J Gen Virol Try Microbiology Online
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via CrossRef
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Dong, X.-P.
Right arrow Articles by Pfister, H.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Dong, X.-P.
Right arrow Articles by Pfister, H.
Agricola
Right arrow Articles by Dong, X.-P.
Right arrow Articles by Pfister, H.
Journal of General Virology (1999), 80, 2097-2101.
© 1999 Society for General Microbiology


Animal: DNA Viruses

Overlapping YY1- and aberrant SP1-binding sites proximal to the early promoter of human papillomavirus type 16

Xiao-Ping Dongb,1 and Herbert Pfister1

Institute of Virology, Universität zu Köln, Fürst-Pückler Str. 56, 50935 Köln, Germany1

Author for correspondence: Herbert Pfister.Fax +49 221 4783902. e-mail Herbert.Pfister{at}medizin.uni-koeln.de


   Abstract
TOP
Abstract
Main text
References
 
Transcription of oncogenes E6 and E7 of human papillomavirus type 16 (HPV-16) from the P97 promoter is regulated by viral and cellular proteins. The transcription factor YY1 represses transcription through binding to cognate sequences in the long control region (LCR). In HPV-16 DNA from cervical carcinomas, mutations of YY1-binding sites have been identified that increase P97 activity 3–6-fold. A second, SP1-binding site has now been identified in the HPV-16 LCR (nt 7842–7847), which overlaps the YY1-binding site at positions 7840–7848. A point mutation within this YY1 site in viral DNA from a cervical cancer, previously shown to prevent YY1 binding, was shown to increase SP1 binding and P97 activity 4·7-fold. An engineered mutant eliminating SP1 binding showed only 1- to 1·6-fold increased P97 activity. It is concluded that competition between SP1 and YY1 for DNA binding plays a major role in YY1 repression mediated by the binding site at positions 7840–7848.


   Main text
TOP
Abstract
Main text
References
 
Transcription of oncogenes E6 and E7 of human papillomavirus type 16 (HPV-16) initiates at the early promoter P97 and is regulated by viral and cellular proteins. Besides the viral E2 protein, which binds four cognate sequences in the long control region (LCR), a number of cellular factors, including AP1 (Chan et al., 1990Down ), NF1 (Apt et al., 1993Down ), Oct1 (O'Connor & Bernard, 1995Down ), SP1 (Gloss & Bernard, 1990Down ), TEF1 (Ishiji et al., 1992Down ), YY1 (May et al., 1994Down ; Dong et al., 1994Down ), NF-IL6 (Kyo et al., 1993Down ), PEF1 (Sibbet et al., 1995Down ) and glucocorticoid/progesterone receptors (Chan et al., 1989Down ), have each been reported to interact with several specific recognition sites, distributed or clustered within the LCR.

Several mechanisms have been described to explain the different regulatory effects of YY1. In some cases, YY1 competes for DNA binding with an activator protein, such as nuclear serum response factor in muscle {alpha}-actin (Lee et al., 1992Down ) and c-fos (Natesan & Gilman, 1995Down ) promoters and with NF-{kappa}B in the rat serum amyloid A1 gene promoter (Lu et al., 1994Down ). Another possibility is heterodimerization of YY1 with transcription regulators such as c-Myc (Shrivastava et al., 1993Down ), E1A (Lee et al., 1995Down ) or B23 (Inouye & Seto, 1994Down ). In addition, YY1 may act as a DNA-bending protein and regulate promoters through an effect on DNA structure (Natesan & Gilman, 1993Down ; Klug & Beato, 1996Down ). Recent findings indicate that YY1 interacts with the non-DNA-binding transcription factor RPD3 and negatively regulates transcription through tethering RPD3 to the promoter region (Yang et al., 1996Down ; Pazin & Kadonaga, 1997Down ).

