|
|
||||||||
Animal: DNA Viruses |
Virus Discovery Group, Experimental Biology Research, Dept 90D, Bldg L3, Abbott Laboratories, 1401 Sheridan Road, North Chicago, IL 60064-6269, USA1
Author for correspondence: I. K. Mushahwar.Fax +1 847 937 2923. e-mail isa.mushahwar{at}add.ssw.abbott.com
| Abstract |
|---|
|
|
|---|
| Introduction |
|---|
|
|
|---|
Recently, the role of TT virus in liver disease has been questioned since the virus is present in a significant number of individuals without hepatitis (Desai et al., 1999
). Specifically, PCR studies designed to test for the presence of TT virus found genomic sequences in 68% of patients with haemophilia, 46% of those on maintenance haemodialysis and 40% of intravenous drug users (Okamoto et al., 1998a
). This is opposed to 47% and 46% of patients with acute and chronic cryptogenic hepatitis, respectively. Additionally, 12% of Japanese blood donors were TT virus positive (Okamoto et al., 1998a
). These results likely underestimate the true prevalence of TT virus in these populations as the PCR assays utilized are not highly sensitive (Desai et al., 1999
). Oligonucleotide primers have recently been described that detected the presence of TT virus in 92% of healthy individuals in Japan (Takahashi et al., 1998
); however, these primers do not detect all virus genotypes (J. C. Erker & T. P. Leary, unpublished observations). In the present study, we have developed three nested PCR assays capable of detecting the most divergent isolates of TT virus known. These assays have superior sensitivity to all PCR assays previously described. Additionally, we have used these assays to demonstrate that TT virus is present in the sera of a variety of distinct animals species, eliminating TT virus as an exclusively human virus and further questioning its role as a causal agent in human liver disease
| Methods |
|---|
|
|
|---|
Oligonucleotide primer design.
Nucleic acid preparation and PCR assays.
Serum samples utilized in this study have been described elsewhere (Desai et al., 1999
; Leary et al., 1996
). Total nucleic acids were extracted from 25 or 50 µl of serum using the US Biochemical RNA/DNA Isolation Kit as directed by the manufacturer. Dried nucleic acid pellets were then dissolved in 25 or 50 µl of water corresponding to the initial serum volume. First round PCR reactions (10 µl volume) utilized 1·0 µM final concentration of each primer, 2 µl of total nucleic acids and the Perkin Elmer GeneAmp PCR Reagent Kit as specified by the manufacturer, with a final concentration of 0·75 units Taq and 2·0 mM MgCl2. Nested PCR reactions (25 µl) utilized 0·5 µM final concentration of each primer, 1 µl of the first round PCR product as template and the conditions described above except that Taq was used at 0·625 units. Amplifications were for 35 cycles (20 s at 94 °C; 30 s at 55 °C; 30 s at 72 °C) followed by an extension at 72 °C for 10 min. Nested PCR products were separated by electrophoresis through a 2·0% agarose gel, blotted onto a nylon membrane (Hybond-N, Amersham) and analysed by Southern hybridization to score positive results and evaluate specificity. PCR primers were as previously described (Nishizawa et al., 1997
; Okamoto et al., 1998a
; Desai et al., 1999
; Simmonds et al., 1998
) or as follows. Set A forward 1 (position 94115), 5' gctgcacttccgaatggctgag 3'; Set A reverse 1 (606585), 5' ccaccagccataggccatggtg 3'; Set A forward 2 (113133), 5' gagttttccacgcccgtccgc 3'; Set A reverse 2 (603582), 5' ccagccataggccatggtgctc 3'; Set B forward 1 (30873110), 5' gtgggactttcacttgtcggtgtc 3'; Set B reverse 1 (33923368), 5' gacaaatggcaagaagataaaggcc 3'; Set B forward 2 (31203141), 5' aggtcactaagcactccgagcg 3'; Set B reverse 2 (33623342), 5' gcgaagtctggccccactcac 3'; Set C forward 1 (32933315), 5' cagactccgagttgccattggac 3'; Set C reverse 1 (36413620), 5' cacgtgtcggggcctacttccg 3'; Set C forward 2 (33333355), 5' gcaacgaaagtgagtggggccag 3'; Set C reverse 2 (35393519), 5' ggtttccgccgaggatgacct 3'. All oligonucleotide positions are numbered utilizing the TT virus prototype sequence (GenBank accession no. AB008394). The expected product sizes for the nested PCR reactions are as follows: Set A, 491 bp; Set B, 243 bp; Set C, 207 bp.
