J Gen Virol Tips for Better Browsing
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via CrossRef
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Baron, M. D.
Right arrow Articles by Barrett, T.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Baron, M. D.
Right arrow Articles by Barrett, T.
Agricola
Right arrow Articles by Baron, M. D.
Right arrow Articles by Barrett, T.
Journal of General Virology (1999), 80, 2031-2039.
© 1999 Society for General Microbiology


Animal: RNA Viruses

Expression in cattle of epitopes of a heterologous virus using a recombinant rinderpest virus

Michael D. Baron1, Mildred Foster-Cuevas2, Jana Baron2 and Thomas Barrett1

Divisions of Molecular Biology1 and Immunology2, Institute for Animal Health Pirbright Laboratory, Ash Road, Pirbright, Surrey GU24 0NF, UK

Author for correspondence: Michael Baron.Fax +44 1483 232448. e-mail michael.baron{at}bbsrc.ac.uk


   Abstract
TOP
Abstract
Introduction
Methods
Results
Discussion
References
 
We have investigated the bovine immune response to heterologous proteins expressed using a recombinant rinderpest virus (RPV). A new gene unit was created in a cDNA copy of the genome of the vaccine strain of RPV, and an open reading frame inserted that encodes the polymerase (3Dpol) and parts of the capsid protein VP1 from foot-and-mouth disease virus (FMDV). Infectious recombinant RPV was rescued and shown to express the FMDV-derived protein at good levels in infected cells. The rescued virus was only slightly more attenuated in tissue culture than the original virus. Cattle infected with this recombinant generated a normal immune response to RPV, and were protected from lethal challenge by that virus. Experimental animals showed a specific delayed-type hypersensitivity response to FMDV 3Dpol, similar to that seen in FMDV infection; however, no antibodies were detected recognizing either of the components of the FMDV-derived protein, nor was any proliferative response to these epitopes found in isolated peripheral blood lymphocytes from infected animals. No protection was seen against FMDV infection.


   Introduction
TOP
Abstract
Introduction
Methods
Results
Discussion
References
 
The development of techniques for manipulating the genomes of negative-strand RNA viruses through the rescue of live virus from cDNA clones (Schnell et al., 1994Down ; Garcin et al., 1995Down ; Lawson et al., 1995Down ; Radecke et al., 1995Down ; Whelan et al., 1995Down ) has opened the way not only to investigation of the function of viral proteins and genetic elements, but also to the functional replacement of viral proteins (Mebatsion et al., 1997Down ; Schnell et al., 1997Down ; Takada et al., 1997Down ; Spielhofer et al., 1998Down ) and the expression of additional proteins by the insertion of new genes into the viral genomes (Bukreyev et al., 1996Down ; Mebatsion et al., 1996Down ; Schnell et al., 1996Down ; Hasan et al., 1997Down ; Yu et al., 1997Down ; Jin et al., 1998Down ; Moriya et al., 1998Down ; Singh & Billeter, 1999Down ). This last type of modification has been done primarily with coding sequences for marker proteins such as chloramphenicol acetyltransferase or luciferase (Bukreyev et al., 1996Down ; Mebatsion et al., 1996Down ; Schnell et al., 1996Down ; Hasan et al., 1997Down ), but recent reports have highlighted the possibilities of using such systems for preparative biosynthesis of mammalian proteins (Yu et al., 1997Down ; Moriya et al., 1998Down ) or expressing proteins that may have effects on infected animals in vivo (Singh & Billeter, 1999Down ). No limit has yet been found on the number or size of proteins that can be expressed from such recombinants; the major limiting factor is likely to be the difficulty in manipulating the full-length genome plasmids.

Rinderpest virus (RPV) is a paramyxovirus in the genus Morbillivirus, closely related to the causative agents of measles and canine, seal and cetacean distempers, and itself responsible for an economically highly important disease affecting cattle and wild bovids. Despite concerted eradication campaigns, the virus remains enzootic in parts of the Indian subcontinent, as well as several countries in the Near and Middle East, and East Africa, with recent outbreaks in Kenya, Tanzania, Russia and Turkey. We have developed techniques for rescuing recombinant RPV from cDNA clones (Baron & Barrett, 1997Down ); with experimental access to the natural host of the virus, this system provides a useful tool for studying the potential for recombinant morbilliviruses to act as multivalent vaccines.

Foot-and-mouth disease (FMD) is a highly contagious disease affecting a wide range of cloven-hoofed animals, including cattle and pigs, outbreaks of which can be economically devastating. Control is achieved through inactivated virus vaccines, which provide only short-term (4–6 months) protection, and are specific for one of the seven known serotypes. In addition, these vaccines do not fully prevent the virus from establishing a persistent infection, creating carrier animals even in a vaccinated herd (Salt, 1993Down ). This contrasts with the long-lasting protection generated by a live attenuated morbillivirus vaccine such as that used for RPV. In the work presented here we have used the RBOK vaccine strain of RPV to express epitopes from structural and non-structural proteins of FMD virus (FMDV) in the hope that we would elicit a neutralizing immune response that was long lasting. The main neutralizing antibody response to FMDV is directed to the VP1 capsid protein, in particular VP1141–160 and VP1200–213 (Strohmaier et al., 1982Down ; Geysen et al., 1984Down ; DiMarchi et al., 1986Down ; Francis et al., 1990Down ). Peptides (DiMarchi et al., 1986Down ) and fusion proteins (Broekhuijsen et al., 1986Down , 1987Down ; Clarke et al., 1987Down ; Morgan & Moore, 1990Down ) containing these regions have been shown to induce protective immune responses in vivo, though not consistently. Immunization with peptide FMDV15 (which contains VP1200–213 –ProProSer– VP1141–158 of serotype O1Kaufbeuren), although successful in immunizing guinea pigs, only protected a minority of cattle (DiMarchi et al., 1986Down ), probably reflecting the failure of FMDV15 to generate epitopes which are presented by most bovine MHC class II haplotypes (Glass et al., 1991Down ). Addition of an appropriate source of class II epitopes to peptide FMDV15 should result in a more effective stimulation of neutralizing antibodies. Cattle infected or vaccinated with a variety of serotypes of FMDV develop CD4+ T-cell responses directed to the FMDV RNA polymerase (3Dpol) (Foster-Cuevas, 1996Down ; Collen et al., 1998Down ; Foster et al., 1998Down ) as well as serotype-cross-reactive antibodies recognizing 3Dpol (Cowan & Graves, 1966Down ; Fernandez et al., 1975Down ; Dawe & Pinto, 1978Down ; Polatnick & Wool, 1981Down ; Alfonso et al., 1988Down ), indicating that this protein may contain suitable widely recognized class II epitopes. The construct we used in these studies consisted of the FMDV 3Dpol fused genetically at its carboxy terminus to peptide FMDV15.