Several YY1-binding sites have been reported in the HPV-16 LCR (May et al., 1994Down ; O'Connor et al., 1996Down ). Single nucleotide exchanges observed in the promoter-distal (nt 7791–7799) and -proximal (nt 7840–7848) YY1-binding sites in HPV-16 DNA from cervical carcinomas abolished the binding capacity for YY1 protein in vitro and, in the context of the whole LCR, the point mutation in the promoter-distal YY1 site induced a roughly 4-fold increase in P97 activity in transient transfection assays (May et al., 1994Down ; Dong et al., 1994Down ). The mechanism of YY1 repressive activity in HPV-16 remains unclear. More recently, O'Connor et al. (1996)Down concluded that YY1 repressed HPV-16 transcription by quenching AP1 activity. In this report, we provide evidence that YY1 represses promoter activity by competing with SP1 for DNA binding at the promoter-proximal YY1-binding motif.

The nucleotide sequence within the promoter-proximal YY1-binding site is CATGGG (nt 7842–7847), which could represent an SP1-binding motif. To address this possibility, we carried out electrophoretic mobility shift assays (EMSA) with double-stranded oligonucleotides (nt 7836–7875) that cover the promoter-proximal YY1-binding site, as described previously (Dong et al., 1994Down ). Purified SP1 protein from nuclear extracts of HeLa cells was obtained from a commercial supplier (Promega). The His–YY1 fusion protein was expressed in E. coli RR cells grown at 30 °C to an OD600 of 0·7 (Shi et al., 1991Down ). The expression plasmid was induced by addition of IPTG (final concentration 1 mM). After a further 4 h incubation, bacteria were pelleted and lysed in 6 M guanidine–HCl, pH 8·0. The His–YY1 protein was purified by affinity chromatography on Ni–NTA agarose (Qiagen) and renatured as described previously (May et al., 1994Down ). Different amounts of protein were mixed with 20000–40000 Cerenkov c.p.m. of end-32P-labelled, double-stranded oligonucleotide probe in 20 µl and the DNA–protein complexes were separated from unbound probe in a 4% non-denaturing polyacrylamide gel (Dong et al., 1994Down ). The oligonucleotide WT, containing the wild-type HPV-16 sequence, formed complexes not only with YY1 but also with SP1 protein (Fig. 1Downa, lanes 1 and 2). This demonstrates that, besides the SP1-binding site (nt 28–33) upstream of P97 (Gloss & Bernard, 1990Down ), there was another SP1-binding motif within the 40 bp HPV-16 subfragment tested.



View larger version (40K):
[in this window]
[in a new window]
 
Fig. 1. EMSA of HPV-16-specific, double-stranded oligonucleotides with YY1 and SP1 proteins. Oligonucleotide WT represents the HPV-16 wild-type LCR from positions 7863–7875, containing the promoter-proximal YY1-binding site at nt 7840–7848. Oligonucleotide PM has an A to G mutation at nt 7843 and oligonucleotide C has a five nucleotide exchange in this YY1-binding site. The nucleotide sequences of these three oligonucleotides were described previously (Dong et al., 1994Down ). Oligonucleotide SP1 is an HPV-18 subfragment containing a characterized SP1-binding site (5' AGGGAGTAACCGAAAACGGT 3'; Rose et al., 1998Down ). Oligonucleotide T7 represents E. coli T7 promoter-specific double-stranded sequences (5' TCGATAATACGACTCACTATAGGGAGAAGATC 3'). (a) Interactions of 32P-labelled oligonucleotide WT with fusion protein His–YY1 and SP1. (b) Interactions of 32P-labelled oligonucleotides WT, PM and C with SP1. F, free probe.

