J Gen Virol Faster Access
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via CrossRef
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Leary, T. P.
Right arrow Articles by Mushahwar, I. K.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Leary, T. P.
Right arrow Articles by Mushahwar, I. K.
Agricola
Right arrow Articles by Leary, T. P.
Right arrow Articles by Mushahwar, I. K.
Journal of General Virology (1999), 80, 2115-2120.
© 1999 Society for General Microbiology


Animal: DNA Viruses

Improved detection systems for TT virus reveal high prevalence in humans, non-human primates and farm animals

Thomas P. Leary1, James C. Erker1, Michelle L. Chalmers1, Suresh M. Desai1 and Isa K. Mushahwar1

Virus Discovery Group, Experimental Biology Research, Dept 90D, Bldg L3, Abbott Laboratories, 1401 Sheridan Road, North Chicago, IL 60064-6269, USA1

Author for correspondence: I. K. Mushahwar.Fax +1 847 937 2923. e-mail isa.mushahwar{at}add.ssw.abbott.com


   Abstract
TOP
Abstract
Introduction
Methods
Results
Discussion
References
 
TT virus is a newly described agent infecting humans. Initially isolated from a patient (initials T.T.) with unexplained hepatitis, the virus has since been found in both normal and diseased individuals. In the present study, we utilized genomic-length sequences from distinct genotypes of TT virus to design PCR-based assays using conserved oligonucleotide primers from three independent regions of the virus genome. Each of the three assays was found to be superior to the PCR-based assays previously published. The most sensitive of the new assays was utilized to demonstrate the prevalence of TT virus to be at least 34·1% in volunteer blood donors, 39·6% in commercial blood donors, 59·6% in non-A–GB hepatitis cases, 81·7% in injectable drug users and 95·9% in haemophiliacs. In an attempt to identify a possible source of human infection, we found TT virus sequences to be present in 19% of chickens, 20% of pigs, 25% of cows and 30% of sheep. Sequence determination and phylogenetic analyses demonstrated that isolates from farm animals were not genetically distinct from those found in humans. This study clearly demonstrates that previously reported PCR assays dramatically underestimate the true prevalence of TT virus within the human population. Due to the high rate of infection in both blood donors and those with non-A–GB hepatitis, these results question the causal role of TT virus in cases of unexplained hepatitis. Further, it is possible that domesticated farm animals serve as a source of human infection.


   Introduction
TOP
Abstract
Introduction
Methods
Results
Discussion
References
 
TT virus was isolated from the serum of a Japanese patient (initials T.T.) with non-A–GB hepatitis and was present in a number of individuals with unexplained hepatitis (Nishizawa et al., 1997Down ; Okamoto et al., 1998aDown ). TT virus has a circular, single-stranded DNA genome of negative polarity that is 3852 nucleotides in length (Mushahwar et al., 1999Down ). The virus particle is small (30–50 nm), dense (1·31–1·34 g/ml in CsCl) and non-enveloped, and may represent the founding member of a new virus family (Mushahwar et al., 1999Down ). Phylogenetic analyses demonstrate that a number of highly divergent genotypes of TT virus exist, none of which bear resemblance to known viruses (Mushahwar et al., 1999Down ). Though the mode of transmission has yet to be determined, it is likely that multiple routes of infection occur. Those at risk for exposure to parenterally transmitted viruses have increased rates of infection (Desai et al., 1999Down ), though TT virus has also been found in the faeces of infected individuals, suggesting possible enteric transmission of the virus (Okamoto et al., 1998bDown ).