   Methods
TOP
Abstract
Introduction
Methods
Results
Discussion
References
 
{blacksquare} Cells and viruses.
Culture of cell lines 293, B95a and Vero, rescue of live RPV from cDNA, growth of virus stocks, determination of virus growth rate and titration of viruses was as previously described (Baron & Barrett, 1997Down ).

{blacksquare} Molecular biology techniques and construction of plasmids.
All DNA manipulation was performed as previously described (Baron & Barrett, 1997Down ). Plasmid pGEX-3DFMDV15 was made by amplifying the sequence of FMDV 3Dpol from plasmid pMR15 (Ryan et al., 1989Down ) using Taq polymerase and primers OR31 (5' GGGGGGAATTCCGGGTTGATTGTGGAC 3') and MF10 (5' GGGGTGCCGGCAGGATCCACGCGGAACCAGCGCGTCACCGCACACGGC 3'), digesting with EcoRI and NaeI and ligating into similarly digested pGEX-3XUC-FMDV15 (Foster-Cuevas, 1996Down ). The final construct was Met-[3Dpol] LeuValProArgGlySerCys [VP1200–213] ProProSer [VP1143–160] CysGly. To make pRPVins, two oligonucleotides were made, SPHINS1 (5' TCATTATAAAAAACTTAGGATCCAAGGTCGGCGCGCCGC ATG 3') and SPHINS2 (5' CGGCGCGCCGACCTTGGATCCTAAGTTTTTTATAATGACATG 3'). These oligonucleotides were kinased, heated to 80 °C and allowed to anneal at a concentration of 9·4 µM. Approximately 23 fmol of the dsDNA fragment was ligated into SphI-digested, alkaline phosphatase-treated pMDBN2F (Baron & Barrett, 1997Down ). Clones that had acquired the AscI site were sequenced. From one clone that had the correct sequence, and the insert in the correct orientation, the ClaI–SunI fragment, containing all of the N, P, M genes and most of the F gene, was removed and ligated into the SunI–ClaI fragment of pMDBRPV (Baron & Barrett, 1997Down ), containing the rest of the genome.

To make pRPV-FMD, the 3DFMDV15 region of pGEX3DFMDV15 was amplified using Pfu polymerase (Stratagene) essentially according to the manufacturer's instructions. The primers used were 5' CCCATGGCGCGCCATGGGGTTGATTGTGGACA 3' (FMD3DF) and 5' CCCTAGGCGCGCCTCTATTATCCGCATGGTA 3' (FMD3DR). The amplified product was digested with AscI, purified in a low melting point agarose gel, and ligated into BssHII-cut, alkaline phosphatase-treated pRPVins. One correct clone was selected and, after sequencing the insert, used for virus rescue.

{blacksquare} Antibodies, immunoprecipitation and immunofluorescence.
Rabbit antisera recognizing the RPV P protein (Baron & Barrett, 1997Down ) were raised against bacterially expressed glutathione S-transferase (GST) fusion proteins. The rabbit anti-RPV N antiserum was raised against a mixture of synthetic peptides representing RPV-N402–424, RPV-N425–451, RPV-N452–476 and RPV-N477–501. Mouse monoclonal antibody recognizing the RPV M protein was prepared by standard techniques from mice immunized with partially purified RPV (M. Fleming & T. Barrett, unpublished). Rabbit anti-FMDV 3Dpol was the kind gift of T. Collen and A. Corteyn of this institute. Mouse monoclonal antibody B2 recognizing the FMDV15 peptide was the generous gift of E. Brocchi, Inst. Zooprofilatico Sperimentale Lombardia Emilia, I-25124 Brescia, Italy. Mouse monoclonal antibody 2-1 recognizing the RPV P protein was the kind gift of M. Sugiyama, Dept. of Veterinary Public Health, Faculty of Agriculture, Gifu University, Gifu 501-11, Japan.

For immunoprecipitation studies, cells in six-well plates were infected with RPV for 2 days, incubated for 1 h in Eagle's medium without methionine or cysteine, then for 2 h in 0·5 ml of the same medium containing 5–10 µCi Pro-mix (Amersham Pharmacia), a mixture of amino acids containing [35S]methionine and [35S]cysteine. The medium was removed and the cells lysed in 0·5 ml lysis buffer (1%, v/v, Nonidet-P40, 50 mM Tris–HCl, pH 7·5, 0·5 M NaCl, 5 mM EDTA, 0·5 mM PMSF, 2·5 mM iodoacetamide, and 100 ng/ml each of leupeptin, pepstatin, antipain and chymostatin). The lysate was incubated first with non-immune rabbit serum and protein A–Sepharose (Amersham Pharmacia) for 1–2 h at 4 °C, centrifuged to remove the protein A–Sepharose, and then incubated with the specific antiserum and protein A–Sepharose overnight at 4 °C. Where the primary antibody was a mouse monoclonal, 0·5 µl of rabbit anti-mouse IgG (Dakopatts) was added in addition. Sepharose pellets were washed and samples prepared for SDS–PAGE as described (Baron & Garoff, 1990Down ).

