J Gen Virol Try IJSEM Online
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via CrossRef
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Wilcock, D.
Right arrow Articles by Smith, G. L.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Wilcock, D.
Right arrow Articles by Smith, G. L.
Agricola
Right arrow Articles by Wilcock, D.
Right arrow Articles by Smith, G. L.
Journal of General Virology (1999), 80, 2137-2148.
© 1999 Society for General Microbiology


Animal: DNA Viruses

The vaccinia virus A40R gene product is a nonstructural, type II membrane glycoprotein that is expressed at the cell surface

Diane Wilcockb,1, Stephen A. Duncanc,1, Paula Traktman2, Wei-Hong Zhang1 and Geoffrey L. Smith1

Sir William Dunn School of Pathology, University of Oxford, South Parks Road, Oxford OX1 3RE, UK1
Department of Microbiology and Molecular Genetics, Medical College of Wisconsin, 8701 Watertown Plank Road, Milwaukee, WI 53226, USA2

Author for correspondence: Geoffrey L. Smith.Fax +44 1865 275501. e-mail glsmith{at}molbiol.ox.ac.uk


   Abstract
TOP
Abstract
Introduction
Methods
Results
Discussion
References
 
Gene A40R from vaccinia virus (VV) strain Western Reserve has been characterized. The open reading frame (ORF) was predicted to encode a 159 amino acid, 18152 Da protein with amino acid similarity to C-type animal lectins and to the VV A34R protein, a component of extracellular enveloped virus (EEV). Northern blotting and S1 nuclease mapping showed that gene A40R is transcribed early during infection from a position 12 nucleotides upstream of the ORF, producing a transcript of approximately 600 nucleotides. Rabbit anti-sera were raised against bacterial fusion proteins containing parts of the A40R protein. These were used to identify an 18 kDa primary translation product and N- and O-glycosylated forms of 28, 35 and 38 kDa. The A40R proteins were detected early during infection, formed higher molecular mass complexes under non-reducing conditions and were present on the cell surface but absent from virions. The proteins partitioned with integral membrane proteins in Triton X-114. Canine pancreatic microsomal membranes protected in vitro-translated A40R from proteinase K digestion, suggesting the A40R protein has type II membrane topology. A mutant virus with the A40R gene disrupted after amino acid 50, so as to remove the entire lectin-like domain, and a revertant virus were constructed. Disruption of the A40R gene did not affect virus plaque size, in vitro growth rate and titre, EEV formation, or virus virulence in a murine intranasal model.


   Introduction
TOP
Abstract
Introduction
Methods
Results
Discussion
References
 
The determination of the complete DNA sequence of vaccinia virus (VV) Copenhagen (Goebel et al., 1990Down ) and most of Western Reserve (WR) [see (Smith et al. (1991)Down for references] has enabled a systematic analysis of VV genes which might encode membrane-associated, secreted or glycosylated proteins. Many ORFs predicted to encode proteins with putative signal sequences, hydrophobic membrane-spanning sequences and/or the motif Asn-X-Ser/Thr, the attachment site for N-linked carbohydrate, were identified by these and other analyses (Johnson et al., 1993Down ).

VV proteins with one or more of these properties can be classified into three categories. The first group comprises non-structural proteins that are secreted from the infected cell. Examples are the vaccinia growth factor (Stroobant et al., 1985Down ), the N1L gene product (Kotwal et al., 1989Down ), vaccinia complement protein (Kotwal & Moss, 1988Down ), the interleukin-1ß receptor (Alcamí & Smith, 1992Down ), the interferon (IFN)-{gamma} receptor (Alcamí & Smith, 1995Down ), the IFN-{alpha} receptor (Symons et al., 1995Down ) and the CC chemokine-binding protein (Patel et al., 1990Down ; Alcamí et al., 1998Down ). These proteins are non-essential for virus replication in vitro but in most cases affect virus virulence in vivo by interfering with the immune response to infection. The second group contains membrane-associated proteins that are incorporated into the extracellular enveloped virus (EEV) particle. Examples include the A56R (Shida, 1986Down ), F13L (Hirt et al., 1986Down ), A34R (Duncan & Smith, 1992Down ), B5R (Engelstad et al., 1992Down ; Isaacs et al., 1992Down ), A36R (Parkinson & Smith, 1994Down ) and A33R (Roper et al., 1996Down ) gene products. Proteins of the third group associate with membranes of the infected cell but are not present in virus particles. Examples are the A38L integral membrane protein (Parkinson et al., 1995Down ) and the surface antigen encoded by gene B18R (the IFN-{alpha}/ß receptor) (Ueda et al., 1990Down ). Several other early cell-surface antigens that have not been mapped to specific genes have been described (Mallon et al., 1985Down ; Mallon & Holowczak, 1985Down ).

In this paper we have characterized the VV WR A40R gene that previously was called SalF2R (Smith et al., 1991Down ). A40R was predicted to encode a membrane-associated protein with amino acid similarity to C-type animal lectins (Smith et al., 1991Down ) and to the VV A34R protein (Duncan & Smith, 1992Down ). We show here that the gene is expressed early during infection and encodes a type II membrane glycoprotein that is present on the cell surface but is not incorporated into intracellular mature virus (IMV) or EEV. Loss of the A40R gene does not affect virus plaque size, nor virus virulence in a mouse intranasal model.


   Methods
TOP
Abstract
Introduction
Methods
Results
Discussion
References
 
{blacksquare} Virus and cells.
VV WR was grown and titrated as described previously (Mackett et al., 1985Down ). CV-1, RK13, BS-C-1, TK-143B, Vero and D980R HeLa cells were grown in Dulbecco's modified Eagle's Medium (DMEM) supplemented with 10% foetal bovine serum (FBS).