Recently, the role of TT virus in liver disease has been questioned since the virus is present in a significant number of individuals without hepatitis (Desai et al., 1999Down ). Specifically, PCR studies designed to test for the presence of TT virus found genomic sequences in 68% of patients with haemophilia, 46% of those on maintenance haemodialysis and 40% of intravenous drug users (Okamoto et al., 1998aDown ). This is opposed to 47% and 46% of patients with acute and chronic cryptogenic hepatitis, respectively. Additionally, 12% of Japanese blood donors were TT virus positive (Okamoto et al., 1998aDown ). These results likely underestimate the true prevalence of TT virus in these populations as the PCR assays utilized are not highly sensitive (Desai et al., 1999Down ). Oligonucleotide primers have recently been described that detected the presence of TT virus in 92% of healthy individuals in Japan (Takahashi et al., 1998Down ); however, these primers do not detect all virus genotypes (J. C. Erker & T. P. Leary, unpublished observations). In the present study, we have developed three nested PCR assays capable of detecting the most divergent isolates of TT virus known. These assays have superior sensitivity to all PCR assays previously described. Additionally, we have used these assays to demonstrate that TT virus is present in the sera of a variety of distinct animals species, eliminating TT virus as an exclusively human virus and further questioning its role as a causal agent in human liver disease


   Methods
TOP
Abstract
Introduction
Methods
Results
Discussion
References
 
{blacksquare} Oligonucleotide primer design.
Previously, we described the isolation of a 260 nucleotide region from 151 globally distributed TT virus isolates and demonstrated the existence of three major viral genotypes (Mushahwar et al., 1999Down ). We then selected several of the most divergent sequences from this group and extended the fragments to genome length (Erker et al., 1999Down ). Nucleotide sequence alignments were performed using genome length sequences to identify regions of conservation among isolates representing three distinct genotypes of TT virus. Nested pairs of consensus oligonucleotide primers were designed to three independent regions of the virus genome, and then examined for identity against partial TT virus sequences in existing databases. Based on the current level of understanding for TT virus, it is presumed that the three primer pairs reside in non-coding regions of the virus genome. Finally, the selected primers were tested by PCR for specificity and sensitivity using nucleic acids isolated from previously identified TT virus-positive and -negative serum.

{blacksquare} Nucleic acid preparation and PCR assays.
Serum samples utilized in this study have been described elsewhere (Desai et al., 1999Down ; Leary et al., 1996Down ). Total nucleic acids were extracted from 25 or 50 µl of serum using the US Biochemical RNA/DNA Isolation Kit as directed by the manufacturer. Dried nucleic acid pellets were then dissolved in 25 or 50 µl of water corresponding to the initial serum volume. First round PCR reactions (10 µl volume) utilized 1·0 µM final concentration of each primer, 2 µl of total nucleic acids and the Perkin Elmer GeneAmp PCR Reagent Kit as specified by the manufacturer, with a final concentration of 0·75 units Taq and 2·0 mM MgCl2. Nested PCR reactions (25 µl) utilized 0·5 µM final concentration of each primer, 1 µl of the first round PCR product as template and the conditions described above except that Taq was used at 0·625 units. Amplifications were for 35 cycles (20 s at 94 °C; 30 s at 55 °C; 30 s at 72 °C) followed by an extension at 72 °C for 10 min. Nested PCR products were separated by electrophoresis through a 2·0% agarose gel, blotted onto a nylon membrane (Hybond-N, Amersham) and analysed by Southern hybridization to score positive results and evaluate specificity. PCR primers were as previously described (Nishizawa et al., 1997Down ; Okamoto et al., 1998aDown ; Desai et al., 1999Down ; Simmonds et al., 1998Down ) or as follows. Set A forward 1 (position 94–115), 5' gctgcacttccgaatggctgag 3'; Set A reverse 1 (606–585), 5' ccaccagccataggccatggtg 3'; Set A forward 2 (113–133), 5' gagttttccacgcccgtccgc 3'; Set A reverse 2 (603–582), 5' ccagccataggccatggtgctc 3'; Set B forward 1 (3087–3110), 5' gtgggactttcacttgtcggtgtc 3'; Set B reverse 1 (3392–3368), 5' gacaaatggcaagaagataaaggcc 3'; Set B forward 2 (3120–3141), 5' aggtcactaagcactccgagcg 3'; Set B reverse 2 (3362–3342), 5' gcgaagtctggccccactcac 3'; Set C forward 1 (3293–3315), 5' cagactccgagttgccattggac 3'; Set C reverse 1 (3641–3620), 5' cacgtgtcggggcctacttccg 3'; Set C forward 2 (3333–3355), 5' gcaacgaaagtgagtggggccag 3'; Set C reverse 2 (3539–3519), 5' ggtttccgccgaggatgacct 3'. All oligonucleotide positions are numbered utilizing the TT virus prototype sequence (GenBank accession no. AB008394). The expected product sizes for the nested PCR reactions are as follows: Set A, 491 bp; Set B, 243 bp; Set C, 207 bp.