SDS–PAGE was performed using the buffer system of Laemmli (1970)Down ; gels were fluorographed using sodium salicylate (Chamberlain, 1979Down ).

For immunofluorescence studies, infected cells growing on glass coverslips were fixed 2 days post-infection and stained essentially as described (Timm et al., 1983Down ); secondary antibodies (FITC and Texas Red conjugates) were obtained from Molecular Probes, Inc.

Fluorographs of gels and photographs of immunofluorescently stained cells were scanned using a Linotype Hell Saphir or a Kodak DCS200 digital camera and imported into Adobe Photoshop 4.01. Images were laid out and text added using Quark Express 3.32 and printed on a Kodak XLS8600 PS dye-sublimation printer.

{blacksquare} Preparation of purified fusion proteins and viral antigen.
Bacterially expressed proteins for immunogenicity studies (GST, GST–3DFMDV15) were expressed in E. coli JM109 and batch purified on glutathione–agarose (Amersham Pharmacia) according to the manufacturer's instructions. For delayed type hypersensitivity (DTH) assays, the antigens were purified by preparative SDS–PAGE. Partially purified RPV proteins were prepared from RPV-infected Vero cells as described (Barrett et al., 1989Down ); uninfected Vero cells were processed in parallel to provide a suitable negative control. Purified FMDV O1 total antigen, lot 6.0.142.C, was obtained from Rhône-Merieux (now Merial).

{blacksquare} Animal studies.
To study the immunogenicity of the 3DFMDV15 fusion protein in cattle, six animals were injected subcutaneously with 3 mg each of purified fusion protein in Freund's complete adjuvant, and boosted at 7 weeks with a further 2 mg of protein in Freund's incomplete adjuvant. Blood was taken at weeks 0, 3, 4, 5, 6, 7, 8, 9, 10, 11 and 13 for determination of serum antibodies and isolation of peripheral blood lymphocytes (PBLs).

For studies with recombinant RPV, animals were infected with approximately 104 TCID50 units of virus in the right shoulder. Blood was taken at 3 to 4 day intervals for serology and isolation of PBLs. At 3 to 4 weeks post-infection, DTH tests were made (as described in Foster et al., 1998Down ), after which the appropriate challenge was performed with 104 TCID50 units of the virulent Saudi/81 strain of RPV or with 105 TCID50 units of FMDV strain O1 Lausanne. For the DTH tests, 20 µg of bacterially expressed GST or GST–3D, or 10 µg of RPV-infected/uninfected Vero cell protein, or 7·5 µg of FMDV total antigen was used in 100 µl PBS.

{blacksquare} In vitro immunological assays.
PBLs were isolated from bovine sera as described in García-Valcarel et al. (1996)Down . For proliferation studies, 105 cells were incubated with antigen (0·125 µg) in triplicate for 5 days. They were then pulsed with [methyl-3H]thymidine (NEN) for 6 h before harvesting onto glass-fibre filter mats and counting. The results are expressed as the stimulation index, the ratio of the 3H incorporated into cells incubated with antigen to that incorporated into cells incubated with medium alone.

Indirect ELISAs for measuring antibodies recognizing GST fusion proteins were performed as follows. Purified GST or fusion protein (250 ng per well) was used to coat 96-well microtitre plates (Nunc). After blocking in PBS–0·05% (v/v) Tween 20–3% (w/v) BSA, plates were incubated with duplicate threefold serial dilutions of test sera, starting from 1/100, for 1 h at 37 °C. The plates were further incubated with horseradish peroxidase-conjugated rabbit anti-bovine IgG (1/1000, Dakopatts), then developed with o-phenylenediamine dihydrochloride (OPD) solution (2·5 mg/ml OPD in 0·15 M citrate–phosphate buffer, pH 5 containing 1/1000 dilution of 20 vol. H2O2). The absorbance was measured at 492 nm. To calculate the ELISA score, readings from the linear range of dilutions were extrapolated to a notional absorbance at 1/100 dilution for an unsaturable assay.


   Results
TOP
Abstract
Introduction
Methods
Results
Discussion
References
 
In preliminary studies, the 3Dpol–FMDV15 (3D15) fusion protein was expressed in E. coli as a carboxy-terminal fusion with GST and then injected into cattle. Clear immune responses (Fig. 1Down) to the FMDV-derived elements of the fusion protein were found, although the boost injection given at week 7 was required for all animals to show anti-3D15 antibodies and proliferative responses. GST–3D gave a response intermediate between GST and GST–3D15, showing that both the 3Dpol and FMDV15 portions of the fusion protein were immunostimulatory (not shown).



View larger version (25K):
[in this window]
[in a new window]
 
Fig. 1. Immune responses in cattle to bacterially synthesized GST–3D15 fusion protein. Six cattle were injected with fusion protein as described in Methods, with a second injection given at 7 weeks [arrow in (a) and (b)]. At the times shown, serum and PBLs were prepared. (a) Direct binding ELISA was used to measure the relative amount of anti-GST (open symbols) and anti-GST–3D15 (closed symbols) present in the serum. (b) PBL proliferation induced by bacterially expressed fusion proteins. Cells from the individual animals were exposed to GST (open bars) or GST–3D15 (filled bars) and the separately determined stimulation indexes plotted stacked together.

 
In order to express the fusion protein from RPV, a new gene had to be created in the viral genome. Transcription of mRNAs from the genomes of nonsegmented negative-strand RNA viruses appears to be driven from a single promoter at the 3' end of the genome, and levels of transcription are dependent on the position of the gene along the genome (Pringle & Easton, 1997Down ); those genes nearest the promoter are expressed at higher levels (Wertz et al., 1998Down ). As a compromise between our desire for strong expression of the fusion protein and the need not to suppress expression of normal viral proteins to the point where an already attenuated virus became non-viable, we chose to introduce the new gene immediately downstream of the P gene. This should preserve normal levels of the nucleocapsid (N) and phospho (P) proteins, which are required in large amounts for genome replication.

