyerhans, A.
Journal of General Virology (1999), 80, 1983-1986.
© 1999 Society for General Microbiology


Animal: RNA Viruses

Manganese cations increase the mutation rate of human immunodeficiency virus type 1 ex vivo

Jean-Pierre Vartanian1, Monica Sala1, Michel Henry1, Simon Wain-Hobson1 and Andreas Meyerhans2

Institut Pasteur, Unité de Rétrovirologie Moléculaire, 28 rue du Dr Roux, 75724 Paris Cedex 15, France1
Abteilung Virologie, Institut für Medizinische Mikrobiologie und Hygiene, Klinikum Homburg, Haus 47, Universität des Saarlandes, 66421 Homburg/Saar, Germany2

Author for correspondence: Jean-Pierre Vartanian.Fax +33 1 45 68 88 74. e-mail jpvart{at}pasteur.fr


   Abstract
TOP
Abstract
Main text
References
 
Human immunodeficiency virus (HIV) reverse transcription is an error-prone process with an overall mutation rate of ~3·4x10-5 per base per replication cycle. This rate can be modulated by changes in different components of the retrotranscription reaction. In particular, in vitro substitution of magnesium cations (Mg2+) by manganese cations (Mn2+) has been shown to increase misincorporation of deoxynucleotide triphosphates (dNTPs) and to alter substrate specificity. Here, it is shown that Mn2+ also increases the HIV mutation rate ex vivo. Treatment of permissive cells with Mn2+ and subsequent HIV infection resulted in at least 6-fold and 10-fold increases in the mutant and mutation frequencies respectively, thus illustrating a further example of how to influence HIV genetic variation.


   Main text
TOP
Abstract
Main text
References
 
The fidelity of virus replication is dependent upon a number of variables, the presence of proof-reading activity being the most important. For retroviruses, which are devoid of this enzymatic activity, the main variables appear to be the nature of the reverse transcriptase (RT) and balanced deoxynucleotide triphosphates (dNTP) concentrations. For example, less than a 10-fold difference distinguishes human immunodeficiency virus (HIV), spleen necrosis virus (SNV) and bovine leukaemia virus (BLV) mutation rates when measured in a single cycle assay (Mansky & Temin, 1994Down ), while unbalanced dNTP concentrations can increase the HIV mutation rate by a factor of 10 (Meyerhans et al., 1994Down ; Vartanian et al., 1997Down ). Other factors are pre-existing mismatches and local sequence motifs (Sala et al., 1995Down ; Boyer et al., 1994Down ; Perach et al., 1997Down ), pH (Eckert & Kunkel, 1993Down ), ionic strength and the nature of the divalent cation.

The HIV RT has several enzymatic activities requiring divalent cations as cofactors. For example, magnesium cations (Mg2+) are utilized for DNA polymerization, and Mg2+ and manganese cations (Mn2+) for ribonuclease H (RNase H) activity. The RNase H acts both as an endonuclease and an exonuclease. Both functions are catalysed by Mg2+, while RNase H-dependent hydrolysis of the double-stranded RNA intermediate is only possible in the presence of Mn2+ (Cirino et al., 1995Down ). As far as DNA polymerase activity is concerned, substitution of Mg2+ by Mn2+ has been shown to increase the misincorporation of dNTPs and to alter the substrate specificities in vitro (Lazcano et al., 1992Down ; Valverde-Garduño et al., 1998Down ). This Mn2+-modulated enzyme function is not unique to HIV RT. It has also been reported for avian myeloblastosis virus (AMV) RT (Sirover & Loeb, 1977Down ), Moloney murine leukaemia virus RT (Gerard & Grandgenett, 1975Down ; Van Beveren & Goulian, 1979Down ), T4 DNA polymerase (Goodman et al., 1983Down ), Taq DNA polymerase (Cadwell & Joyce, 1992Down ; Fromant et al., 1995Down ; Leung et al., 1989Down ; Vartanian et al., 1996Down ), E. coli polymerase I (Richetti & Buc, 1993Down ) and human DNA polymerases {alpha} and ß (Chang & Bollum, 1973Down ).