{blacksquare} Phylogenetic analysis.
Nested PCR products were gel separated, and then excised and purified with Geneclean II (Bio101). Purified products were ligated into pGEM-T Easy (Promega) and each strand was sequenced with ABI Big Dye and analysed on an Applied Biosystems model 377 DNA sequencer. Sequences were edited and assembled utilizing Sequencher version 3.0 (GeneCodes) and analysed using the programs of the Wisconsin Sequence Analysis Package (version 9.0, Genetics Computer Group, Madison, WI, USA). Sequence alignments were performed on the Set B region utilizing the GAP or PILEUP program with the default settings in place for gap creation and extension. Phylogenetic distances between pairs of nucleotides were determined using DNADIST of the PHYLIP package, version 3.5 (Felsenstein, 1993Down ). The computed distances were utilized for the construction of phylogenetic trees using the programs NEIGHBOR and RETREE. The final output was generated with the use of TREEVIEW (Page, 1996Down ). Bootstrap values were determined on 1000 resamplings of the nucleotide sequences using SEQBOOT, DNADIST, NEIGHBOR and CONSENSE. Values greater than 70% were considered supportive of the observed groupings. The sequences reported in this manuscript have been deposited in GenBank under the accession nos AF124057AF124091.


   Results
TOP
Abstract
Introduction
Methods
Results
Discussion
References
 
Comparison of TT virus assays
Having established the specificity and sensitivity of the three nested oligonucleotide primer sets on known TT virus-positive and -negative serum nucleic acids, we next compared the primer sets against previously reported PCR assays for the detection of TT virus. In order to perform this study, a serum panel was assembled that contained 25% known TT virus-positive samples as determined by a combination of the previously published assays. As shown in Table 1Down, 38 (79·2%) of the samples were found to be positive by at least one assay and 24 (50·0%) were positive by two or more assays.Down Set A detected 13 (27·1%) samples, Set B, 29 (60·4%) samples and Set C, 23 (47·9%) samples. Previously described PCR assays for TT virus by Nishizawa (Nishizawa et al., 1997Down ), Okamoto (Okamoto et al., 1998aDown ) and Simmonds (Simmonds et al., 1998Down ) detected 3 (6·3%), 8 (16·7%) and 9 (18·8%) samples, respectively. Though none of the samples are positive in all assays, Set B and Set C assays are clearly superior to any of the others. Set B detected 76·3% of the total positive samples while Set C detected 60·5%. In combination, Set B and C detect 36 of the 38 (94·7%) positive samples, though only 42·1% of these are detected by both assays. These results clearly demonstrate that previous PCR assays dramatically underestimate TT virus prevalence and emphasize the need for assays with oligonucleotide primers designed to highly conserved regions of the virus genome.


View this table:
[in this window]
[in a new window]
 
Table 1. Comparison of TT virus detection systems

 
Detection of TT virus in blood donors
Because the new primer pairs described above appear to be superior to those previously reported, a number of populations previously evaluated for the presence of TT virus (Desai et al., 1999Down ) were reexamined utilizing Set B primers (Table 2).Down Among volunteer blood donors with normal alanine aminotransferase (ALT) levels, 31 (34·1%) were found to be positive for TT virus. This is compared to a prevalence of 10·7% found when two previously published assays were utilized (Desai et al., 1999Down ). When volunteer blood donors with elevated ALT values were examined, 11 (15·9%) were positive as compared to the 9·1% determined earlier for this population (Desai et al., 1999Down ). Further, the TT virus infection rate among commercial blood donors increased from 12·8% to 39·6% using the new assay, while injectable drug users increased from 17·2% to 81·7%. Finally, among 48 non-A–GB hepatitis samples tested, only 1 (2·1 %) was positive in the previous study (Desai et al., 1999Down ), whereas 28 (59·6%) were positive with the Set B primer assay.