{blacksquare} Plasmid construction
(i) Plasmids for construction of recombinant VVs (rVVs).
Plasmid pPROF1 containing the A40R ORF and flanking sequences was constructed by cloning a 3525 bp SalI–EcoRI fragment isolated from the SalI F fragment of VV WR (pSalIF) (Smith et al., 1991Down ) into pUC13. pPROF1 was digested with NsiI to remove a 99 bp fragment of the A40R ORF and treated with T4 DNA polymerase to create blunt termini. This small fragment was replaced with a 2·1 kb EcoRI fragment, that had been treated with Klenow enzyme to create blunt termini, which contained the Escherichia coli guanine phosphoribosyl transferase (Ecogpt) gene linked to the VV 7.5K promoter (Boyle & Coupar, 1988Down ). This plasmid was called pSAD3G. For expression of the A40R ORF from an IPTG-inducible VV promoter, a copy of the ORF was created by PCR using plasmid pPROF1 as template and oligonucleotides 5' CCCGGATCCATATGAACAAACATAAGACA and 3' CGGGGGATCCTTATATAGTGTAACACGA. Underlined nucleotides represent BamHI and NdeI sites. The PCR product was digested with BamHI and cloned into the BamHI site of plasmid pUC13 to form pSAD3. The A40R ORF was sequenced to confirm the fidelity of the PCR product and then excised with BamHI and cloned into the BamHI site of pPR35 downstream of the IPTG-inducible p4b promoter (Rodriguez & Smith, 1990aDown ) to form pSAD16. To attach an influenza virus haemagglutinin (HA) epitope tag (YPYDVPDYA) at the C terminus of A40R ORF, a DNA fragment was assembled by splicing by overlap extension (SOE). First, a fragment that contained a 5' XbaI site (underlined), the 150 nucleotides upstream of ORF A40R and the A40R ORF fused to a C-terminal HA tag (underlined) followed by a stop codon was produced by PCR using oligonucleotides 5' GCTCTAGACAAACTCGTAGCTCGCAAGTC and 3' AGCGTAATCAGGCACGTCGTAAGGGTATATAGTAGTGTAACACGAATGCAGTTTG as primers and pSalIF as template. Second, a fragment containing the HA tag (underlined), stop codon and 400 nucleotides downstream of the A40R ORF followed by a HindIII site (underlined) was constructed using oligonucleotides 5' TACGACGTGCCTGATTACGCTTAACAATTACACTACATTTTTATCATAC and 3' GCGAAGCTTTTAACAGAAGAATGTATAGTGGAC as primers and pSalIF as template. These two fragments were spliced together by SOE using the terminal oligonucleotides as primers and finally this fragment was digested with XbaI and HindIII and cloned into pGEM-3zf to form pGEM-A40RHA.

(ii) Expression of the A40R ORF as TrpE- and glutathione S-transferase (GST)-fusion proteins.
An EcoRI–BamHI fragment was excised from the replicative form of M13mp18 clone SalF164, which contains nucleotides 682–1008 from the left end of the SalIF fragment (Smith et al., 1991Down ), and was cloned into pUC13. The resultant plasmid, pSAD4, was digested with EcoRI, treated with Klenow enzyme and digested with BamHI. The released 340 bp fragment was inserted into pATH1 (Koerner et al., 1991Down ) which had been digested with HindIII, treated with Klenow enzyme and digested with BamHI. The derivative plasmid, pSAD26, contained the C-terminal 83 amino acids of A40R fused to the TrpE protein. To express the A40R ORF as a GST-fusion protein, a DNA fragment containing terminal BamHI sites and the sequences encoding A40R amino acids 1–10 and 55–85 was assembled by PCR using oligonucleotides 5' GCGGGATCCATGAATAAGCACAAAACGGACTACGCGGGCTGTCCTACTGACTGGATA and 3' GCGGGATCCTTTGCATGCATTACGTCC as primers and pSalIF as template. The PCR fragment was digested with BamHI and cloned into pGEX-2T (Pharmacia) to form pGEX-A40R.

(iii) Plasmids for in vitro transcription of the A40R ORF.
The A40R ORF was excised from pSAD3 as a BamHI fragment and cloned into pGEM-3Zf. Clones were isolated with the ORF under the control of either the T7 or SP6 promoter and were termed pA40R-T7 and pA40R-SP6, respectively.

{blacksquare} Transcriptional mapping.
mRNA was extracted from VV-infected cells early or late during infection and A40R transcripts were identified by Northern blotting and S1 nuclease protection experiments as described previously (Duncan & Smith, 1992Down ).

{blacksquare} Construction of rVVs.
An rVV with 99 bp of the A40R ORF replaced with the Ecogpt gene cassette was constructed by transfection of plasmid pSAD3G into CV-1 VV WR-infected cells. A mycophenolic acid (MPA)-resistant rVV, v{Delta}A40R, was isolated by plaque assay on CV-1 cells as described previously (Falkner & Moss, 1988Down ). A revertant virus, vRA40R, in which the A40R gene was reinserted into v{Delta}A40R was constructed by transfecting v{Delta}A40R-infected cells with pSalIF and selection of Ecogpt- virus on D980R cells (Kerr & Smith, 1991Down ) in the presence of 1  µg/ml 6-thioguanine (Isaacs et al., 1990Down ). An rVV, vindA40R, that contained only an IPTG-inducible version of the A40R ORF, was constructed by transfecting plasmid pSAD16 into v{Delta}A40R-infected TK-143B cells and selecting thymidine kinase- virus as described (Rodriguez & Smith, 1990bDown ). Finally, an rVV (vA40RHA) that contained an HA tag fused to the C terminus of A40R ORF was constructed by transfection of plasmid pGEM-A40RHA into v{Delta}A40R-infected CV-1 cells and selection on D98OR cells in the presence of 6-thioguanine.