 
To see whether formation of the SP1–DNA complex was really due to the CATGGG motif, we used oligonucleotides PM, with an A to G mutation at position 7843, and C, with a five nucleotide exchange from nt 7843–7847. Both mutated oligonucleotides have been shown to have lost YY1-binding capacity (Dong et al., 1994Down ). Oligonucleotide C, with the sequence CGCTAC instead of CATGGG, formed no complex with the SP1 protein (Fig. 1bUp, lanes 5 and 6), while the A to G exchange significantly increased SP1 binding (Fig. 1bUp, compare lanes 1 and 2 with 3 and 4). The specific SP1–DNA complex was no longer formed in the presence of a 400-fold excess of unlabelled, double-stranded HPV-18 sequences that contain a previously characterized SP1-binding site (oligonucleotide H18-SP1; Rose et al., 1998Down ), while it was not affected by competition with the same amount of heterologous T7 promoter double-stranded sequences (lanes 7 and 8). These results indicate that SP1 does bind to the suspected domain. The more pronounced shift observed with oligonucleotide PM, with the A to G exchange, may be explained by a higher affinity of SP1 for a CG structure than for a CA structure (Kadonaga et al., 1986Down ).

Since the newly identified SP1 motif overlaps the promoter-proximal YY1-binding site completely, it is reasonable to think that SP1 will compete with YY1 for binding at this position. When YY1 and SP1 were mixed for EMSA with 32P-labelled oligonucleotide WT at the concentrations used for YY1- and SP1-specific shifts (Fig. 1aUp, lanes 1 and 2), there was no additional complex detectable, indicating that the proteins are not able to bind to the same DNA molecule and that no protein–protein interaction occurs between DNA-bound YY1 and SP1 (Fig. 1aUp, lane 3). The SP1-specific complex appeared clearly less prominent than in lane 2, suggesting a greater ability of YY1 to bind this site. With increasing amounts of SP1 protein, the SP1–DNA complex became more apparent at the expense of the YY1–DNA complex (Fig. 1aUp, lane 4).

To evaluate the relative occupation of nucleotides 7840–7848 by YY1 and SP1 at the concentrations that occur in cervical carcinoma cells, we performed EMSA with nuclear extracts of HT3, HeLa and C33a cells. The cells were grown in DMEM supplemented with 10% foetal calf serum and harvested by trypsinization. After washing twice with PBS (Gibco), the cells were lysed on ice for 15 min with 1 ml lysis buffer (0·6% NP-40, 300 mM sucrose, 10 mM HEPES, pH 7·9, 1 mM EDTA, 1·5 mM MgCl2, 50 mM PMSF, 0·5 mM DTT). The nuclei were pelleted by centrifugation and incubated on ice for 1 h in 0·1 ml elution buffer (25%, v/v, glycerol, 10 mM HEPES, pH 7·9, 0·1 mM EDTA, 0·1 mM EGTA, 1·5 mM MgCl2, 525 mM PMSF, 0·5 mM DTT). The supernatants were collected and stored in aliquots at -80 °C after determining the protein concentration. After mixing the nuclear extracts with 32P-labelled, double-stranded oligonucleotide WT, several complexes were detected by EMSA, two of which (A and D) migrated to similar positions to those of the SP1- and YY1-specific complexes obtained with purified proteins (Fig. 2Down, lanes 1–5). The identity of these complexes was confirmed by competition experiments with 50- or 400-fold excesses of different unlabelled oligonucleotides. Complex A was competed for by oligonucleotide SP1 and more efficiently by oligonucleotide PM (Fig. 2Down, lanes 9–12), which both contain SP1-binding sites. Complex D was not detectable in the presence of oligonucleotide AAV (Fig. 2Down, lanes 7 and 8), containing a genuine YY1-binding site. Both complexes were not affected by 50-fold excesses of the complementary competitors or of oligonucleotide C (Fig. 2Down, lane 14), binding neither SP1 nor YY1. No specificity could be assigned to complexes B, C and E, which were removed by a 400-fold excess of any unlabelled competitor. Both YY1- and SP1-specific complexes were clearly visible with all three nuclear extracts tested, with the SP1-specific band appearing considerably stronger.



View larger version (53K):
[in this window]
[in a new window]
 
Fig. 2. EMSA of oligonucleotide WT with nuclear extracts from cervical carcinoma cell lines C33a, HT3 and HeLa. Oligonucleotides SP1, PM and C, used as competitors, are described in Fig. 1. Oligonucleotide AAV represents a subfragment of adeno-associated virus containing a YY1-binding site (5' CCCGCTTCAAAATGGAGAACCCT 3'; Shi et al., 1991Down ). The competition assays were carried out only with the extracts of HeLa cells. F, free probe.