View this table:
[in this window]
[in a new window]
 
Table 2. Prevalence of TT virus in human populations

 
Additionally, we have tested a number of other populations and have compared the results to the previous assays. Haemophiliacs, which were 56·2% positive, are now 95·9% positive when tested with the Set B primer assay. Human T-lymphotropic virus type I (HTLV-I)-positive Japanese blood donors that were previously 35·0% positive were now 100% positive, and the rate doubled (22·2% as compared to 11·1%) in a panel of New Zealand children after utilizing the Set B primer assay. In contrast to the limited study initially performed (Table 1Up), virtually all samples determined to be TT virus positive by other methods were detected with the Set B primer assay when tested on the clinical samples described in Table 2Up.

TT virus detection in animals
Due to the high viral prevalence in the human population, we were interested in determining if a non-human source of infection exists. Because the rate of infection between volunteer blood donors and patients with non-A–E hepatitis was not substantially different, it was surmised that a shared source of infection might exist that is independent of geographical location. Therefore, we tested for the presence of TT virus in the sera of domesticated farm animals utilizing the Set B primer assay. As demonstrated in Table 3Down, 20% of pigs, 25% of cows, 19% of chickens and 30% of sheep were positive for the presence of TT virus.Down Only three of these TT virus-infected animals were positive when tested with three previously published PCR assays (Nishizawa et al., 1997Down ; Okamoto et al., 1998aDown ; Simmonds et al., 1998Down ). We also examined a limited number of samples from several species of non-human primates with the Set B primer assay. In this study, TT virus was detected in Saguinus labiatus (23·5%), Aotus trivirgatus (20·0%) and Pan troglodytes (50·0%), though virus sequences were not detected in Callithrix jacchus, Saguinus mystax or Macaca fascicularis. In the latter cases, only limited numbers of samples were evaluated: therefore, the possibility of infection in these species cannot be eliminated.


View this table:
[in this window]
[in a new window]
 
Table 3. Prevalence of TT virus in farm animals

 
Phylogenetic analysis
Sequence comparisons demonstrated that products isolated from non-human primates and domesticated farm animals were not remarkably different from human TT virus sequences. In fact, the human isolates were slightly more divergent than the animal isolates. Identity among human sequences within the Set B region was 75·1–100%, whereas identity among non-human sequences was 79·8–100%. The identity between animal and human sequences was 79·0–99·2%. To clarify the relationship between these sequences, genetic distances were determined and an unrooted phylogenetic tree was generated (Fig. 1Down). Sequences clustered strongly into three distinct groups with bootstrap values greater than 93%. Also, these groupings are supported by full-length sequences of TT virus (data not shown). Support for subtype designations was not apparent within the Set B region, most likely the result of the short length and high degree of conservation within a genotype. Genetic distances were similar to percentage identity values in that human and non-human isolates were equally divergent and did not segregate into separate groups. These data demonstrate that TT virus is able to infect a wide range of mammals as well as avian species.



View larger version (15K):
[in this window]
[in a new window]
 
Fig. 1. Phylogenetic tree representing the genetic groupings of TT virus sequences derived from the Set B region. Human designations are as follows: Ghana, GH; Japan, JA; haemophiliac, H; United States, US. Non-human isolates are referred to according to the species from which sequences were obtained: bovine, B; chicken, C; Pan troglodytes, CH; porcine, P; Aotus trivirgatus, OW; ovine, S; Saguinus labiatus, T. Genotypic designations are as defined by partial (Mushahwar et al., 1999Down ) and full-length (Erker et al., 1999Down ) human isolates. Bootstrap values are shown at the major branches.