The new `gene' consisted of new gene stop signal, intergenic trinucleotide and a minimal gene start signal, followed by a unique restriction site (AscI), all inserted in the 3' untranslated region (UTR) of the P gene. The gene start and end sequences of morbilliviruses are not fully conserved (Baron & Barrett, 1995Down ), and the exact roles played by individual bases have not been defined. We therefore duplicated existing sequences from the RPV genome for the new `gene', the gene stop/polyadenylation signal from the P gene and the gene start from the H gene. The sequence of the modified region of the genome (in mRNA sense) is shown in Fig. 2Down. The total length of the inserted nucleotides was 42, keeping the genome length a multiple of six, as appears to be necessary for replication of some paramyxoviruses, including Sendai virus (Calain & Roux, 1993Down ) and morbilliviruses (Radecke et al., 1995Down ; Baron & Barrett, 1997Down ). An open reading frame cloned into the AscI site should be transcribed and polyadenylated and, if it has a suitable translation initiation site (Kozak, 1984Down ), will be translated into the desired protein.



View larger version (17K):
[in this window]
[in a new window]
 
Fig. 2. Sequence of the modified region of the RPV genome in plasmid pRPVins. The new sequence inserted into the genome is highlighted (boxed). The gene start and end sequences of the final construct are marked, as are the original and new intergenic trinucleotides (underscored) and the unique AscI site (italics). The sequence is shown in antigenome sense, with numbering from the start of the antigenome.

 
The 3D15 construct was amplified by Pfu polymerase in a PCR, introducing the translation initiation signal and appropriate restriction sites in the primers. This DNA was then cloned into the modified genome plasmid and the sequence checked. Again, the total length of the inserted nucleotides was a multiple of six. Virus rescue was performed as previously described (Baron & Barrett, 1997Down ). The virus containing only the extra gene start and stop signals was never rescued, despite many transfections; the same genome plasmid, containing the full 3D15 insertion, was rescued as virus at the first attempt.

Cells infected with the rescued virus (rRPV-FMD) showed clear staining by antibodies to RPV proteins, to 3Dpol and to FMDV15 (Fig. 3Down). Immunoprecipitation of radiolabelled proteins synthesized in infected cells showed that the fusion protein was synthesized at a level similar to that of the viral P protein and could be precipitated by anti-3Dpol or anti-FMDV15 (Fig. 4),Down though somewhat poorly by the latter antibody. We also found that, as expected, the insertion of the extra gene had altered the relative levels of P and M made in infected cells (Fig. 5Down), and this alteration may be the cause of the slightly decreased growth rate of the virus in culture (Fig. 6Down).



View larger version (66K):
[in this window]
[in a new window]
 
Fig. 3. Expression of 3D15 in rRPV-FMD-infected cells. Vero cells were infected with rRPV (a, b, e, f) or rRPV-FMD (c, d, g, h), fixed at 2 days post-infection and labelled with mouse anti-RPV P protein (a, c) and rabbit anti-3D (b, d) or rabbit anti-RPV N protein (e, g) and mouse anti-FMDV15 (f, h). Bound antibody was visualized with FITC-labelled goat anti-rabbit IgG and Texas Red-labelled goat anti-mouse IgG, as described in Methods. Scale bar, 50 µm.

 


View larger version (31K):
[in this window]
[in a new window]
 
Fig. 4. Expression of 3D15 fusion protein in rRPV-FMD-infected cells. B95a cells were infected with rRPV (ac) or rRPV-FMD (dg) and labelled with 35S Pro-mix, lysed and aliquots of lysate extracted with various antibodies as described in Methods: (a), (d) rabbit anti-RPV-N plus rabbit anti-RPV-P; (b), (e) rabbit anti-3Dpol; (c), (f) mouse anti-FMDV15; (g) lysate from (e) re-extracted with anti-FMDV15. Immunoprecipitated proteins were analysed on a 10% SDS–PAGE gel and the gel fluorographed.

Fig. 5. Effect of gene insertion of expression of downstream genes. B95a cells were infected, labelled and lysed as in Fig. 4. Aliquots of lysate were extracted with the indicated antibodies ({alpha}M, mouse anti-RPV M monoclonal; {alpha}P, mouse anti-RPV P monoclonal) and the immunoprecipitated proteins analysed on a 12% SDS–PAGE gel, and the gel fluorographed.

 


View larger version (19K):
[in this window]
[in a new window]
 
Fig. 6. Growth of recombinant RPV in tissue culture. The total (cell associated and medium) virus present in cultures infected with rRPV (open symbols) or rRPV-FMD (closed symbols), in either B95a cells (triangles) or Vero cells (circles) was measured as described in Methods. Each line is the mean of two separate experiments.

 
Initially, six cattle were infected with rRPV-FMD, and one with unmodified rRPV. Three animals given rRPV-FMD and the rRPV control were challenged with virulent RPV 3 weeks post-infection and all were completely protected. The three remaining rRPV-FMD-infected animals were challenged with FMDV (strain O1), but no protection was found. Prior to challenge with either RPV or FMDV, all six experimental animals showed clear DTH responses to 3Dpol (Fig. 7Down), though not to FMDV (not shown), suggesting there was no recognition of the FMDV15 peptide. No proliferative response in PBLs to 3Dpol, FMDV15 or FMDV was detectable, nor were any antibodies recognizing 3Dpol or FMDV detected, either by ELISA or Western blot, although serum anti-RPV antibodies were detected as normal (not shown).



View larger version (40K):
[in this window]
[in a new window]
 
Fig. 7. Delayed-type hypersensitivity responses in cattle infected with rRPV (TE60) or rRPV-FMD (all other animals) 3 weeks prior to test. Antigen suspended in 100 µl PBS was injected intradermally as described in Methods, and the skin thickness measured 2 days later. The response is expressed as the increase in skin thickness over a control region of skin injected only with PBS.