Phylogenetic analysis.
Nested PCR products were gel separated, and then excised and purified with Geneclean II (Bio101). Purified products were ligated into pGEM-T Easy (Promega) and each strand was sequenced with ABI Big Dye and analysed on an Applied Biosystems model 377 DNA sequencer. Sequences were edited and assembled utilizing Sequencher version 3.0 (GeneCodes) and analysed using the programs of the Wisconsin Sequence Analysis Package (version 9.0, Genetics Computer Group, Madison, WI, USA). Sequence alignments were performed on the Set B region utilizing the GAP or PILEUP program with the default settings in place for gap creation and extension. Phylogenetic distances between pairs of nucleotides were determined using DNADIST of the PHYLIP package, version 3.5 (Felsenstein, 1993
). The computed distances were utilized for the construction of phylogenetic trees using the programs NEIGHBOR and RETREE. The final output was generated with the use of TREEVIEW (Page, 1996
). Bootstrap values were determined on 1000 resamplings of the nucleotide sequences using SEQBOOT, DNADIST, NEIGHBOR and CONSENSE. Values greater than 70% were considered supportive of the observed groupings. The sequences reported in this manuscript have been deposited in GenBank under the accession nos AF124057AF124091.
| Results |
|---|
|
|
|---|
|
|
TT virus detection in animals
Due to the high viral prevalence in the human population, we were interested in determining if a non-human source of infection exists. Because the rate of infection between volunteer blood donors and patients with non-AE hepatitis was not substantially different, it was surmised that a shared source of infection might exist that is independent of geographical location. Therefore, we tested for the presence of TT virus in the sera of domesticated farm animals utilizing the Set B primer assay. As demonstrated in Table 3
, 20% of pigs, 25% of cows, 19% of chickens and 30% of sheep were positive for the presence of TT virus.
Only three of these TT virus-infected animals were positive when tested with three previously published PCR assays (Nishizawa et al., 1997
; Okamoto et al., 1998a
; Simmonds et al., 1998
). We also examined a limited number of samples from several species of non-human primates with the Set B primer assay. In this study, TT virus was detected in Saguinus labiatus (23·5%), Aotus trivirgatus (20·0%) and Pan troglodytes (50·0%), though virus sequences were not detected in Callithrix jacchus, Saguinus mystax or Macaca fascicularis. In the latter cases, only limited numbers of samples were evaluated: therefore, the possibility of infection in these species cannot be eliminated.
|
|
| Discussion |
|---|
|
|
|---|
The role of TT virus in human liver disease is unknown. This question has yet to be adequately addressed due to the insensitive detection systems formerly available. Each of the previously published assays dramatically underestimate the true prevalence of TT virus in the human population (Desai et al., 1999
), likely the result of genomic diversity existing within coding regions of the virus. In a recent study, Takahashi et al. (1998)
described a PCR-based assay that detected TT virus sequences in 92% of healthy individuals at a Japanese hospital. Though this assay seems to be the most sensitive reported, careful examination of the oligonucleotide primers utilized demonstrate that this assay is genotype 1-specific and most likely is unable to detect divergent genotypes (data not shown). Therefore, prevalence in Japan is likely to exceed the 92% reported. Further, we have found genotype 2 and 3 sequences to be prevalent in Japan and have observed a high rate of multiply infected individuals within this population (Mushahwar et al., 1999
). In the current study, each of the 20 HTLV-I-infected blood donors from Japan was positive by the Set B primer assay. Therefore, based on the prevalence observed in normal and diseased individuals, it is difficult to conclude that TT virus accounts for a significant portion, if any, of unexplained hepatitis cases.