 

   Discussion
TOP
Abstract
Introduction
Methods
Results
Discussion
References
 
In the present study, we have designed three distinct nested PCR assays for the detection of TT virus sequences. In each case, the assays were shown to be superior to those described to date. We have utilized the most sensitive of these assays to evaluate several populations that were tested by previously reported methods, demonstrating a much higher prevalence than initially observed. This is especially true in populations at increased risk for exposure to parenterally transmitted viruses, such as haemophiliacs and injectable drug users. In these cases, virtually all of the samples tested were found to be positive. Additionally, we have tested a number of non-human primates and farm animals and have found TT virus sequences to be present in blood sera. In each case, phylogenetic analysis demonstrated that the isolated sequences were not distinct from those found in human sera. Caution must be used in evaluating these animal data for a number of reasons: (1) the number of samples tested from each animal species was limited; (2) the possibility that the non-human primates being tested were at one time inoculated with human materials cannot be eliminated; and (3) it is conceivable that these animals were infected with a related virus that is being detected as a result of a highly conserved region present in two distantly related viruses. Though the products amplified from these animals are similar to the human isolates, it is not possible to eliminate the third possibility, as these sequences have not been extended beyond the initial amplified region.

The role of TT virus in human liver disease is unknown. This question has yet to be adequately addressed due to the insensitive detection systems formerly available. Each of the previously published assays dramatically underestimate the true prevalence of TT virus in the human population (Desai et al., 1999Down ), likely the result of genomic diversity existing within coding regions of the virus. In a recent study, Takahashi et al. (1998)Down described a PCR-based assay that detected TT virus sequences in 92% of healthy individuals at a Japanese hospital. Though this assay seems to be the most sensitive reported, careful examination of the oligonucleotide primers utilized demonstrate that this assay is genotype 1-specific and most likely is unable to detect divergent genotypes (data not shown). Therefore, prevalence in Japan is likely to exceed the 92% reported. Further, we have found genotype 2 and 3 sequences to be prevalent in Japan and have observed a high rate of multiply infected individuals within this population (Mushahwar et al., 1999Down ). In the current study, each of the 20 HTLV-I-infected blood donors from Japan was positive by the Set B primer assay. Therefore, based on the prevalence observed in normal and diseased individuals, it is difficult to conclude that TT virus accounts for a significant portion, if any, of unexplained hepatitis cases.

The mode of TT virus transmission is just now starting to be understood. Because TT virus is much more prevalent in those at risk for exposure to parenterally transmitted viruses (Table 2Up), it can be inferred that the virus is transmitted by this route, although other routes of exposure are likely also. When blood donor populations are examined for the presence of TT virus and GBV-C (a parenterally transmitted virus), very low co-infection frequencies occur (Desai et al., 1999Down ). This would suggest that other modes of transmission do exist, perhaps via the enteric route. It has been shown that individuals residing in developing countries have much higher TT virus infection rates (Prescott & Simmonds, 1998Down ) as compared to those in Western countries (Desai et al., 1999Down ), and it has recently been demonstrated that TT virus sequences are present in faecal material (Okamoto et al., 1998bDown ). Therefore, should enteric transmission of TT virus occur, it would not be surprising to find the highest rates of infection in regions with poor sanitary conditions. In addition, we have demonstrated the presence of TT virus in the sera of cows, sheep, pigs and chickens. Consequently, before a complete understanding of TT virus transmission can occur, it will be necessary to determine if farm animals and possibly undercooked meat are indeed a source of human infection.

Despite the fact that TT virus has been discovered recently, significant details have been reported regarding the prevalence, mode of transmission, and the biophysical and molecular characterization of the virus. Although the high prevalence is not consistent with a disease-causing agent, further investigations are necessary to eliminate the unlikely possibility that a variant or subspecies of the virus can cause disease. As highly sensitive molecular techniques continue to evolve and be more extensively utilized for virus discovery, it is likely that ubiquitous and benign agents will be identified in the future.


   Acknowledgments
 
The authors would like to thank Dr A Scott Muerhoff for his insightful discussions and careful review of the manuscript.


   Footnotes
 
The GenBank accession numbers of the sequences reported are AF124057 to AF124091.