The aim of this work was to study the effect of Mn2+ on the mutation rate following HIV replication in culture (ex vivo). Briefly, 3x106 cells of the monocytic cell line U937-2 were preincubated with 0·5 mM MnCl2 in RPMI 1640 medium for 30 min at 37 °C. This medium contains 0·4 mM Mg2+ but lacks Mn2+. The cell culture was then infected with 6x102 c.p.m. of HIV-1 Lai RT activity per 106 cells as described (Nietfeld et al., 1995Down ). After 3 h at 37 °C, cells were washed twice with RPMI 1640 medium and then cultured in RPMI 1640–10% foetal calf serum with 0·5 mM MnCl2 for 16 h. Control cell cultures without MnCl2 treatment were infected accordingly. The cells were then washed, centrifuged and resuspended in 1 ml PBS (without Ca/Mg) containing 1 µg/ml DNase I and 10 mM MgCl2. After 30 min at room temperature, the cells were centrifuged and resuspended in 200 µl 2x lysis buffer for PCR containing 10 mM Tris pH 8·3, 1% Tween, 1% NP40 and 0·6 mg/ml proteinase K. Samples were maintained for 1 h at 55 °C. Proteinase K was inactivated by incubating for 15 min at 95 °C and the samples were kept at -20 °C until use. A fragment of the HIV RT region [codons 550–557 from the start of the pol open reading frame (Wain-Hobson et al., 1985Down )] was amplified by PCR with the primers RTGA1 (5' GGCGAATTCTAAATTTAAACTACCCATACAA) and RTGA2 [5' GGCAAGCTTGTGG(C/T)TTGCCAATA(C/T)T(C/T)TGT] (Fig. 1Down). Amplification products were cloned in-frame into the lacZ {alpha}-coding fragment of M13mp18 via EcoRI and HindIII. E. coli XL-1 Blue was transformed and plated on 8% X-Gal plus IPTG indicator plates. Colonies obtained were counted and all white plaques were sequenced as previously described (Vartanian et al., 1997Down ).



View larger version (18K):
[in this window]
[in a new window]
 
Fig. 1. Tryptophan trap Mn2+-induced mutants. The tryptophan-rich sequence is found in the HIV-1 pol open reading frame. The PCR primers RTGA1 and RTGA2 are indicated. Control and Mn2+-treated clones are detailed. Only mutations with respect to the reference sequence are shown.

 
The identification of HIV provirus mutants by sequencing randomly picked clones of PCR-amplified fragments is cumbersome, particularly in cases where the mutant frequency is low. For this reason, a genetic screening method based upon E. coli ß-galactosidase complementation was used in this study. This so-called `tryptophan trap' method has successfully been applied previously for the identification of G->A transitions under conditions of altered intracellular dNTP levels. (Vartanian et al., 1994Down , 1997Down ). A short region of the HIV pol gene is amplified by PCR and cloned in-frame of the {alpha}-subunit of the ß-galactosidase gene in an M13mp18 vector. The amplified region covers eight codons of which three are UGG, the only triplet encoding tryptophan. Any G->A transition in these will give rise to stop codons (UGA, UAG and UAA) and thus a white phenotype in the ß-galactosidase assay. Additional mutations in the respective HIV region will only be detected in this assay if they disrupt the ß-galactosidase structure and function, while the unmutated control comes up as blue plaques. Thus, the ratio between white and total number of colonies gives a minimal estimate for the mutant frequency. This can subsequently be refined by sequencing.

Manganese treatment of permissive cells increased significantly the error rate for HIV reverse transcription ex vivo by more than 6-fold. Five mutants out of 980 clones were identified in the Mn2+-treated sample whereas no mutant within 1359 clones was found in the control (Table 1Down). Sequencing of the individual mutants identified seven point mutations, four G->A transitions within the tryptophan codons and three additional transversions in the glutamic acid and threonine codons leading to aspartic acid and serine respectively (Fig. 1). From these data, the minimal HIV mutation frequency (no. of mutations/no. of sequence nucleotides multiplied by the no. of total clones analysed) during Mn2+ treatment can be calculated to be 3x10-4. This is only a minimal estimate because mutations that do not give rise to an altered ß-galactosidases activity or to stop codons are missed. Therefore, compared to the control infection with a mutation frequency <3x10-5 (at least one white colony per 1359 blue), manganese treatment increased the mutation frequency at least by a factor of 10. As the experiments lasted 16 h, the frequencies correspond to a single HIV replication round.