 

   Discussion
TOP
Abstract
Introduction
Methods
Results
Discussion
References
 
We have shown that recombinant RPV can be constructed that produces large quantities of expressed heterologous protein in tissue culture. The virus was only slightly impaired in growth, and functioned normally as a vaccine against RPV. An interesting observation was that the genome with a whole new gene, including open reading frame, (pRPV-FMD) could be rescued without problems, whilst we have continually failed to rescue the genome with the much smaller inserted sequence containing only the gene start and end sequences (pRPVins). This cannot be due to an extra, deleterious, mutation in pRPVins, since the same plasmid stock was used to construct pRPV-FMD. We have since shown that the addition of an extra 66 bases at the AscI site of pRPVins renders it fully rescuable (M. D. Baron, unpublished), and this may have implications for the minimum length of a gene in RPV. If the new gene stop in RPVins was too close to the preceding gene start, and was not recognized by the viral polymerase, the resultant bicistronic mRNA would be the only transcript of the viral M gene. It would contain an AUG codon upstream of, and out of frame with, the normal M protein start codon, albeit in a poor context (CGCATGC), and this might have very serious consequences for virus viability. A form of measles virus (MV) has been rescued with no M gene (Cathomen et al., 1998Down ), and this virus is severely attenuated, and our own observations have suggested that the more attenuated the virus, the lower the frequency of rescue events in transfected cells. If the hypothetical virus RPVins did not express M protein, and was equally attenuated and hard to rescue, it is probable that we would have had to transfect 10 or 100 times as many cells in order to isolate the virus.

Although the heterologous protein expressed from the recombinant RPV-FMD was composed of regions of FMDV proteins known to be immunogenic in FMDV infection, and the fusion protein was itself shown to be immunogenic when injected directly into animals, only a minimal immune response was found in vivo when this protein was expressed using the recombinant RPV vaccine. There are several possible reasons why the observed response was so poor.

One explanation could be that RPV, like MV, is a lymphotropic virus. MV infection is immune suppressive, and we have observed a similar suppressive effect of RPV on lymphoid cell replication in culture (J. Heaney, T. Barrett & S. L. Cosby, unpublished). However, the suppression in vivo brought about by MV is characterized by a decrease in mitogen sensitivity and DTH responses, and we found normal responses to concanavalin A in PBLs from RPV-vaccinated animals (data not shown), and good DTH responses to both RPV and the FMDV 3Dpol. It is unlikely, therefore, that the animals were immune suppressed.

Alternatively, the expressed protein was not being correctly presented to elicit a humoral response. Cytoplasmically expressed proteins would be expected to generate peptides that would primarily enter the MHC class I presentation pathway after degradation by the proteasome (Driscoll et al., 1993Down ). However, there is clear evidence that peptides from cytoplasmically synthesized proteins can cross over into the MHC class II pathway (Brooks & McCluskey, 1993Down ; Aichinger & Lechler, 1995Down ). In addition, proteins released from dead cells can be taken up and degraded by specialist antigen-presenting cells, thereby entering the normal exogenous route to class II presentation. A polyepitope fusion protein expressed from vaccinia virus generated both cytotoxic T-cell and antibody responses to various components (An & Whitton, 1997Down ), showing that peptides from a single protein can enter both pathways. In our case, the generation of the Th1-dependent DTH reaction showed that peptides from 3Dpol were entering the class II pathway. In fact, the anti-3Dpol DTH response observed after infection with rRPV-FMD (6/6) was at least as good as that observed for single dose infection of cattle with FMDV itself [9/12 (Foster et al., 1998Down )].

On the other hand, FMDV infection invariably gives rise to detectable anti-3Dpol antibodies (Berger et al., 1990Down ), which were not found in the rRPV-FMD-infected animals. This difference may reflect the different cytopathologies of the (attenuated) RPV and normal FMDV: whilst the latter is highly lytic, at least in cultured cells, the former is not. Coupled with the low levels of replication achievable by a vaccine strain, it is possible that only a very small amount of intact 3D15 protein is being released in rRPV-FMD-infected animals to act as a target for the B cell repertoire. A recombinant virulent strain would doubtless express much higher levels of heterologous protein, but this would rather defeat the object of the exercise.

If the level of expression and release from the cell of the expressed non-RPV protein are the limiting factors, it will be necessary to improve the efficiency of delivery to the MHC class II pathway in order to maximize the response and improve the efficacy of this system as a vaccine delivery tool. Increased release of intact protein is also likely to be helpful. We have already found that adding a signal peptide to a protein, causing it to be translocated into the endoplasmic reticulum and secreted from infected cells, increases the serum antibody response, though not to 100% (E. P. Walsh, M. D. Baron & T. Barrett, unpublished). Further increases in immune stimulation may be achieved by anchoring the expressed protein in the cell membrane, targeting it either to the surface of the cell or to the endosomal/lysosomal compartment in which MHC class II molecules are loaded (Peters et al., 1991Down ; Marks et al., 1995Down ), and we are investigating these possibilities in our current research.


   Acknowledgments
 
We thank J. Thevesagaym and Dr J. Anderson for ELISA of anti-rinderpest antibodies, T. Rendell for anti-3Dpol ELISA, and Drs L Cedillo-Barron and R. M. E. Parkhouse for helpful discussions.


   References
TOP
Abstract
Introduction
Methods
Results
Discussion
References
 
Aichinger, G. & Lechler, R. I. (1995). Endogenous pathway of class II presentation. Biochemical Society Transactions 23, 657-660.[Medline]

Alfonso, A., Gomes, I. & Bahnemann, H. G. (1988). The induction of antibodies against VIAA in cattle vaccinated and revaccinated with inactivated foot-and-mouth disease vaccine. Boletin del Centro Panamericano de Fiebre Aftosa 54, 53-54.