   References
TOP
Abstract
Introduction
Methods
Results
Discussion
References
 
Desai, S. M., Muerhoff, A. S., Leary, T. P., Erker, J. C., Simons, J. N., Chalmers, M. L., Birkenmeyer, L. G., Pilot-Matias, T. J. & Mushahwar, I. K. (1999). Prevalence of TT virus infection in US blood donors and populations at risk for acquiring parenterally transmitted viruses. Journal of Infectious Diseases 179, 1242-1244.[Medline]

Erker, J. C., Leary, T. P., Desai, S. M., Chalmers, M. L. & Mushahwar, I. K. (1999). Analyses of TT virus full length genomic sequences. Journal of General Virology 80, 1743-1750.[Abstract]

Felsenstein, J. (1993). PHYLIP, version 3.5. Distributed by the author, Dept of Genetics, University of Washington, Seattle, USA.

Leary, T. P., Desai, S. M., Yamaguchi, J., Chalmers, M. L., Schlauder, G. G., Dawson, G. J. & Mushahwar, I. K. (1996). Species-specific variants of GB virus A in captive monkeys. Journal of Virology 70, 9028-9030.[Abstract]

Mushahwar, I. K., Erker, J. C., Muerhoff, A. S., Leary, T. P., Simons, J. N., Birkenmeyer, L. G., Chalmers, M. C., Pilot-Matias, T. J. & Desai, S. M. (1999). Molecular and biophysical characterization of TT virus: evidence for a new virus family infecting humans. Proceedings of the National Academy of Sciences, USA 96, 3177-3182.[Abstract/Free Full Text]

Nishizawa, T., Okamoto, H., Konishi, K., Yoshizawa, H., Miyakawa, Y. & Mayumi, M. (1997). A novel DNA virus (TTV) associated with elevated transaminase levels in postransfusion hepatitis of unknown etiology. Biochemical and Biophysical Research Communications 241, 92-97.[Medline]

Okamoto, H., Nishizawa, T., Kato, N., Ukita, M., Ikeda, H., Iizuka, H., Miyakawa, Y. & Mayumi, M. (1998a). Molecular cloning and characterization of a novel DNA virus (TTV) associated with postransfusion hepatitis of unknown etiology. Hepatology Research 10, 1-16.

Okamoto, H., Akahane, Y., Ukita, M., Fukada, M., Tsuda, F., Miyakawa, Y. & Mayumi, M. (1998b). Fecal excretion of a nonenveloped DNA virus (TTV) associated with posttransfusion non-A–G hepatitis. Journal of Medical Virology 56, 128-132.[Medline]

Page, R. D. M. (1996). Treeview: an application to display phylogenetic trees on personal computers. Computer Applications in the Biosciences 12, 357-358.[Free Full Text]

Prescott, L. E. & Simmonds, P. (1998). Global distribution of transfusion-transmitted virus. New England Journal of Medicine 339, 776-777.[Free Full Text]

Simmonds, P., Davidson, F., Lycett, C., Prescott, L. E., MacDonald, D. M., Ellender, J., Yap, P. L., Ludlam, C. A., Haydon, G. H., Gillon, J. & Jarvis, L. M. (1998). Detection of a novel DNA virus (TTV) in blood donors and blood products. Lancet 352, 191-194.[Medline]

Takahashi, K., Hoshino, H., Ohta, Y., Yoshida, N. & Mishiro, S. (1998). Very high prevalence of TT virus (TTV) infection in general population of Japan revealed by a new set of PCR primers. Hepatology Research 12, 233-239.

Received 10 February 1999; accepted 26 April 1999.


This article has been cited by other articles:


Home page
J. Gen. Virol.Home page
T. F. F. Ng, W. K. Suedmeyer, E. Wheeler, F. Gulland, and M. Breitbart
Novel anellovirus discovered from a mortality event of captive California sea lions
J. Gen. Virol., May 1, 2009; 90(5): 1256 - 1261.
[Abstract] [Full Text] [PDF]


Home page
J. Gen. Virol.Home page
T. Kekarainen, L. Martinez-Guino, and J. Segales
Swine torque teno virus detection in pig commercial vaccines, enzymes for laboratory use and human drugs containing components of porcine origin
J. Gen. Virol., March 1, 2009; 90(3): 648 - 653.
[Abstract] [Full Text] [PDF]