{blacksquare} Immunoblotting.
Antisera to A40R were produced by immunization of rabbits with fusion proteins produced in E. coli. The immunoglobulin (Ig) fraction of the anti-A40R–TrpE serum (called anti-A40R1) was isolated by sodium sulphate fractionation and DEAE chromatography as described (Parkinson & Smith, 1994Down ). Anti-A40R2 Ig was purified by passing anti-GST–A40R serum through a GST–Sepharose 4B (Pharmacia Biotech) column and then passing the unbound Ig through a GST–A40R–Sepharose column. The bound Ig was eluted in 100 mM glycine (pH 2·5), dialysed against PBS and concentrated. Cells were harvested at the indicated time post-infection (p.i.) and lysates were resolved by SDS–PAGE and transferred electrophoretically to nitrocellulose. Immunoblotting was performed using the enhanced chemiluminescence (ECL) detection system (Amersham) according to the manufacturer's instructions.

{blacksquare} Immunofluorescence and confocal microscopy.
BS-C-1 cells were grown on glass coverslips and infected with indicated viruses at 1 p.f.u. per cell. At 8 h p.i. the cells were washed in ice-cold PBS and fixed in ice-cold acetone for 1 min. After drying, the cells were blocked in PBS, 5% FBS, 1% BSA for 1 h at room temperature and then incubated with mouse monoclonal antibody (MAb) HA1.1 (BAcC0, Berkeley, CA, USA) against the influenza HA tag, or biotinylated mouse MAb AB1.1 against the VV D8L protein (Parkinson & Smith, 1994Down ). After washing, bound antibody was detected with fluorescein-isothiocyanate (FITC)-conjugated donkey anti-mouse (DAM) or rhodamine-conjugated streptavidin (Rd-strep) (Serotech). For analysis of non-permeabilized cells, the primary MAb was added to cells on ice, unbound MAb was removed by washing and the cells were then fixed in acetone and treated as for permeabilized cells (above). Samples were mounted in 90% glycerol, 2·5% (w/v) diazabicydo and 10% PBS and analysed by using a Bio-Red MRC 1024 confocal microscope.

{blacksquare} In vitro transcription–translation.
Plasmids pA40R-T7 and pA40R-SP6 were linearized with SalI and used as templates for synthesis of uncapped transcripts using the Promega riboprobe core system with T7 RNA polymerase. The completed transcription reactions were treated with RNase-free DNase, extracted twice with phenol–chloroform, once with chloroform and precipitated with ethanol. Pelleted RNA was redissolved in nuclease-free water. Translation reactions were performed using the ECL in vitro translation system (Amersham) as directed by the manufacturer. RNA template was used at a concentration of 30 µg/ml and 1·8 µl canine pancreatic microsomal membranes (Promega) were added per 25 µl reaction where indicated. Reactions were incubated for 1 h at 30 °C. Translation products were resolved by SDS–PAGE, transferred to nitrocellulose and biotinylated proteins were detected with streptavidin-conjugated horseradish peroxidase (Vectastain Elite ABC kit, Vector Laboratories) and ECL (Amersham).

{blacksquare} Measurement of virus virulence.
Groups of 5 female BALB/c mice (5–6-weeks-old) were infected intranasally with 104 or 105 p.f.u. of VV WR, v{Delta}A40R or vRA40R in 20 µl PBS. Animals were weighed daily and those showing more than 30% loss of original body weight were sacrificed by cervical dislocation.


   Results
TOP
Abstract
Introduction
Methods
Results
Discussion
References
 
Sequence analysis
The VV WR SalI F fragment contains an ORF of 159 codons with the potential to encode a membrane-associated glycoprotein that originally was called SalF2R (Smith et al., 1991Down ), but hereafter will be referred to as A40R, the name of the equivalent ORF in VV Copenhagen (Goebel et al., 1990Down ). Near the N terminus of the predicted A40R protein there are 23 hydrophobic amino acid residues which could function as a signal and or anchor sequence. Towards the C terminus a more hydrophilic region contains three potential sites for addition of asparagine-linked carbohydrate (N-X-S/T, where X is any amino acid except P). The predicted protein sequence also contains three threonine-O-glycosylation motifs (Gooley et al., 1991Down ).

Comparison of the A40R sequence with the SWISS-PROT protein database revealed similarity to several proteins from fowlpox virus (Tomley et al., 1988Down ), to VV A34R (Duncan & Smith, 1992Down ) and to the family of calcium-dependent (C-type) animal lectins. The C-type lectin superfamily includes selectins that enable lymphocytes to localize at sites of inflammation, collectins that are thought to function in humoral defence by binding to the surface carbohydrates of pathogens, and a number of membrane-bound receptors that mediate endocytosis of glycoproteins (Drickamer, 1993Down ). These proteins are characterized by one or more carbohydrate-recognition domains (CRD) of 115–130 amino acids including 14 invariant of 32 conserved residues. The crystal structures of the C-type lectin domain of the rat mannose-binding protein and of E-selectin have been determined (Weis et al., 1991Down , 1992Down ; Graves et al., 1994Down ). The C-type lectins most closely related to A40R are natural killer cell receptors, human low affinity IgE receptor (CD23) and human early lymphocyte activation antigen (CD69). The highest FASTA score (198) with a non-poxvirus protein was against the human natural killer cell G2-A protein (accession no. P26715). A40R conforms well to approximately the first half of the C-type CRD but then differs significantly and overall contains only 5/14 and 17/32 of the invariant and conserved residues, respectively. One of the cysteine residues predicted to form an intradomain disulphide bond and sequences corresponding to loop 2 and ß sheet 5 are missing. However, other lectins that lack a number of conserved residues and have deletions in loop regions are still predicted to form a C-type lectin fold and have been demonstrated to bind carbohydrate. Thus it is uncertain if the A40R gene product will have lectin activity. For amino acid alignment of A40R with other poxvirus proteins and several lectins see Duncan & Smith (1992)Down .