An, L.-L. & Whitton, J. L. (1997). A multivalent vaccine, containing B-cell, cytotoxic T-lymphocyte, and Th epitopes from several microbes, induces appropriate responses in vivo and confers protection against more than one pathogen. Journal of Virology 71, 2292-2302.[Abstract]

Baron, M. D. & Garoff, H. (1990). Mannosidase II and the 135kDa Golgi-specific antigen recognized by monoclonal antibody 53FC3 are the same dimeric protein. Journal of Biological Chemistry 265, 19928-19931.[Abstract/Free Full Text]

Baron, M. D. & Barrett, T. (1995). Sequencing and analysis of the nucleocapsid (N) and polymerase (L) genes and the terminal extragenic domains of the vaccine strain of rinderpest virus. Journal of General Virology 76, 593-602.[Abstract/Free Full Text]

Baron, M. D. & Barrett, T. (1997). Rescue of rinderpest virus from cloned cDNA. Journal of Virology 71, 1265-1271.[Abstract]

Barrett, T., Belsham, G. J., Subbarao, S. M. & Evans, S. A. (1989). Immunization with a vaccinia recombinant expressing the F-protein protects rabbits from challenge with a lethal dose of rinderpest virus. Virology 170, 11-18.[Medline]

Berger, H. G., Straub, O. C., Ahl, R., Tesar, M. & Marquardt, O. (1990). Identification of foot-and-mouth disease virus replication in vaccinated cattle by antibodies to nonstructural virus proteins. Vaccine 8, 213-216.[Medline]

Broekhuijsen, M. P., Blom, T., Kottenhagen, M., Pouwels, P. H., Meloen, R. H., Barteling, S. J. & Enger-Valk, B. E. (1986). Synthesis of fusion proteins containing the antigenic determinants of foot-and-mouth disease virus. Vaccine 4, 119-124.[Medline]

Broekhuijsen, M. P., Van Rijn, J. M. M., Blom, A. J. M., Pouwels, P. H., Enger-Valk, B. E., Brown, F. & Francis, M. J. (1987). Fusion proteins with multiple copies of the major antigenic determinant of foot-and-mouth disease virus protect both the natural host and laboratory animals. Journal of General Virology 68, 3137-3143.[Abstract/Free Full Text]

Brooks, A. G. & McCluskey, J. (1993). Class II-restricted presentation of a hen egg lysozyme determinant derived from endogenous antigen sequestered in the cytoplasm or endoplasmic reticulum of the antigen presenting cells. Journal of Immunology 150, 3690-3697.[Abstract]

Bukreyev, A., Camargo, E. & Collins, P. L. (1996). Recovery of infectious respiratory syncytial virus expressing an additional foreign gene. Journal of Virology 70, 6634-6641.[Abstract/Free Full Text]

Calain, P. & Roux, L. (1993). The rule of six, a basic feature for efficient replication of Sendai virus defective interfering RNA. Journal of Virology 67, 4822-4830.[Abstract/Free Full Text]

Cathomen, T., Mrkic, B., Spehener, D., Drillien, R., Naef, R., Pavlovic, J., Aguzzi, A., Billeter, M. A. & Cattaneo, R. (1998). A matrix-less measles virus is infectious and elicits extensive cell fusion: consequences for propagation in the brain. EMBO Journal 17, 3899.[Medline]

Chamberlain, J. P. (1979). Fluorographic detection of radioactivity in polyacrylamide gels with water-soluble fluor, sodium salicylate. Analytical Biochemistry 98, 132-135.[Medline]

Clarke, B. E., Newton, S. E., Carroll, A. R., Francis, M. J., Appleyard, G., Syred, A. D., Highfield, P. E., Rowlands, D. J. & Brown, F. (1987). Improved immunogenicity of a peptide epitope after fusion to hepatitis B core antigen. Nature 330, 381-384.[Medline]

Collen, T., Baron, J., Childerstone, A., Corteyn, A., Doel, T. R., Flint, M., Garcia-Valcarel, M., Parkhouse, R. M. E. & Ryan, M. D. (1998). Heterotypic recognition of recombinant FMDV proteins by bovine T-cells: the polymerase (P3Dpol) as an immunodominant T-cell immunogen. Virus Research 56, 125-133.[Medline]

Cowan, K. M. & Graves, J. H. (1966). A third antigenic component associated with foot-and-mouth disease infection. Virology 30, 528-540.[Medline]

Dawe, P. S. & Pinto, A. A. (1978). Antibody responses to type-specific and `virus-infection-associated' antigens in cattle vaccinated with inactivated polyvalent foot-and-mouth disease virus in North Malawi. British Veterinary Journal 134, 504-511.

DiMarchi, R., Brooke, G., Gale, C., Cracknell, V., Doel, T. & Mowat, N. (1986). Protection of cattle against foot-and-mouth disease by a synthetic peptide. Science 232, 639-641.[Abstract/Free Full Text]

Driscoll, J., Brown, M. G., Finley, D. & Monaco, J. J. (1993). MHC-linked gene products specifically alter peptidase activities of the proteasome. Nature 365, 262-264.[Medline]

Fernandez, A. A., Mello, P. A. D., Gomes, I. & Rosenberg, F. (1975). The use of virus-infection-associated antigen (VIA) in the detection of cattle exposed to FMDV. Boletin del Centro Panamericano de Fiebre Aftosa 17/18, 17-22.

Foster, M., Cook, A., Cedillo, L. & Parkhouse, R. M. E. (1998). Serological and cellular immune responses to non-structural proteins in animals infected with FMDV. Veterinary Quarterly 20, S28-S30.

Foster-Cuevas, M. (1996). Immunodeterminants of foot-and-mouth disease virus. PhD thesis, University of Hertfordshire, Hatfield, Herts, UK.