View this table:
[in this window]
[in a new window]
 
Table 1. Mutant and mutation frequencies associated with untreated and Mn2+-treated HIV-infected cells

 
The observed ex vivo increase in the HIV replication fidelity induced by Mn2+ is compatible with recent observations of an Mn2+-dependent decrease in HIV production (Filler & Lever, 1997Down ). Furthermore, previous in vitro studies support the idea that it may be a direct effect of the cation on the RT polymerization activity. For example, the substrate specificity of the HIV-1 RT is modified by Mn2+ in vitro. Ribonucleotides may be added to a nascent deoxyribonucleotide strand in a template-dependent reaction on RNA templates (Valverde-Garduño et al., 1998Down ). While turning HIV-1 RT into an RNA replicase, Mn2+ inhibits RNA-dependent DNA polymerase activity. This change in favour of rNTP seems not to be specific to HIV-1 RT as it has been also observed in vitro for AMV RT (Lazcano et al., 1992Down ). Another in vitro study showed that on specific DNA or RNA template motifs, Mn2+ induces HIV-1 RT to depart from its classical mode of elongation. This behaviour is enhanced when mismatches are introduced and Mn2+ is increased to millimolar concentrations. Under these conditions, HIV-1 RT can generate repetitive products beyond the last base of the template (Richetti & Buc, 1996Down ).

The chemical basis by which Mn2+ induces an aberrant polymerization activity of the HIV RT is not completely understood. Mn2+ seems to decrease the number of RT molecules engaged in polymerization (Valverde-Garduño et al., 1998Down ). This cation is known to reduce base stacking by binding to the primer–template helix (Shin, 1973Down ; Vamvakopoulos et al., 1977Down ). This could alter the stability of the nucleic acid molecule and confer more flexibility to the helix allowing an easier introduction of misincorporated nucleotides (Sala et al., 1995Down ). On the other hand, alterations in helix structure in direct contact with the enzyme could induce an increase in the enzyme's koff, thus facilitating RT to fall off the primer–template complex. In addition, Mn2+ is known to bind to the heterocyclic nitrogen atoms of bases and to stabilize mismatches which expose heterocyclic nitrogen atoms to the solvent with a higher efficiency than Mg2+ (Pan et al., 1993Down ). In this way Mn2+ could increase the probability of fixing mutations in the HIV genome. Furthermore, Mn2+ could also bind noncovalently at the metal-binding sites in the RT structure. Altogether, the effect of Mn2+ on the RT polymerization activity seems to be multifactorial, involving simultaneous interactions with the template, the substrate and the enzyme.

In conclusion, the fidelity of the HIV RT can be manipulated by various means with subsequent mutation frequencies spanning from the basal 3·4x10-5 ex vivo (Mansky & Temin, 1995Down ) to 10-2 in vitro (Martinez et al., 1995Down ; Sala et al., 1995Down ; Vartanian et al., 1997Down ). Knowing how to reduce RT fidelity especially ex vivo might offer tools to directly increase the HIV mutation rate. While HIV is able to tolerate a high degree of sequence divergence without changes in pathogenicity, it might be possible to increase the mutation rate beyond the error threshold (Domingo & Holland, 1997Down ). This would have to be achieved using small synthetic molecules for manganese and biased dNTP concentrations would probably prove mutagenic for host cell replication. However, the extensive collection of RT structures might allow modelling of a molecule that could relocate the nucleic acid helix in the cleft so altering fidelity.


   Acknowledgments
 
We thank Nicolaus Müller-Lantzsch for continuous interest in the work and Birgit Holzwarth for excellent technical assistance. This work was supported by the Deutsche Forschungsgemeinschaft and grants from the Institut Pasteur and Agence Nationale de Recherche sur le SIDA (ANRS).


   References
TOP
Abstract
Main text
References
 
Boyer, P. L., Tantillo, C., Jacobo-Molina, A., Nanni, R. G., Ding, J., Arnold, E. & Hughes, S. H. (1994). Sensitivity of wild-type human immunodeficiency virus type 1 reverse transcriptase to dideoxynucleotides depends on template. Proceedings of the National Academy of Sciences, USA 91, 4882-4886.[Abstract/Free Full Text]

Cadwell, R. C. & Joyce, G. F. (1992). Randomization of genes by PCR mutagenesis. PCR Methods and Applications 2, 28-33.[Medline]