Home page
J. Gen. Virol.Home page
M. Ninomiya, T. Nishizawa, M. Takahashi, F. R. Lorenzo, T. Shimosegawa, and H. Okamoto
Identification and genomic characterization of a novel human torque teno virus of 3.2 kb
J. Gen. Virol., July 1, 2007; 88(7): 1939 - 1944.
[Abstract] [Full Text] [PDF]


Home page
J. Gen. Virol.Home page
T. Kekarainen, M. Sibila, and J. Segales
Prevalence of swine Torque teno virus in post-weaning multisystemic wasting syndrome (PMWS)-affected and non-PMWS-affected pigs in Spain.
J. Gen. Virol., April 1, 2006; 87(Pt 4): 833 - 837.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
M. S. Jones, A. Kapoor, V. V. Lukashov, P. Simmonds, F. Hecht, and E. Delwart
New DNA Viruses Identified in Patients with Acute Viral Infection Syndrome
J. Virol., July 1, 2005; 79(13): 8230 - 8236.
[Abstract] [Full Text] [PDF]


Home page
J. Gen. Virol.Home page
C. Niel, L. Diniz-Mendes, and S. Devalle
Rolling-circle amplification of Torque teno virus (TTV) complete genomes from human and swine sera and identification of a novel swine TTV genogroup
J. Gen. Virol., May 1, 2005; 86(5): 1343 - 1347.
[Abstract] [Full Text] [PDF]


Home page
J. Gen. Virol.Home page
L. Bigarre, V. Beven, C. de Boisseson, B. Grasland, N. Rose, P. Biagini, and A. Jestin
Pig anelloviruses are highly prevalent in swine herds in France
J. Gen. Virol., March 1, 2005; 86(3): 631 - 635.
[Abstract] [Full Text] [PDF]


Home page
J. Gen. Virol.Home page
K. Kooistra, Y.-H. Zhang, N. V. Henriquez, B. Weiss, D. Mumberg, and M. H. M. Noteborn
TT virus-derived apoptosis-inducing protein induces apoptosis preferentially in hepatocellular carcinoma-derived cells
J. Gen. Virol., June 1, 2004; 85(6): 1445 - 1450.
[Abstract] [Full Text] [PDF]


Home page
J. Gen. Virol.Home page
H. Okamoto, M. Takahashi, T. Nishizawa, A. Tawara, K. Fukai, U. Muramatsu, Y. Naito, and A. Yoshikawa
Genomic characterization of TT viruses (TTVs) in pigs, cats and dogs and their relatedness with species-specific TTVs in primates and tupaias
J. Gen. Virol., June 1, 2002; 83(6): 1291 - 1297.
[Abstract] [Full Text] [PDF]


Home page
J Med MicrobiolHome page
TT virus infection: a novel virus-host relationship
J. Med. Microbiol., June 1, 2002; 51(6): 455 - 458.
[Full Text] [PDF]


Home page
J. Virol.Home page
F. Maggi, M. Pistello, M. Vatteroni, S. Presciuttini, S. Marchi, P. Isola, C. Fornai, S. Fagnani, E. Andreoli, G. Antonelli, et al.
Dynamics of Persistent TT Virus Infection, as Determined in Patients Treated with Alpha Interferon for Concomitant Hepatitis C Virus Infection
J. Virol., December 15, 2001; 75(24): 11999 - 12004.
[Abstract] [Full Text] [PDF]


Home page
J. Gen. Virol.Home page
H. Okamoto, T. Nishizawa, M. Takahashi, A. Tawara, Y. Peng, J. Kishimoto, and Y. Wang
Genomic and evolutionary characterization of TT virus (TTV) in tupaias and comparison with species-specific TTVs in humans and non-human primates
J. Gen. Virol., September 1, 2001; 82(9): 2041 - 2050.
[Abstract] [Full Text] [PDF]