 
To see whether the naturally occurring nucleotide exchange within the overlapping YY1- and SP1-binding sites, which affected protein binding in vitro, also influenced P97 activity, we transfected luciferase reporter plasmids, which contained different lengths of the wild-type HPV-16 LCR or the LCR with the A to G exchange at nt 7843 (pPM-pro), into C33a cells. All the constructs were based on the luciferase expression plasmid pA-luc (Dong et al., 1994Down ). Plasmids pH16-7004 and pPM-pro-7004 (previously designated pH16 and pT432; Dong et al., 1994Down ) represent the whole HPV-16 LCR (Fig. 3Down). To generate plasmids pH16-7463 and pPM-pro-7463, which represent the LCR shortened to the beginning of the enhancer, plasmids pBS-H16 and pBS-T432 (containing the whole LCR cloned in pBS M13+) were cleaved by SphI and religated, removing the HPV-16 LCR sequences from positions 7004–7462. The shortened HPV-16 subfragments were released from the vector with HindIII and BamHI and subcloned into the respective sites of pA-luc. Under the control of the whole HPV-16 LCR and the 5'-deleted LCR starting with the beginning of the enhancer, the point mutation induced 4·72- and 3·72-fold increases in luciferase expression. This demonstrates that the nucleotide exchange in the overlapping YY1- and SP1-binding site, which abolished YY1-binding ability in vitro, can increase the activity of the promoter P97. We previously failed to detect a stimulatory effect of the PM mutation in HT3 cells (Dong et al., 1994Down ). However, a re-evaluation showed that this mutant also reveals a 3–4-fold increased promoter activity in HT3 cells (data not shown).



View larger version (22K):
[in this window]
[in a new window]
 
Fig. 3. A naturally occurring point mutation in the overlapping YY1- (nt 7840–7848) and SP1- (nt 7843–7847) binding sites increases the activity of the promoter P97, whereas abolishing both YY1 and SP1 binding to the overlapping binding sites (nt 7840–7848) has little or no effect on P97. The various lengths of HPV-16 LCR fragments cloned in pA-luc are presented schematically. The luciferase assays were carried out as described previously (Dong et al., 1994Down ). The activities are means from at least three independent experiments in C33a cells and are presented relative to that of pH16-7004. The fold stimulation induced by the mutation is given to the right.

 
To examine the effect of destruction of both YY1- and SP1-binding activity on the P97 promoter, we generated equal-length HPV-16 LCRs with the five nucleotide exchange at nt 7843–7847. Plasmid pC-7004 was constructed by site-directed mutagenesis achieved with a PCR protocol. The primers for the first PCR were reverse primer (5' AACAGCTATGACCATG 3', pBS M13+ sequence) and H16-LS (5' TTTACAAATGAACAATGTATG 3'); the primers for the second PCR were C-7836 (Dong et al., 1994Down ) and M13 -20 (5' GTAAAACGACGGCCAGT 3', pBS M13+ sequence). The amplified products were digested with HindIII (first PCR product) and BamHI (second PCR product), cloned into pUC19 and subcloned into pA-luc. To generate pC-7463, plasmid pC-7004 cloned in pUC19 was cleaved with SphI and religated. The shortened insert was released from pUC19 with HindIII and BamHI and subcloned into pA-luc. Transfection assays showed similar luciferase expression for both mutated LCR constructs and the respective wild-type LCR constructs (Fig. 3Up), indicating that binding of YY1 to nucleotides 7840–7848 contributes little to the overall repression by YY1 except for by competition with SP1.