Chang, L. M. & Bollum, F. J. (1973). A comparison of associated enzyme activities in various deoxyribonucleic acid polymerases. Journal of Biological Chemistry 248, 3398-3404.[Abstract/Free Full Text]

Cirino, N. M., Cameron, C. E., Smith, J. S., Rausch, J. W., Roth, M. J., Benkovic, S. J. & Le Grice, S. F. J. (1995). Divalent cation modulation of the ribonuclease functions of human immunodeficiency virus reverse transcriptase. Biochemistry 34, 9936-9943.[Medline]

Domingo, E. & Holland, J. J. (1997). RNA viral mutations and fitness for survival. Annual Review of Microbiology 51, 151-178.[Medline]

Eckert, K. A. & Kunkel, T. A. (1993). Fidelity of DNA synthesis catalyzed by human DNA polymerase alpha and HIV-1 reverse transcriptase: effect of reaction pH. Nucleic Acids Research 21, 5212-5220.[Abstract/Free Full Text]

Filler, A. G. & Lever, A. M. L. (1997). Effects of cation substitutions on reverse transcriptase and on human immunodeficiency virus production. AIDS Research and Human Retroviruses 13, 291-299.[Medline]

Fromant, M., Blanquet, S. & Plateau, P. (1995). Direct random mutagenesis of gene-sized DNA fragments using polymerase chain reaction. Analytical Biochemistry 224, 347-353.[Medline]

Gerard, G. F. & Grandgenett, D. P. (1975). Purification and characterization of the DNA polymerase and RNase H activities in Moloney murine sarcoma–leukemia virus. Journal of Virology 15, 785-797.[Abstract/Free Full Text]

Goodman, M. F., Keener, S., Guidotti, S. & Branscomb, E. W. (1983). On the enzymatic basis for mutagenesis by manganese. Journal of Biological Chemistry 258, 3469-3475.[Abstract/Free Full Text]

Lazcano, A., Valverde, V., Hernàndez, G., Gariglio, P., Fox, G. E. & Oro, J. (1992). On the early emergence of reverse transcription: theoretical basis and experimental evidence. Journal of Molecular Evolution 35, 524-536.[Medline]

Leung, D., Chen, E. & Goeddel, D. (1989). A method for random mutagenesis of a defined DNA segment using a modified polymerase chain reaction. Technique 1, 11-15.

Mansky, L. M. & Temin, H. M. (1994). Lower mutation rate of bovine leukemia virus relative to that of spleen necrosis virus. Journal of Virology 68, 494-499.[Abstract/Free Full Text]

Mansky, L. M. & Temin, H. M. (1995). Lower in vivo mutation rate of human immunodeficiency virus type 1 than that predicted from the fidelity of purified reverse transcriptase. Journal of Virology 69, 5087-5094.[Abstract]

Martinez, M. A., Sala, M., Vartanian, J. P. & Wain-Hobson, S. (1995). Reverse transcriptase and substrate dependence of the RNA hypermutagenesis reaction. Nucleic Acids Research 23, 2573-2578.[Abstract/Free Full Text]

Meyerhans, A., Vartanian, J. P., Hultgren, C., Plikat, U., Karlsson, A., Wang, L. Y., Eriksson, S. & Wain-Hobson, S. (1994). Enhancement and restriction of HIV replication by modulation of the intracellular dNTP pool. Journal of Virology 68, 535-540.[Abstract/Free Full Text]

Nietfeld, W., Bauer, M., Fevrier, M., Maier, R., Holzwarth, B., Frank, R., Maier, B., Riviere, Y. & Meyerhans, A. (1995). Sequence constraints and recognition by cytotoxic T lymphocytes of an HLA-B27 restricted HIV-1 Gag epitope. Journal of Immunology 154, 2188-2197.

Pan, T., Long, D. M. & Uhlenbeck, O. C. (1993). Title of Article. In The RNA World, pp. 271-302. Edited by R. F. Gesterland & J. F. Atkins. Plainview, NY: Cold Spring Harbor Laboratory Press.