Francis, M. J., Hastings, G. Z., Clarke, B. E., Brown, A. L., Beddell, C. R., Rowlands, D. J. & Brown, F. (1990). Neutralising antibodies to all seven serotypes of foot-and-mouth disease virus elicited by synthetic peptides. Immunology 69, 171-176.[Medline]

García-Valcarel, M., Doel, T., Collen, T., Ryan, M. & Parkhouse, R. M. E. (1996). Recognition of foot-and-mouth disease virus and its capsid protein VP1 by bovine peripheral T lymphocytes. Journal of General Virology 77, 727-735.[Abstract/Free Full Text]

Garcin, D., Pelet, T., Calain, P., Roux, L., Curran, J. & Kolakofsky, D. (1995). A highly recombinogenic system for the recovery of infectious Sendai paramyxovirus from cDNA: generation of a novel copy-back nondefective interfering virus. EMBO Journal 14, 6087-6094.[Medline]

Geysen, H. M., Meloen, R. H. & Barteling, S. J. (1984). Use of peptide synthesis to probe viral antigens for epitopes to a resolution of a single amino acid. Proceedings of the National Academy of Sciences, USA 81, 3998-4002.[Abstract/Free Full Text]

Glass, E. J., Oliver, R. A., Collen, T., Doel, T. R., Di Marchi, R. & Spooner, R. L. (1991). MHC class II restricted recognition of FMDV peptides by bovine T cells. Immunology 74, 594-599.[Medline]

Hasan, M. K., Kato, A., Shioda, T., Sakai, Y., Yu, D. S. & Nagai, Y. (1997). Creation of an infectious recombinant Sendai virus expressing the firefly luciferase gene from the 3' proximal first locus. Journal of General Virology 78, 2813-2820.[Abstract]

Jin, H., Clarke, D., Zhou, H. Z.-Y., Cheng, X., Coelingh, K., Bryant, M. & Li, S. (1998). Recombinant human respiratory syncytial virus (RSV) from cDNA and construction of subgroup A and B chimeric RSV. Virology 251, 206-214.[Medline]

Kozak, M. (1984). Compilation and analysis of sequences upstream from the translational start site in eukaryotic mRNAs. Nucleic Acids Research 12, 857-872.[Abstract/Free Full Text]

Laemmli, U. K. (1970). Cleavage of structural protein during the assembly of the head of bacteriophage T4. Nature 227, 680-685.[Medline]

Lawson, N. D., Stillman, E. A., Whitt, M. A. & Rose, J. K. (1995). Recombinant vesicular stomatitis viruses from DNA. Proceedings of the National Academy of Sciences, USA 92, 4477-4481.[Abstract/Free Full Text]

Marks, M. S., Roche, P. A., van Donselaar, E., Woodruff, L., Peters, P. J. & Bonifacino, J. S. (1995). A lysosomal targeting signal in the cytoplasmic tail of the ß chain directs HLA-DM to MHC class II compartments. Journal of Cell Biology 131, 351-369.[Abstract/Free Full Text]

Mebatsion, T., Schnell, M. J., Cox, J. H., Finke, S. & Conzelmann, K.-K. (1996). Highly stable expression of a foreign gene from rabies virus vectors. Proceedings of the National Academy of Sciences, USA 93, 7310-7314.[Abstract/Free Full Text]

Mebatsion, T., Finke, S., Weiland, F. & Conzelmann, K.-K. (1997). A CXCR4/CD4 pseudotype rhabdovirus that selectively infects HIV-1 envelope protein-expressing cells. Cell 90, 841-847.[Medline]

Morgan, D. O. & Moore, D. M. (1990). Protection of cattle and swine against foot-and-mouth disease using biosynthetic peptide vaccines. American Journal of Veterinary Research 51, 40-45.[Medline]

Moriya, C., Shioda, T., Tashiro, K., Nagasawa, T., Ikegawa, M., Ohnishi, Y., Kato, A., Hu, H. L., Xin, X. M., Hasan, M. K., Maekawa, M., Takebe, Y., Sakai, Y., Honjo, T. & Nagai, Y. (1998). Large quantity production with extreme convenience of human SDF-1 alpha and SDF-1 beta by a Sendai virus vector. FEBS Letters 425, 105-111.[Medline]

Peters, P. J., Neefjes, J. J., Oorschot, V., Pleogh, H. L. & Geuze, H. J. (1991). Segregation of MHC class II molecules from MHC class I molecules in the Golgi complex for transport to lysosomal compartments. Nature 349, 669-676.[Medline]

Polatnick, J. & Wool, S. (1981). Characterization of the 70S polyuridylic acid polymerase isolated from foot-and-mouth disease virus infected cells. Journal of Virology 40, 881-889.[Abstract/Free Full Text]

Pringle, C. R. & Easton, A. J. (1997). Monopartite negative strand genomes. Seminars in Virology 8, 49-57.

Radecke, F., Spielhofer, P., Schneider, H., Kaelin, K., Huber, M., Dotsch, C., Christiansen, G. & Billeter, M. A. (1995). Rescue of measles viruses from cloned DNA. EMBO Journal 14, 5773-5784.[Medline]

Ryan, M. D., Belsham, G. J. & King, A. M. Q. (1989). Specificity of enzyme–substrate interactions in foot-and-mouth disease polyprotein processing. Virology 173, 35-45.[Medline]

Salt, J. S. (1993). The carrier state in foot and mouth disease – an immunological review. British Veterinary Journal 149, 207-223.

Schnell, M. J., Mebatsion, T. & Conzelmann, K.-K. (1994). Infectious rabies virus from cloned cDNA. EMBO Journal 13, 4195-4203.[Medline]

Schnell, M. J., Buonocore, L., Whitt, M. A. & Rose, J. K. (1996). The minimal conserved transcription stop-start signal promotes stable expression of a foreign gene in vesicular stomatitis virus. Journal of Virology 70, 2318-2323.[Abstract]

Schnell, M. J., Johnson, J. E., Buonocore, L. & Rose, J. K. (1997). Construction of a novel virus that targets HIV-1-infected cells and controls HIV-1 infection. Cell 90, 857.