Transcriptional analyses
Downstream of A40R and before the next ORF, A41L, there are three potential sites for termination of early transcription [(T)5NT (Yuen & Moss, 1987Down )] in the rightward direction and two in the leftward direction, indicating that transcriptional interference between A40R and A41L is unlikely early during infection. Upstream of A40R, the presence of the sequence AC(A)3TG(A)7, which closely resembles the VV early promoter consensus (A)5TG(A)8 (Davison & Moss, 1989aDown ), and the absence of the sequence TAAAT that is found at the RNA start sites of most late genes (Rosel et al., 1986Down ; Davison & Moss, 1989bDown ), suggest that A40R might be transcribed early during infection. This prediction was examined experimentally by Northern blotting and S1 nuclease protection analyses of RNA extracted from VV-infected cells either early (6 h in the presence of cycloheximide) or late (16 h) after infection. Fig. 1(aDown) shows that a 32P-labelled single-stranded probe complementary to nucleotides 84–411 of the A40R ORF coding strand detected an early transcript of approximately 600 nucleotides and heterogeneous RNAs made late during infection. The latter observation is consistent with the known heterogeneity of late VV mRNAs. These transcripts may, therefore, initiate either from a proximal A40R late promoter or from start sites further upstream. To address this, and to accurately map the 5' end of the early transcript, an S1 nuclease protection experiment was performed using a probe that was labelled at the SphI site 252 nucleotides downstream from the 5' end of the ORF and which extended 614 nucleotides upstream (Fig. 1b)Down. This probe was protected partially from S1 nuclease digestion by hybridization to early RNA (lane 2) and the size of the protected RNA fragment indicated that transcription initiated 12 nucleotides upstream of the ORF. Late RNA protected only the full-length probe (lane 1), showing that no late initiation site lies between 362 nucleotides upstream and 252 nucleotides downstream of the 5' end of ORF. Allowing for addition of a poly(A) tail, the size of the early transcript detected by Northern blotting is consistent with initiation 12 bp upstream of the ORF and termination approximately 50 nucleotides downstream of any of the three clustered T5NT motifs located shortly after the A40R ORF.



View larger version (68K):
[in this window]
[in a new window]
 
Fig. 1. Transcriptional analyses of the A40R gene. (a) Northern blot. RNA isolated from VV-infected cells early (lane 3) or late (lane 2) during infection, or from mock-infected cells (lane 1) was resolved by agarose gel electrophoresis, transferred to a nitrocellulose membrane and probed with a single-stranded, 32P-labelled DNA fragment specific for the A40R ORF. Double-stranded DNA size markers (M) are shown in kilobases. The early A40R transcript of approximately 600 nucleotides is indicated by an arrow. (b) S1 nuclease protection analysis. A 32P-labelled DNA probe (lane 4) was hybridized overnight with RNA isolated from VV-infected cells early (lane 2) or late (lane 1) during infection, or with tRNA (lane 3) and then digested with S1 nuclease. Protected DNA fragments were resolved by electrophoresis on a 6% polyacrylamide gel alongside a sequencing ladder and detected by autoradiography. Underneath the autoradiograph the position of the single-stranded labelled DNA fragment relative to the A40R ORF is illustrated. The deduced early transcription initiation site is shown by asterisks adjacent to the nucleotide and amino acid sequences.

 
Disruption of the A40R ORF in the virus genome
To investigate the function of the A40R gene, an rVV (v{Delta}A40R) was constructed in which the ORF was disrupted by insertion of the Ecogpt gene cassette after amino acid 50 so that the entire lectin-like domain of A40R would not be expressed. To ensure that any phenotypic difference seen with v{Delta}A40R was not due to mutations elsewhere in the virus genome, a revertant virus, vRA40R, was made by reinserting the A40R gene at its natural locus. The genomes of the WT, v{Delta}A40R and vRA40R viruses were analysed by PCR and Southern blotting and found to have the predicted structures (data not shown).

Growth properties of v{Delta}A40R
During plaque-purification of v{Delta}A40R there was no apparent difference in the size or morphology of plaques compared to WT. Nevertheless, it was possible that there were slight differences in the virus yield that would not be reflected in plaque size and so the growth kinetics of v{Delta}A40R, WT and vRA40R viruses were compared. After infection of RK13 cells with 0·1 p.f.u. per cell, the yields of cell-associated virus or virus recovered from the medium of infected cells were indistinguishable for the three viruses (Fig. 2Down). Similarly, after infection with 0·001 or 10 p.f.u. per cell there were no differences in virus yields in either RK13 or CV-1 cells (data not shown).



View larger version (19K):
[in this window]
[in a new window]
 
Fig. 2. Growth curves of WT, v{Delta}A40R and vRA40R viruses. RK13 cells were infected at 0·1 p.f.u. per cell. At various times p.i. cells and media were harvested and virus infectivity was titrated by plaque assay on BS-C-1 cells. The virus titres in the cells (a) and supernatant (b) are shown.

 
To compare more accurately the amounts of EEV produced by WT, v{Delta}A40R and vRA40R, RK13 cells infected at 10 p.f.u. per cell were labelled with [3H]thymidine and the EEV present in the supernatant at 24 h p.i. was measured by caesium chloride density-gradient centrifugation (Parkinson & Smith, 1994Down ). Similar levels of EEV were produced by v{Delta}A40R, WT and vRA40R infections (data not shown), confirming that the A40R gene is dispensable for the production of normal amounts of either EEV or IMV.