The mode of TT virus transmission is just now starting to be understood. Because TT virus is much more prevalent in those at risk for exposure to parenterally transmitted viruses (Table 2
), it can be inferred that the virus is transmitted by this route, although other routes of exposure are likely also. When blood donor populations are examined for the presence of TT virus and GBV-C (a parenterally transmitted virus), very low co-infection frequencies occur (Desai et al., 1999
). This would suggest that other modes of transmission do exist, perhaps via the enteric route. It has been shown that individuals residing in developing countries have much higher TT virus infection rates (Prescott & Simmonds, 1998
) as compared to those in Western countries (Desai et al., 1999
), and it has recently been demonstrated that TT virus sequences are present in faecal material (Okamoto et al., 1998b
). Therefore, should enteric transmission of TT virus occur, it would not be surprising to find the highest rates of infection in regions with poor sanitary conditions. In addition, we have demonstrated the presence of TT virus in the sera of cows, sheep, pigs and chickens. Consequently, before a complete understanding of TT virus transmission can occur, it will be necessary to determine if farm animals and possibly undercooked meat are indeed a source of human infection.
Despite the fact that TT virus has been discovered recently, significant details have been reported regarding the prevalence, mode of transmission, and the biophysical and molecular characterization of the virus. Although the high prevalence is not consistent with a disease-causing agent, further investigations are necessary to eliminate the unlikely possibility that a variant or subspecies of the virus can cause disease. As highly sensitive molecular techniques continue to evolve and be more extensively utilized for virus discovery, it is likely that ubiquitous and benign agents will be identified in the future.
| Acknowledgments |
|---|
| Footnotes |
|---|
| References |
|---|
|
|
|---|
Erker, J. C., Leary, T. P., Desai, S. M., Chalmers, M. L. & Mushahwar, I. K. (1999). Analyses of TT virus full length genomic sequences. Journal of General Virology 80, 1743-1750.[Abstract]
Felsenstein, J. (1993). PHYLIP, version 3.5. Distributed by the author, Dept of Genetics, University of Washington, Seattle, USA.
Leary, T. P., Desai, S. M., Yamaguchi, J., Chalmers, M. L., Schlauder, G. G., Dawson, G. J. & Mushahwar, I. K. (1996). Species-specific variants of GB virus A in captive monkeys. Journal of Virology 70, 9028-9030.[Abstract]
Mushahwar, I. K., Erker, J. C., Muerhoff, A. S., Leary, T. P., Simons, J. N., Birkenmeyer, L. G., Chalmers, M. C., Pilot-Matias, T. J. & Desai, S. M. (1999). Molecular and biophysical characterization of TT virus: evidence for a new virus family infecting humans. Proceedings of the National Academy of Sciences, USA 96, 3177-3182.
Nishizawa, T., Okamoto, H., Konishi, K., Yoshizawa, H., Miyakawa, Y. & Mayumi, M. (1997). A novel DNA virus (TTV) associated with elevated transaminase levels in postransfusion hepatitis of unknown etiology. Biochemical and Biophysical Research Communications 241, 92-97.[Medline]
Okamoto, H., Nishizawa, T., Kato, N., Ukita, M., Ikeda, H., Iizuka, H., Miyakawa, Y. & Mayumi, M. (1998a). Molecular cloning and characterization of a novel DNA virus (TTV) associated with postransfusion hepatitis of unknown etiology. Hepatology Research 10, 1-16.
Okamoto, H., Akahane, Y., Ukita, M., Fukada, M., Tsuda, F., Miyakawa, Y. & Mayumi, M. (1998b). Fecal excretion of a nonenveloped DNA virus (TTV) associated with posttransfusion non-AG hepatitis. Journal of Medical Virology 56, 128-132.[Medline]
Page, R. D. M. (1996). Treeview: an application to display phylogenetic trees on personal computers. Computer Applications in the Biosciences 12, 357-358.
Prescott, L. E. & Simmonds, P. (1998). Global distribution of transfusion-transmitted virus. New England Journal of Medicine 339, 776-777.