Perach, M., Rubinek, T., Hughes, S. H. & Hizi, A. (1997). Analysis of HIV-2 RT mutants provides evidence that resistance of HIV-1 and HIV-2 RT to nucleoside analogs involves a repositioning of the template-primer. Journal of Molecular Biology 268, 648-654.[Medline]

Richetti, M. & Buc, H. (1993). E. coli DNA polymerase I as a reverse transcriptase. EMBO Journal 12, 387-396.[Medline]

Richetti, M. & Buc, H. (1996). A reiterative mode of DNA synthesis adopted by HIV-1 reverse transcriptase after a misincorporation. Biochemistry 35, 14970-14983.[Medline]

Sala, M., Wain-Hobson, S. & Schaeffer, F. (1995). Human immunodeficiency virus type 1 reverse transcriptase tG:T mispair formation on RNA and DNA templates with mismatched primers: a kinetic and thermodynamic study. EMBO Journal 14, 4622-4627.[Medline]

Shin, Y. (1973). Interaction of metal ions with polynucleotides and related compounds. Effect of divalent metal ions on the conformational changes of polyribonucleotides. Biopolymers 12, 2459-2475.[Medline]

Sirover, M. A. & Loeb, L. A. (1977). On the fidelity of DNA replication. Effect of metal activator during synthesis with avian myeloblastosis virus DNA polymerase. Journal of Biological Chemistry 252, 3605-3610.[Abstract/Free Full Text]

Valverde-Garduño, V., Gariglio, P. & Gutiérrez, L. (1998). Functional analysis of HIV-1 reverse transcriptase motif C: site-directed mutagenesis and metal cation interaction. Journal of Molecular Evolution 47, 73-80.[Medline]

Vamvakopoulos, N. C., Vournakis, J. N. & Marcus, S. L. (1977). The effect of magnesium and manganese ions on the structure and template activity for reverse transcriptase of polyribocytidylate and its 2'-O-methyl derivative. Nucleic Acids Research 4, 3589-3597.[Abstract/Free Full Text]

Van Beveren, C. & Goulian, M. (1979). Optimal conditions for synthesis of long complementary DNA product with Moloney murine leukemia virus. Journal of Virology 30, 951-954.[Abstract/Free Full Text]

Vartanian, J. P., Meyerhans, A., Sala, M. & Wain-Hobson, S. (1994). G->A hypermutation of the HIV-1 genome: evidence for dCTP pool imbalance during reverse transcription. Proceedings of the National Academy of Sciences, USA 91, 3092-3096.[Abstract/Free Full Text]

Vartanian, J. P., Henry, M. & Wain-Hobson, S. (1996). Hypermutagenic PCR involving all four transitions and a sizeable proportion of transversions. Nucleic Acids Research 24, 2627-2631.[Abstract/Free Full Text]

Vartanian, J. P., Plikat, U., Maheux, R., Guillemot, L., Meyerhans, A. & Wain-Hobson, S. (1997). HIV genetic variability is directed and restricted by DNA precursor availability. Journal of Molecular Biology 270, 139-151.[Medline]

Wain-Hobson, S., Sonigo, P., Danos, O., Cole, S. & Alizon, M. (1985). Nucleotide sequence of the AIDS virus, LAV. Cell 40, 9-17.[Medline]

Received 12 February 1999; accepted 28 April 1999.


This article has been cited by other articles:


Home page
J. Virol.Home page
J. Balzarini, M.-J. Camarasa, M.-J. Perez-Perez, A. San-Felix, S. Velazquez, C.-F. Perno, E. De Clercq, J. N. Anderson, and A. Karlsson
Exploitation of the Low Fidelity of Human Immunodeficiency Virus Type 1 (HIV-1) Reverse Transcriptase and the Nucleotide Composition Bias in the HIV-1 Genome To Alter the Drug Resistance Development of HIV
J. Virol., July 1, 2001; 75(13): 5772 - 5777.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
C. E. Cases-Gonzalez, M. Gutierrez-Rivas, and L. Menendez-Arias
Coupling Ribose Selection to Fidelity of DNA Synthesis. THE ROLE OF Tyr-115 OF HUMAN IMMUNODEFICIENCY VIRUS TYPE 1 REVERSE TRANSCRIPTASE
J. Biol. Chem., June 23, 2000; 275(26): 19759 - 19767.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via CrossRef
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Vartanian, J.-P.
Right arrow Articles by Meyerhans, A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Vartanian, J.-P.
Right arrow Articles by Meyerhans, A.
Agricola
Right arrow Articles by Vartanian, J.-P.
Right arrow Articles by Meyerhans, A.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
INT J SYST EVOL MICROBIOL MICROBIOLOGY J GEN VIROL
J MED MICROBIOL ALL SGM JOURNALS