Characterization of A40R protein in infected-cell extracts
Anti-A40R1 Ig was used in immunoblots of extracts from cells infected with either VV WR or v{Delta}A40R. Cells were infected in the presence or absence of cytosine arabinoside (araC), an inhibitor of virus DNA replication and late gene expression, to produce early and late virus proteins, respectively. Proteins that were specific to WR-infected cells were detected in both early and late infected-cell extracts (Fig. 3a),Down consistent with the early transcription of the gene (Fig. 1)Up, and suggesting either continued translation late during infection or that the protein is stable. Immunoprecipitation of A40R from metabolically labelled infected-cell extracts showed that it is synthesized only at early times of infection and is stable (data not shown). Three major proteins of 28, 35 and 38 kDa were detected early, with the 28 kDa form becoming less abundant late in infection. Longer exposure also revealed a minor protein of 18 kDa at both early and late times. The size of this band is close to that of the predicted primary A40R translation product (18152 Da) and its abundance increased in the presence of tunicamycin (see below), suggesting that it represented unglycosylated A40R protein.



View larger version (57K):
[in this window]
[in a new window]
 
Fig. 3. Characterization of the A40R protein. (a) The A40R protein is synthesized early during infection. BS-C-1 cells were mock-infected (m) or infected with v{Delta}A40R ({Delta}) or WR virus at 15 p.f.u. per cell in the presence or absence of 40 µg/ml araC. At 24 h p.i. the cells were washed in cold PBS, scraped into PBS and spun at 1500 r.p.m. for 5 min. Cell pellets were resuspended in 1xLaemmli buffer, sonicated, resolved by SDS–PAGE (15% gel) and immunoblotted with anti-A40R1 Ig. Lanes are E (early, +araC) or L (late, -araC). (b) The A40R protein is glycosylated. BS-C-1 cells were mock-infected (m) or infected with v{Delta}A40R ({Delta}) or WR at 15 p.f.u. per cell in the presence or absence of 1 µg/ml tunicamycin or 1 µM monensin. Cells were harvested at 24 h p.i. and treated as described in (a). (c) The A40R protein forms higher molecular mass complexes. BS-C-1 cells were infected with wild-type (WT), v{Delta}A40R ({Delta}) or vRA40R virus at 50 p.f.u. per cell. Cells were harvested at 6 h p.i. and treated as described in (a) except that the -2mE samples were dissolved in Laemmli buffer that lacked 2-mercaptoethanol. The arrow indicates the non-reduced form of the A40R protein. Positions of protein size markers are shown in kDa.

 
The detection of multiple protein bands and the presence of potential N- and O-linked glycosylation sites in the A40R amino acid sequence suggested that the protein was glycosylated. To investigate this, immunoblots were performed on extracts from cells infected in the presence of either tunicamycin or monensin, which inhibit glycosylation occurring in the endoplasmic reticulum and trans-Golgi, respectively (Fig. 3b)Up. Infection in the presence of tunicamycin blocked the formation of higher molecular mass forms of A40R and only the 18 kDa primary translation product was detected. Treatment with monensin produced A40R bands of intermediate size (27 and 30 kDa), consistent with the prevention of late (trans-Golgi) modifications to the protein.

The lack of expression of WT A40R by v{Delta}A40R is shown in Fig. 3(a, b, c)Up. These analyses might not have detected the N-terminal, 50 amino acid peptide predicted to be synthesized by v{Delta}A40R due to its small size, lack of recognition by the antisera or instability. Fig. 3(c)Up also confirms that the revertant virus, vRA40R, produced A40R proteins like WT virus. Omission of 2-mercaptoethanol from the sample buffer resulted in detection of A40R proteins of approximately 70 and 76 kDa, which are possibly dimers of glycosylated A40R (Fig. 3 c)Up.

A40R partitions with integral membrane proteins in Triton X-114
Triton X-114 partitioning has been used to separate hydrophobic integral membrane proteins from hydrophilic soluble proteins (Bordier, 1981Down ). Therefore, the partitioning of A40R in Triton X-114 was investigated in infected-cell extracts. An rVV, vindA40R, was used because in the presence of IPTG this virus makes greater amounts of A40R protein than VV WR. The A40R proteins partitioned predominantly to the detergent phase (Fig. 4aDown, lane 2) as did the EEV protein B5R, under the same conditions (Fig. 4bDown, lanes 2). In contrast, the soluble VV core protein kinase, B1R, partitioned exclusively to the aqueous phase as expected (Fig. 4bDown, lanes 1). Thus A40R exhibits phase separation characteristics typical of integral membrane proteins.



View larger version (27K):
[in this window]
[in a new window]
 
Fig. 4. Phase separation of A40R in Triton-X-114. BS-C-1 cells were infected at 10 p.f.u. per cell with v{Delta}A40R or with vindA40R in the presence of IPTG. Cells were harvested 24 h p.i. and separated into aqueous (1) and detergent (2) phases (Bordier, 1981Down ). The two phases were made equal in volume, salt and detergent concentration and analysed by SDS–PAGE and immunoblotting using (a) anti-A40R1 Ig (diluted 1/250) or (b) anti-B5R (diluted 1/5000) (Engelstad et al., 1992Down ) and anti-B1R antibodies (diluted 1/250) (Banham & Smith, 1992Down ). Arrows in (a) indicate the positions of the A40R proteins. Positions of protein size markers are shown in kDa.

 
In vitro translation of A40R
The amino acid sequence of A40R suggests that the protein has type II membrane topology. To address the membrane topology of A40R experimentally, the protein was transcribed and translated in vitro in the presence or absence of canine pancreatic microsomal membranes. In the absence of microsomes an unglycosylated 18 kDa protein was synthesized (Fig. 5, lane pA40R-T7)Down that was not evident using a plasmid containing the A40R protein in the reverse orientation (pA40R-SP6). Translation in the presence of microsomal membranes produced two A40R proteins of 35 and 38 kDa, approximately the same size as those seen in infected-cell extracts at late times of infection (compare Fig. 5bDown, lanes 1 and 2, with Fig. 3Up). Since the potential asparagine-linked glycosylation sites are near the C terminus of the protein, this observation confirmed that the C terminus is within the vesicle. These glycosylated forms of A40R pelleted with the microsomal membranes when the translation-reaction mixtures were centrifuged at 13000 r.p.m. in a microfuge for 30 min at 4 °C (data not shown), providing further evidence for membrane- or vesicle-association of the A40R proteins.