This analysis thus provides evidence for another mechanism of YY1 repression. SP1-binding sites are usually located and clustered in front of TATA boxes or TATA-less promoters. SP1 acts as a transcription activator or initiator through binding to its cognate sequences. In the HPV-16 LCR, one SP1-binding site (nt 28–33) has been mapped in front of promoter P97 close to an E2-binding site (Gloss & Bernard, 1990Down ). Although SP1 is generally considered to be a protein that interacts with promoter-proximal elements, it also mediates long-range activation of transcription via protein–protein interactions between DNA-bound SP1 molecules or SP1 and other transcription factors. Two SP1-recognition sites within the HPV-16 LCR offer the possibility to form a loop (Su et al., 1991Down ), which could contribute to the activation of P97 because the enhancer element would move closer to the transcription initiation complex. Competition between YY1 and SP1 for binding to nt 7840–7848 could theoretically hinder SP1-mediated activation of P97.

As expected in view of the completely overlapping YY1 and SP1 recognition sites, binding of both proteins to the oligonucleotide 7836–7875 in vitro was indeed mutually exclusive. At the same protein concentration, YY1 bound more efficiently than SP1. However, the SP1-specific complex turned out to be more prominent than the YY1-specific complex when using nuclear extracts of cervical carcinoma cell lines for EMSA. This suggests a predominance of SP1, which is in line with the presence of high levels of SP1 in C33a cells (Apt et al., 1996Down ). One would therefore expect that repression by YY1 through competition with SP1 is more relevant in normal keratinocytes, with lower SP1 concentrations compared with tumour cells (Apt et al., 1996Down ). In spite of the rather unfavourable ratio of YY1 and SP1 in C33a cells, the PM mutation led to an approximately 5-fold activation. This will be the result of both removal of competitive YY1 binding and the higher affinity of SP1 further increasing the amount of SP1 binding to this site.

An increased concentration of SP1 was not only observed in transformed keratinocytes but also in differentiated ones (Apt et al., 1996Down ). The newly established competition between the activator SP1 and repressor YY1 could therefore contribute to the increased activity of the HPV-16 oncogene promoter in the course of epithelial differentiation and tumour progression.


   Acknowledgments
 
We thank Dr Thomas Shenk for the bacterial YY1 expression vector. This work was supported by the Deutsche Forschungsgemeinschaft (SFB 247/A9).


   Footnotes
 
b Present address: Institute of Virology, Chinese Academy of Preventive Medicine, Ying-Xin St 100, 100052 Beijing, People's Republic of China. Back


   References
TOP
Abstract
Main text
References
 
Apt, D., Chong, T., Liu, Y. & Bernard, H. U. (1993). Nuclear factor I and epithelial cell-specific transcription of human papillomavirus type 16. Journal of Virology 67, 4455-4463.[Abstract/Free Full Text]

Apt, D., Watts, R. M., Suske, G. & Bernard, H. U. (1996). High Sp1/Sp3 ratios in epithelial cells during epithelial differentiation and cellular transformation correlate with the activation of the HPV-16 promoter. Virology 224, 281-291.[Medline]

Chan, W. K., Klock, G. & Bernard, H. U. (1989). Progesterone and glucocorticoid response elements occur in the long control regions of several human papillomaviruses involved in anogenital neoplasia. Journal of Virology 63, 3261-3269.[Abstract/Free Full Text]

Chan, W. K., Chong, T., Bernard, H. U. & Klock, G. (1990). Transcription of the transforming genes of the oncogenic human papillomavirus-16 is stimulated by tumor promoters through AP1 binding sites. Nucleic Acids Research 18, 763-769.[Abstract/Free Full Text]

Dong, X.-P., Stubenrauch, F., Beyer-Finkler, E. & Pfister, H. (1994). Prevalence of deletions of YY1-binding sites in episomal HPV 16 DNA from cervical cancers. International Journal of Cancer 58, 803-808.