Simmonds, P., Davidson, F., Lycett, C., Prescott, L. E., MacDonald, D. M., Ellender, J., Yap, P. L., Ludlam, C. A., Haydon, G. H., Gillon, J. & Jarvis, L. M. (1998). Detection of a novel DNA virus (TTV) in blood donors and blood products. Lancet 352, 191-194.[Medline]
Takahashi, K., Hoshino, H., Ohta, Y., Yoshida, N. & Mishiro, S. (1998). Very high prevalence of TT virus (TTV) infection in general population of Japan revealed by a new set of PCR primers. Hepatology Research 12, 233-239.
Received 10 February 1999;
accepted 26 April 1999.
This article has been cited by other articles:
![]() |
S. Roperto, O. Paciello, F. Paolini, U. Pagnini, E. Palma, R. Di Palo, V. Russo, F. Roperto, and A. Venuti Short communication: Detection of human Torque teno virus in the milk of water buffaloes (Bubalus bubalis) J Dairy Sci, December 1, 2009; 92(12): 5928 - 5932. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. F. F. Ng, W. K. Suedmeyer, E. Wheeler, F. Gulland, and M. Breitbart Novel anellovirus discovered from a mortality event of captive California sea lions J. Gen. Virol., May 1, 2009; 90(5): 1256 - 1261. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Kekarainen, L. Martinez-Guino, and J. Segales Swine torque teno virus detection in pig commercial vaccines, enzymes for laboratory use and human drugs containing components of porcine origin J. Gen. Virol., March 1, 2009; 90(3): 648 - 653. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Ninomiya, T. Nishizawa, M. Takahashi, F. R. Lorenzo, T. Shimosegawa, and H. Okamoto Identification and genomic characterization of a novel human torque teno virus of 3.2 kb J. Gen. Virol., July 1, 2007; 88(7): 1939 - 1944. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Kekarainen, M. Sibila, and J. Segales Prevalence of swine Torque teno virus in post-weaning multisystemic wasting syndrome (PMWS)-affected and non-PMWS-affected pigs in Spain. J. Gen. Virol., April 1, 2006; 87(Pt 4): 833 - 837. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. S. Jones, A. Kapoor, V. V. Lukashov, P. Simmonds, F. Hecht, and E. Delwart New DNA Viruses Identified in Patients with Acute Viral Infection Syndrome J. Virol., July 1, 2005; 79(13): 8230 - 8236. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Niel, L. Diniz-Mendes, and S. Devalle Rolling-circle amplification of Torque teno virus (TTV) complete genomes from human and swine sera and identification of a novel swine TTV genogroup J. Gen. Virol., May 1, 2005; 86(5): 1343 - 1347. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Bigarre, V. Beven, C. de Boisseson, B. Grasland, N. Rose, P. Biagini, and A. Jestin Pig anelloviruses are highly prevalent in swine herds in France J. Gen. Virol., March 1, 2005; 86(3): 631 - 635. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Kooistra, Y.-H. Zhang, N. V. Henriquez, B. Weiss, D. Mumberg, and M. H. M. Noteborn TT virus-derived apoptosis-inducing protein induces apoptosis preferentially in hepatocellular carcinoma-derived cells J. Gen. Virol., June 1, 2004; 85(6): 1445 - 1450. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Okamoto, M. Takahashi, T. Nishizawa, A. Tawara, K. Fukai, U. Muramatsu, Y. Naito, and A. Yoshikawa Genomic characterization of TT viruses (TTVs) in pigs, cats and dogs and their relatedness with species-specific TTVs in primates and tupaias J. Gen. Virol., June 1, 2002; 83(6): 1291 - 1297. [Abstract] [Full Text] [PDF] |
||||
![]() |
TT virus infection: a novel virus-host relationship J. Med. Microbiol., June 1, 2002; 51(6): 455 - 458. [Full Text] [PDF] |