View larger version (42K):
[in this window]
[in a new window]
 
Fig. 5. In vitro transcription and translation of A40R. (a) Synthesis of A40R protein in the absence of microsomal membranes. Translation reactions were performed using RNA transcribed from templates pA40R-T7 or pA40R-SP6 that contain the A40R ORF in the positive or reverse orientation, respectively. A 2·5 µl aliquot of each reaction was mixed with an equal volume of 2xLaemmli buffer, heated at 60 °C for 2 min and resolved by SDS–PAGE (15% gel) before transfer to nitrocellulose and detection as described in Methods. (b) A40R associated with microsomal membranes is protected from proteinase K digestion. Translation reactions were performed in the presence of microsomal membranes using RNA transcribed from pA40R-T7 (lanes 1–3) or plasmid A40R-SP6 (lanes 4–6). After incubation at 30 °C for 1 h, 6 µl aliquots from each reaction were mixed with 6 µl of either PBS (lanes 1 and 4), 0·1 mg/ml proteinase K in PBS (lanes 2 and 5) or 0·1% Triton X-100 plus 0·1 mg/ml proteinase K in PBS (lanes 3 and 6) and incubated on ice for 30 min. Proteinase K was inactivated by addition of 2·5 µl 100 mM PMSF before addition of Laemmli buffer and analysis as in (a). Arrows indicate the positions of the A40R proteins. Positions of protein size markers are shown in kDa.

 
A40R proteins synthesized in the presence of microsomes were resistant to proteinase K digestion, but became sensitive after treatment of the membrane-associated translation products with Triton X-100 to lyse the membranes (Fig. 5b)Up. No shift in mobility of the membrane-associated proteins was observed in the presence of proteinase K without detergent treatment. This is consistent with only seven amino acids upstream of the putative hydrophobic signal/anchor sequence being exposed to proteinase and even if these residues were digested the difference may have been too small to detect on this gel. Thus the A40R protein is a membrane-associated glycoprotein with type II membrane topology.

The A40R protein is expressed at the cell surface
The anti-A40R Ig fractions did not work well for immunofluorescence and so the subcellular location of the A40R protein was addressed using an rVV in which the endogenous A40R protein was replaced by A40RHA containing an HA epitope fused to the C terminus. vA40RHA formed a similar sized plaque and produced a similar amount of A40R protein compared to WR virus (data not shown). Cells infected with vA40RHA or WR were stained with MAb against the HA tag before or after membrane permeabilization (Fig. 6ac).Down The A40RHA protein was detected readily in vA40RHA-infected cells but not in WR-infected cells. In permeabilized cells the A40RHA protein was present in the perinuclear region and punctate cytoplasmic structures that might represent the Golgi network and exocytic vesicles, respectively. In non-permeabilized cells the A40RHA protein was detected at the cell surface. The recognition of the C-terminal HA tag at this location in non-permeabilized cells confirmed that the C terminus of the A40R protein was outside the cell, consistent with a type II membrane topology.



View larger version (119K):
[in this window]
[in a new window]
 
Fig. 6. Immunofluorescent analysis of infected cells. (a)–(c) Localization of A40R protein in infected cells. BS-C-1 cells were infected by WR (a) or vA40RHA (b , c) at 1 p.f.u. per cell. At 8 h p.i. the permeabilized or non-permeabilized cells were stained with MAb HA1.1 (diluted 1:400) and revealed by FITC-conjugated DAM IgG. (d)–(f) The A40R protein is not present on virions. BS-C-1 cells were infected by vA40RHA at 1 p.f.u. per cell and fixed with acetone at 8 h p.i. The cells were stained with HA1.1 and then FITC-DAM IgG, and then fixed again in acetone and stained with biotinylated MAb AB1.1 (diluted 1:100) and then Rd-strep (diluted 1:100). Panels (d)–(f) represent analysis of the same cell. Panels (d) and (e) show FITC- and Rd-fluorescence respectively, and panel (f) shows the merged Rd- and FITC-signals. Size bar, 3 µm.

 
The A40R protein is not incorporated into virions
To examine if the A40R protein became associated with virions, vA40RHA-infected cells were stained with MAbs to the HA tag or VV protein D8L (Fig. 6d–f)Up. Merged images of D8L-positive virions and HA-tag-positive structures showed these were mostly not coincident. Similarly, if intracellular enveloped virus (IEV) and cell-associated enveloped virus (CEV) particles were stained with anti-B5R MAb, the B5R-positive virions were not coincident with HA-positive structures, although some co-localization in the Golgi was evident (data not shown).

As an independent way to assess whether the A40R protein is incorporated into virions, IMV and EEV were purified from WR-infected cells or the culture supernatant by sucrose density-gradient centrifugation and were analysed by immunoblotting. No A40R protein was detected in virions despite these proteins being detected easily in infected-cell extracts (Fig. 7a).Down For comparison, the D8L and B5R proteins were detected at similar levels in infected-cell extracts and virions (Fig. 7b, c)Down. The lack of B5R in IMV confirmed the purity of this preparation.