Gloss, B. & Bernard, H. U. (1990). The E6/E7 promoter of human papillomavirus type 16 is activated in the absence of E2 proteins by a sequence-aberrant Sp1 distal element. Journal of Virology 64, 5577-5584.[Abstract/Free Full Text]

Inouye, C. J. & Seto, E. (1994). Relief of YY1-induced transcriptional repression by protein–protein interaction with the nucleolar phosphoprotein B23. Journal of Biological Chemistry 269, 6506-6510.[Abstract/Free Full Text]

Ishiji, T., Lace, M. J., Parkkinen, S., Anderson, R. D., Haugen, T. H., Cripe, T. P., Xiao, J.-H., Davidson, I., Chambon, P. & Turek, L. P. (1992). Transcriptional enhancer factor (TEF)-1 and its cell-specific co-activator activate human papillomavirus-16 E6 and E7 oncogene transcription in keratinocytes and cervical carcinoma cells. EMBO Journal 11, 2271-2281.[Medline]

Kadonaga, J. T., James, K. A. & Tjian, R. (1986). Promoter activation of RNA polymerase II transcription by Sp1. Trends in Biochemical Sciences 11, 20-23.

Klug, J. & Beato, M. (1996). Binding of YY1 to a site overlapping a weak TATA box is essential for transcription from the uteroglobin promoter in endometrial cells. Molecular and Cellular Biology 16, 6398-6407.[Abstract]

Kyo, S., Inoue, M., Nishio, Y., Nakanishi, K., Akira, S., Inoue, S., Yutsudo, M., Tanizawa, O. & Hakura, A. (1993). NF-IL6 represses early gene expression of human papillomavirus type 16 through binding to the noncoding region. Journal of Virology 67, 1058-1066.[Abstract/Free Full Text]

Lee, T. C., Shi, Y. & Schwartz, R. J. (1992). Displacement of BrdUrd-induced YY1 by serum response factor activates skeletal {alpha}-actin transcription in embryonic myoblasts. Proceedings of the National Academy of Sciences, USA 89, 9814-9818.[Abstract/Free Full Text]

Lee, J. S., See, R. H., Galvin, K. M., Wang, J. & Shi, Y. (1995). Functional interactions between YY1 and adenovirus E1A. Nucleic Acids Research 23, 925-931.[Abstract/Free Full Text]

Lu, S. Y., Rodriguez, M. & Liao, W. S. (1994). YY1 represses rat serum amyloid A1 gene transcription and is antagonized by NF-{kappa}B during acute-phase response. Molecular and Cellular Biology 14, 6253-6263.[Abstract/Free Full Text]

May, M., Dong, X.-P., Beyer-Finkler, E., Stubenrauch, F., Fuchs, P. G. & Pfister, H. (1994). The E6/E7 promoter of extrachromosomal HPV16 DNA in cervical cancers escapes from cellular repression by mutation of target sequences for YY1. EMBO Journal 13, 1460-1466.[Medline]

Natesan, S. & Gilman, M. Z. (1993). DNA bending and orientation-dependent function of YY1 in the c-fos promoter. Genes & Development 7, 2497-2509.[Abstract/Free Full Text]

Natesan, S. & Gilman, M. (1995). YY1 facilitates the association of serum response factor with the c-fos serum response element. Molecular and Cellular Biology 15, 5975-5982.[Abstract]

O'Connor, M. & Bernard, H.-U. (1995). Oct-1 activates the epithelial-specific enhancer of human papillomavirus type 16 via a synergistic interaction with NFI at a conserved composite regulatory element. Virology 207, 77-88.[Medline]

O'Connor, M. J., Tan, S. H., Tan, C. H. & Bernard, H. U. (1996). YY1 represses human papillomavirus type 16 transcription by quenching AP-1 activity. Journal of Virology 70, 6529-6539.[Abstract/Free Full Text]

Pazin, M. J. & Kadonaga, J. T. (1997). What's up and down with histone deacetylation and transcription? Cell 89, 325-328.[Medline]

Rose, B., Steger, G., Dong, X.-P., Thompson, C., Cossart, Y., Tattersall, M. & Pfister, H. (1998). Point mutations in Sp1 motifs in the upstream regulatory region of human papillomavirus type 18 isolates from cervical cancers increase promoter activity. Journal of General Virology 79, 1659-1663.[Abstract]

Shi, Y., Seto, E., Chang, L.-S. & Shenk, T. (1991). Transcriptional repression by YY1, a human GLI-Krüppel-related protein, and relief of repression by adenovirus E1A protein. Cell 67, 377-388.[Medline]