||||
![]() |
F. Maggi, M. Pistello, M. Vatteroni, S. Presciuttini, S. Marchi, P. Isola, C. Fornai, S. Fagnani, E. Andreoli, G. Antonelli, et al. Dynamics of Persistent TT Virus Infection, as Determined in Patients Treated with Alpha Interferon for Concomitant Hepatitis C Virus Infection J. Virol., December 15, 2001; 75(24): 11999 - 12004. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Okamoto, T. Nishizawa, M. Takahashi, A. Tawara, Y. Peng, J. Kishimoto, and Y. Wang Genomic and evolutionary characterization of TT virus (TTV) in tupaias and comparison with species-specific TTVs in humans and non-human primates J. Gen. Virol., September 1, 2001; 82(9): 2041 - 2050. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Bendinelli, M. Pistello, F. Maggi, C. Fornai, G. Freer, and M. L. Vatteroni Molecular Properties, Biology, and Clinical Implications of TT Virus, a Recently Identified Widespread Infectious Agent of Humans Clin. Microbiol. Rev., January 1, 2001; 14(1): 98 - 113. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Laurent, E. Esnault, G. Dambrine, A. Goudeau, D. Choudat, and D. Rasschaert Detection of avian oncogenic Marek's disease herpesvirus DNA in human sera J. Gen. Virol., January 1, 2001; 82(1): 233 - 240. [Abstract] [Full Text] |
||||
![]() |
C. Ott, L. Duret, I. Chemin, C. Trépo, B. Mandrand, and F. Komurian-Pradel Use of a TT virus ORF1 recombinant protein to detect anti-TT virus antibodies in human sera J. Gen. Virol., December 1, 2000; 81(12): 2949 - 2958. [Abstract] [Full Text] |
||||
![]() |
C.-L. Lin, W. Kyono, J. Tongson, P. K. Chua, D. Easa, R. Yanagihara, and V. R. Nerurkar Fecal Excretion of a Novel Human Circovirus, TT Virus, in Healthy Children Clin. Vaccine Immunol., November 1, 2000; 7(6): 960 - 963. [Abstract] [Full Text] [PDF] |
||||
![]() |
V. A. Arankalle, S. S. Gandhe, T. M. Deshmukh, M. S. Chadha, and A. M. Walimbe Prevalence and Phylogenetic Analysis of TT Virus DNA in Western India Clin. Vaccine Immunol., September 1, 2000; 7(5): 845 - 849. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. L. Hallett, J. P. Clewley, F. Bobet, P. J. McKiernan, and C. G. Teo Characterization of a highly divergent TT virus genome J. Gen. Virol., September 1, 2000; 81(9): 2273 - 2279. [Abstract] [Full Text] |
||||
![]() |
M. Worobey Extensive Homologous Recombination among Widely Divergent TT Viruses J. Virol., August 15, 2000; 74(16): 7666 - 7670. [Abstract] [Full Text] |
||||
![]() |
H. Okamoto, M. Ukita, T. Nishizawa, J. Kishimoto, Y. Hoshi, H. Mizuo, T. Tanaka, Y. Miyakawa, and M. Mayumi Circular Double-Stranded Forms of TT Virus DNA in the Liver J. Virol., June 1, 2000; 74(11): 5161 - 5167. [Abstract] [Full Text] |
||||
![]() |
R. Romeo, P. Hegerich, S. U. Emerson, M. Colombo, R. H. Purcell, and J. Bukh High prevalence of TT virus (TTV) in naive chimpanzees and in hepatitis C virus-infected humans: frequent mixed infections and identification of new TTV genotypes in chimpanzees J. Gen. Virol., April 1, 2000; 81(4): 1001 - 1007. [Abstract] [Full Text] |
||||
![]() |
H. Okamoto, M. Fukuda, A. Tawara, T. Nishizawa, Y. Itoh, I. Hayasaka, F. Tsuda, T. Tanaka, Y. Miyakawa, and M. Mayumi Species-Specific TT Viruses and Cross-Species Infection in Nonhuman Primates J. Virol., February 1, 2000; 74(3): 1132 - 1139. [Abstract] [Full Text] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| INT J SYST EVOL MICROBIOL | MICROBIOLOGY | J GEN VIROL |
| J MED MICROBIOL | ALL SGM JOURNALS | |