View larger version (45K):
[in this window]
[in a new window]
 
Fig. 7. Immunoblot showing the absence of A40R protein in IMV and EEV. IMV and EEV were purified by sucrose density-gradient centrifugation and 3  µg of proteins was analysed by SDS–PAGE (10% gel) together with extracts from BS-C-1 cells that had been infected with WR at 10 p.f.u. per cell for 15 h. After transfer to nitrocellulose filters, proteins were detected by immunoblotting with anti-A40R2 (a), rat MAb 19C2 (B5R) (b) and MAb AB1.1 (D8L) (c). The positions of protein size markers are shown in kDa.

 
v{Delta}A40R is not attenuated in mice infected intranasally
There are many VV genes that are non-essential for virus replication in vitro but which affect virus virulence in vivo. The virulence of v{Delta}A40R was therefore compared to WT and vRA40R using a murine intranasal model (Turner, 1967Down ). Fig. 8Down shows that animals infected with these viruses at doses of 104 and 105 p.f.u. suffered similar substantial weight loss and had to be sacrificed. Therefore, in this model at least, the A40R gene does not play a role in VV virulence.



View larger version (20K):
[in this window]
[in a new window]
 
Fig. 8. Virulence assay. Groups of five, 5–6-week-old, female, BALB/c mice were infected intranasally with (a) 104 or (b) 105 of WR, v{Delta}A40R or vRA40R viruses. Animals were weighed daily. The data shown represent the mean weight of each group of animals compared to the same group on the day of infection (indicated by arrow). Animals that had lost greater than 30% of their body weight were sacrificed.

 

   Discussion
TOP
Abstract
Introduction
Methods
Results
Discussion
References
 
The VV WR gene A40R is shown to encode a type II membrane glycoprotein that is expressed early during infection and forms higher molecular mass complexes under non-reducing conditions. The protein is expressed on the cell surface but is not incorporated into IMV or EEV particles. A virus with a disrupted A40R ORF replicated normally in vitro and had unaltered virulence in mice that were infected intranasally.

An interesting comparison may be made between the VV A40R and A34R proteins. These two proteins show amino acid similarity to the family of C-type lectins and have a type II membrane topology with the relatively hydrophilic C terminus, including the CRD, positioned on the outside of the cell (Duncan & Smith, 1992Down ). This topology was confirmed for A40R by glycosylation of the protein translated in vitro in the presence of microsomal membranes, protection of the membrane-associated protein from proteinase K digestion, and detection of the A40RHA protein on the cell surface by MAb directed against the C-terminal HA tag. Similarly, the A34R protein has type II membrane topology as shown by its detection on the EEV surface with a C-terminal specific antibody (Duncan & Smith, 1992Down ) and by in vitro translation in the presence of microsomes and subsequent digestion with proteases (Parkinson et al., 1995Down ). The A34R and A40R proteins are both glycosylated and form multiple glycoproteins and higher molecular mass complexes. In other respects, however, the proteins differ. A40R is expressed early during infection while A34R is late. A40R was not detected in virions and is present on the surface of the infected cells, while the A34R protein is part of the EEV outer envelope. A40R does not affect virus plaque formation, in vitro replication or virulence in mice, while A34R affects normal plaque formation, EEV release and virus virulence (Duncan & Smith, 1992Down ; Blasco et al., 1993Down ; McIntosh & Smith, 1996Down ).

In terms of conservation in orthopoxviruses the two proteins also differ. A comparison of the VV WR A40R (Smith et al., 1991Down ) to the equivalent protein in VV Copenhagen (Goebel et al., 1990Down ) showed that a frameshift mutation replaces the C-terminal 22 amino acids of WR with 31 unrelated residues in Copenhagen. Immunoblotting showed that VV International Health Department (IHD)-J strain did not express the A40R protein (data not shown) and the sequences of variola viruses Harvey-1947 (Aguado et al., 1992Down ), India-1967 (Shchelkunov et al., 1995Down ) and Bangladesh-1975 (Massung et al., 1994Down ) show that in each case the A40R gene is disrupted. In contrast, the A34R protein is very highly conserved between these viruses (McIntosh & Smith, 1996Down ). VV possess other groups of genes encoding proteins that belong to the same protein superfamily but which have different roles in the virus life-cycle, for example the VV proteins belonging to the Ig, complement control protein, serine protease inhibitor and protein kinase superfamilies (Johnson et al., 1993Down ; Moss, 1996Down ).

A40R shares amino acid similarity to the CRD domain of C-type animal lectins. The C-type lectin CRDs have relatively low affinity for their cognate ligands and in some cases this is compensated for by having multiple CRDs in a single polypeptide chain or by having a single CRD linked to an {alpha}-helical region that can enable oligomerization via coiled-coil interactions (Drickamer, 1993Down ). In this regard, it is noteworthy that the A40R protein forms higher molecular mass complexes in the absence of reducing agents. C-type lectins function in a number of processes that constitute the host response to infection and it possible that A40R has, or once had, a role in interfering with one or more of these processes. The low but significant amino acid similarity of A40R to several C-type lectins, particularly the natural killer (NK) cell proteins that recognize class I major histocompatibility complex (MHC) antigens, is intriguing. These NK cell proteins engage class I MHC molecules on other cells and send signals that prevent activation of the NK cell. However, in the absence of class I MHC antigens the NK cell may be activated and kill the target cell. Since the A40R protein would be present on infected cells, rather than NK cells, it is unclear if this protein would be in a position to affect activation of the NK cell. Experiments to investigate these and other possibilities are in progress.


   Acknowledgments
 
We thank Paco Rodriguez for plasmid pPROF1, Christopher M. Sanderson for discussion and assistance with confocal microscopy, Julian A. Symons for critical reading of the manuscript and Sara Thompson, Chris Daw and Niall Higbee for cell culture. S.A.D. was the recipient of an MRC AIDS Directed Programme Research Studentship. This work was supported by MRC programme grant PG8901790.