Shrivastava, A., Saleque, S., Kalpana, G. V., Artandi, S., Goff, S. P. & Calame, K. (1993). Inhibition of transcriptional regulator Yin-Yang-1 by association with c-Myc. Science 262, 1889-1892.[Abstract/Free Full Text]

Sibbet, G. J., Cuthill, S. & Campo, M. S. (1995). The enhancer in the long control region of human papillomavirus type 16 is up-regulated by PEF-1 and down-regulated by Oct-1. Journal of Virology 69, 4006-4011.[Abstract]

Su, W., Jackson, S., Tjian, R. & Echols, H. (1991). DNA looping between sites for transcriptional activation: self-association of DNA-bound Sp1. Genes & Development 5, 820-826.[Abstract/Free Full Text]

Yang, W.-M., Inouye, C., Zeng, Y., Bearss, D. & Seto, E. (1996). Transcriptional repression by YY1 is mediated by interaction with a mammalian homolog of the yeast global regulator RPD3. Proceedings of the National Academy of Sciences, USA 93, 12845-12850.[Abstract/Free Full Text]

Received 11 February 1999; accepted 12 April 1999.


This article has been cited by other articles:


Home page
J. Virol.Home page
R. Jia, X. Liu, M. Tao, M. Kruhlak, M. Guo, C. Meyers, C. C. Baker, and Z.-M. Zheng
Control of the Papillomavirus Early-to-Late Switch by Differentially Expressed SRp20
J. Virol., January 1, 2009; 83(1): 167 - 180.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Microbiol.Home page
S. Pande, N. Jain, B. K. Prusty, S. Bhambhani, S. Gupta, R. Sharma, S. Batra, and B. C. Das
Human Papillomavirus Type 16 Variant Analysis of E6, E7, and L1 Genes and Long Control Region in Biopsy Samples from Cervical Cancer Patients in North India
J. Clin. Microbiol., March 1, 2008; 46(3): 1060 - 1066.
[Abstract] [Full Text] [PDF]


Home page
J. Gen. Virol.Home page
S. Dai, Z. Zhang, J. Bick, and R. N. Beachy
Essential role of the Box II cis element and cognate host factors in regulating the promoter of Rice tungro bacilliform virus.
J. Gen. Virol., March 1, 2006; 87(Pt 3): 715 - 722.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
W. G. Hubert
Variant Upstream Regulatory Region Sequences Differentially Regulate Human Papillomavirus Type 16 DNA Replication throughout the Viral Life Cycle
J. Virol., May 15, 2005; 79(10): 5914 - 5922.
[Abstract] [Full Text] [PDF]


Home page
Mol. Pharmacol.Home page
S. Her, R. Claycomb, T. C. Tai, and D. L. Wong
Regulation of the Rat Phenylethanolamine N-Methyltransferase Gene by Transcription Factors Sp1 and MAZ
Mol. Pharmacol., November 1, 2003; 64(5): 1180 - 1188.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
W. Ai, J. Narahari, and A. Roman
Yin Yang 1 Negatively Regulates the Differentiation-Specific E1 Promoter of Human Papillomavirus Type 6
J. Virol., June 1, 2000; 74(11): 5198 - 5205.
[Abstract] [Full Text]


Home page
J. Biol. Chem.Home page
P. T. La Celle and R. R. Polakowska
Human Homeobox HOXA7 Regulates Keratinocyte Transglutaminase Type 1 and Inhibits Differentiation
J. Biol. Chem., August 24, 2001; 276(35): 32844 - 32853.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via CrossRef
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Dong, X.-P.
Right arrow Articles by Pfister, H.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Dong, X.-P.
Right arrow Articles by Pfister, H.
Agricola
Right arrow Articles by Dong, X.-P.
Right arrow Articles by Pfister, H.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
INT J SYST EVOL MICROBIOL MICROBIOLOGY J GEN VIROL
J MED MICROBIOL ALL SGM JOURNALS