Singh, M. & Billeter, M. A. (1999). A recombinant measles virus expressing biologically active human interleukin-12. Journal of General Virology 80, 101-106.[Abstract]

Spielhofer, P., Bächi, T., Fehr, T., Christiansen, G., Cattaneo, R., Kaelin, K., Billeter, M. A. & Naim, H. Y. (1998). Chimeric measles viruses with a foreign envelope. Journal of Virology 72, 2150-2159.[Abstract/Free Full Text]

Strohmaier, K., Franze, R. & Adams, K.-H. (1982). Localization and characterization of the antigenic portion of foot-and-mouth disease virus protein. Journal of General Virology 59, 295-306.[Abstract/Free Full Text]

Takada, A., Robison, C., Goto, H., Sanchez, A., Murti, K. G., Whitt, M. A. & Kawaoka, Y. (1997). A novel system for functional analysis of Ebola virus glycoproteins. Proceedings of the National Academy of Sciences, USA 94, 14764-14769.[Abstract/Free Full Text]

Timm, B., Kondor-Koch, C., Lehrach, H., Riedel, H., Edström, J.-E. & Garoff, H. (1983). Expression of viral membrane proteins from cloned cDNA by microinjection into eukaryotic cell nuclei. Methods in Enzymology 96, 496-511.[Medline]

Wertz, G. W., Perepelitsa, V. P. & Ball, L. A. (1998). Gene rearrangement attenuates expression and lethality of a nonsegmented negative strand RNA virus. Proceedings of the National Academy of Sciences, USA 95, 3501-3506.[Abstract/Free Full Text]

Whelan, S. P. J., Ball, L. A., Barr, J. N. & Wertz, G. T. W. (1995). Efficient recovery of infectious vesicular stomatitis virus entirely from cDNA clones. Proceedings of the National Academy of Sciences, USA 92, 8388-8392.[Abstract/Free Full Text]

Yu, D., Shioda, T., Kato, A., Hasan, M. K., Sakai, Y. & Nagai, Y. (1997). Sendai virus-based expression of HIV-1 gp120: reinforcement by the V(-)version. Genes to Cells 2, 457-466.[Abstract]

Received 15 March 1999; accepted 13 May 1999.


This article has been cited by other articles:


Home page
Proc. Natl. Acad. Sci. USAHome page
M. Yoneda, V. Guillaume, F. Ikeda, Y. Sakuma, H. Sato, T. F. Wild, and C. Kai
Establishment of a Nipah virus rescue system
PNAS, October 31, 2006; 103(44): 16508 - 16513.
[Abstract] [Full Text] [PDF]


Home page
J. Gen. Virol.Home page
M. Mahapatra, S. Parida, M. D. Baron, and T. Barrett
Matrix protein and glycoproteins F and H of Peste-des-petits-ruminants virus function better as a homologous complex
J. Gen. Virol., July 1, 2006; 87(7): 2021 - 2029.
[Abstract] [Full Text] [PDF]


Home page
J. Gen. Virol.Home page
M. D. Baron
Wild-type Rinderpest virus uses SLAM (CD150) as its receptor
J. Gen. Virol., June 1, 2005; 86(6): 1753 - 1757.
[Abstract] [Full Text] [PDF]


Home page
J. Gen. Virol.Home page
H. Zhao and B. P. H. Peeters
Recombinant Newcastle disease virus as a viral vector: effect of genomic location of foreign gene on gene expression and virus replication
J. Gen. Virol., April 1, 2003; 84(4): 781 - 788.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
T. Nakaya, J. Cros, M.-S. Park, Y. Nakaya, H. Zheng, A. Sagrera, E. Villar, A. Garcia-Sastre, and P. Palese
Recombinant Newcastle Disease Virus as a Vaccine Vector
J. Virol., December 1, 2001; 75(23): 11868 - 11873.
[Abstract] [Full Text]


Home page
J. Virol.Home page
E. P. Walsh, M. D. Baron, L. F. Rennie, P. Monaghan, J. Anderson, and T. Barrett
Recombinant Rinderpest Vaccines Expressing Membrane-Anchored Proteins as Genetic Markers: Evidence of Exclusion of Marker Protein from the Virus Envelope
J. Virol., November 1, 2000; 74(21): 10165 - 10175.
[Abstract] [Full Text]


Home page
J. Virol.Home page
S. C. Das, M. D. Baron, and T. Barrett
Recovery and Characterization of a Chimeric Rinderpest Virus with the Glycoproteins of Peste-des-Petits-Ruminants Virus: Homologous F and H Proteins Are Required for Virus Viability
J. Virol., October 1, 2000; 74(19): 9039 - 9047.
[Abstract] [Full Text]


Home page
J. Virol.Home page
M. D. Baron and T. Barrett
Rinderpest Viruses Lacking the C and V Proteins Show Specific Defects in Growth and Transcription of Viral RNAs
J. Virol., March 15, 2000; 74(6): 2603 - 2611.
[Abstract] [Full Text]


Home page
J. Gen. Virol.Home page
E. P. Walsh, M. D. Baron, J. Anderson, and T. Barrett
Development of a genetically marked recombinant rinderpest vaccine expressing green fluorescent protein
J. Gen. Virol., March 1, 2000; 81(3): 709 - 718.
[Abstract] [Full Text]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via CrossRef
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Baron, M. D.
Right arrow Articles by Barrett, T.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Baron, M. D.
Right arrow Articles by Barrett, T.
Agricola
Right arrow Articles by Baron, M. D.
Right arrow Articles by Barrett, T.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
INT J SYST EVOL MICROBIOL MICROBIOLOGY J GEN VIROL
J MED MICROBIOL ALL SGM JOURNALS