Home page
Clin. Microbiol. Rev.Home page
M. Bendinelli, M. Pistello, F. Maggi, C. Fornai, G. Freer, and M. L. Vatteroni
Molecular Properties, Biology, and Clinical Implications of TT Virus, a Recently Identified Widespread Infectious Agent of Humans
Clin. Microbiol. Rev., January 1, 2001; 14(1): 98 - 113.
[Abstract] [Full Text] [PDF]


Home page
J. Gen. Virol.Home page
S. Laurent, E. Esnault, G. Dambrine, A. Goudeau, D. Choudat, and D. Rasschaert
Detection of avian oncogenic Marek's disease herpesvirus DNA in human sera
J. Gen. Virol., January 1, 2001; 82(1): 233 - 240.
[Abstract] [Full Text]


Home page
J. Gen. Virol.Home page
C. Ott, L. Duret, I. Chemin, C. Trépo, B. Mandrand, and F. Komurian-Pradel
Use of a TT virus ORF1 recombinant protein to detect anti-TT virus antibodies in human sera
J. Gen. Virol., December 1, 2000; 81(12): 2949 - 2958.
[Abstract] [Full Text]


Home page
CVIHome page
C.-L. Lin, W. Kyono, J. Tongson, P. K. Chua, D. Easa, R. Yanagihara, and V. R. Nerurkar
Fecal Excretion of a Novel Human Circovirus, TT Virus, in Healthy Children
Clin. Vaccine Immunol., November 1, 2000; 7(6): 960 - 963.
[Abstract] [Full Text] [PDF]


Home page
CVIHome page
V. A. Arankalle, S. S. Gandhe, T. M. Deshmukh, M. S. Chadha, and A. M. Walimbe
Prevalence and Phylogenetic Analysis of TT Virus DNA in Western India
Clin. Vaccine Immunol., September 1, 2000; 7(5): 845 - 849.
[Abstract] [Full Text] [PDF]


Home page
J. Gen. Virol.Home page
R. L. Hallett, J. P. Clewley, F. Bobet, P. J. McKiernan, and C. G. Teo
Characterization of a highly divergent TT virus genome
J. Gen. Virol., September 1, 2000; 81(9): 2273 - 2279.
[Abstract] [Full Text]


Home page
J. Virol.Home page
M. Worobey
Extensive Homologous Recombination among Widely Divergent TT Viruses
J. Virol., August 15, 2000; 74(16): 7666 - 7670.
[Abstract] [Full Text]


Home page
J. Virol.Home page
H. Okamoto, M. Ukita, T. Nishizawa, J. Kishimoto, Y. Hoshi, H. Mizuo, T. Tanaka, Y. Miyakawa, and M. Mayumi
Circular Double-Stranded Forms of TT Virus DNA in the Liver
J. Virol., June 1, 2000; 74(11): 5161 - 5167.
[Abstract] [Full Text]


Home page
J. Gen. Virol.Home page
R. Romeo, P. Hegerich, S. U. Emerson, M. Colombo, R. H. Purcell, and J. Bukh
High prevalence of TT virus (TTV) in naive chimpanzees and in hepatitis C virus-infected humans: frequent mixed infections and identification of new TTV genotypes in chimpanzees
J. Gen. Virol., April 1, 2000; 81(4): 1001 - 1007.
[Abstract] [Full Text]


Home page
J. Virol.Home page
H. Okamoto, M. Fukuda, A. Tawara, T. Nishizawa, Y. Itoh, I. Hayasaka, F. Tsuda, T. Tanaka, Y. Miyakawa, and M. Mayumi
Species-Specific TT Viruses and Cross-Species Infection in Nonhuman Primates
J. Virol., February 1, 2000; 74(3): 1132 - 1139.
[Abstract] [Full Text]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via CrossRef
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Leary, T. P.
Right arrow Articles by Mushahwar, I. K.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Leary, T. P.
Right arrow Articles by Mushahwar, I. K.
Agricola
Right arrow Articles by Leary, T. P.
Right arrow Articles by Mushahwar, I. K.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
INT J SYST EVOL MICROBIOL MICROBIOLOGY J GEN VIROL
J MED MICROBIOL ALL SGM JOURNALS