   Footnotes
 
b Present address: Cambridge Antibody Technology Ltd, The Science Park, Melbourn, Royston SG8 6JJ, UK. Back

c Present address: Department of Cell Biology, Neurobiology and Anatomy, Medical College of Wisconsin, 8701 Watertown Plank Road, Milwaukee, WI 53226, USA. Back


   References
TOP
Abstract
Introduction
Methods
Results
Discussion
References
 
Aguado, B., Selmes, I. P. & Smith, G. L. (1992). Nucleotide sequence of 21·8 kbp of variola major virus strain Harvey and comparison with vaccinia virus. Journal of General Virology 73, 2887-2902.[Abstract/Free Full Text]

Alcamí, A. & Smith, G. L. (1992). A soluble receptor for interleukin-1ß encoded by vaccinia virus: a novel mechanism of virus modulation of the host response to infection. Cell 71, 153-167.[Medline]

Alcamí, A. & Smith, G. L. (1995). Vaccinia, cowpox, and camelpox viruses encode soluble gamma interferon receptors with novel broad species specificity. Journal of Virology 69, 4633-4639.[Abstract]

Alcamí, A., Symons, J. A., Collins, P. D., Williams, T. J. & Smith, G. L. (1998). Blockade of chemokine activity by a soluble chemokine binding protein from vaccinia virus. Journal of Immunology 160, 624-633.[Abstract/Free Full Text]

Banham, A. H. & Smith, G. L. (1992). Vaccinia virus gene B1R encodes a 34-kDa serine/threonine protein kinase that localizes in cytoplasmic factories and is packaged into virions. Virology 191, 803-812.[Medline]

Blasco, R., Sisler, J. R. & Moss, B. (1993). Dissociation of progeny vaccinia virus from the cell membrane is regulated by a viral envelope glycoprotein: effect of a point mutation in the lectin homology domain of the A34R gene. Journal of Virology 67, 3319-3325.[Abstract/Free Full Text]

Bordier, C. (1981). Phase separation of integral membrane proteins in Triton X-114 solution. Journal of Biological Chemistry 256, 1604-1607.[Abstract/Free Full Text]

Boyle, D. B. & Coupar, B. E. H. (1988). A dominant selectable marker for the construction of recombinant poxviruses. Gene 65, 123-128.[Medline]

Davison, A. J. & Moss, B. (1989a). Structure of vaccinia virus early promoters. Journal of Molecular Biology 210, 749-769.[Medline]

Davison, A. J. & Moss, B. (1989b). Structure of vaccinia virus late promoters. Journal of Molecular Biology 210, 771-784.[Medline]

Drickamer, K. (1993). The biology of animal lectins. Annual Review of Cell Biology 9, 237-264.

Duncan, S. A. & Smith, G. L. (1992). Identification and characterization of an extracellular envelope glycoprotein affecting vaccinia virus egress. Journal of Virology 66, 1610-1621.[Abstract/Free Full Text]

Engelstad, M., Howard, S. T. & Smith, G. L. (1992). A constitutively expressed vaccinia virus gene encodes a 42 kDa glycoprotein related to complement control factors that forms part of the extracellular envelope. Virology 188, 801-810.[Medline]

Falkner, F. G. & Moss, B. (1988). Escherichia coli gpt gene provides dominant selection for vaccinia virus open reading frame expression vectors. Journal of Virology 62, 1849-1854.[Abstract/Free Full Text]

Goebel, S. J., Johnson, G. P., Perkus, M. E., Davis, S. W., Winslow, J. P. & Paoletti, E. (1990). The complete DNA sequence of vaccinia virus. Virology 179, 247-266.[Medline]

Gooley, A. A., Classon, B. J., Marschalek, R. & Williams, K. L. (1991). Glycosylation sites identified by detection of glycosylated amino-acids released from Edman degradation – the identification of Xaa-Pro-Xaa-Xaa as a motif for Thr-O-glycosylation. Biochemical and Biophysical Research Communications 178, 1194-1201.[Medline]

Graves, B. J., Crowther, R. L., Chandran, C., Rumberger, J. M., Li, S., Huang, K.-S., Presky, D. H., Familletti, P. C., Wolitsky, B. A. & Burns, D. K. (1994). Insight into E-selectin/ligand interaction from the crystal structure and mutagenesis of the lec/EGF domains. Nature 367, 532-538.[Medline]

Hirt, P., Hiller, G. & Wittek, R. (1986). Localization and fine structure of a vaccinia virus gene encoding an envelope antigen. Journal of Virology 58, 757-764.[Abstract/Free Full Text]

Isaacs, S. N., Kotwal, G. J. & Moss, B. (1990). Reverse guanine phosphoribosyltransferase selection of recombinant vaccinia viruses. Virology 178, 626-630.[Medline]

Isaacs, S. N., Wolffe, E. J., Payne, L. G. & Moss, B. (1992). Characterization of a vaccinia virus-encoded 42-Kilodalton class I membrane glycoprotein component of the extracellular virus envelope. Journal of Virology 66, 7217-7224.[Abstract/Free Full Text]

Johnson, G. P., Goebel, S. J. & Paoletti, E. (1993). An update on the vaccinia virus genome. Virology 196, 381-401.[Medline]

Kerr, S. M. & Smith, G. L. (1991). Vaccinia virus DNA ligase is nonessential for virus replication: recovery of plasmids from virus-infected cells. Virology 180, 625-632.[Medline]

Koerner, T. J., Hill, J. E., Myers, A. M. & Tzagoloff, A. (1991). High expression vectors with multiple cloning sites for construction of trpE fusion genes: pATH vectors. Methods in Enzymology 194, 477-490.[Medline]

Kotwal, G. J. & Moss, B. (1988). Vaccinia virus encodes a secretory polypeptide structurally related to complement control proteins. Nature 335, 176-178.[Medline]

Kotwal, G. J., Hugin, A. W. & Moss, B. (1989). Mapping and insertional mutagenesis of a vaccinia virus gene encoding a 13,800-Da secreted protein. Virology 171, 579-587.[Medline]

McIntosh, A. A. G. & Smith, G. L. (1996). Vaccinia virus glycoprotein A34R is required for infectivity of extracellular enveloped virus. Journal of Virology 70, 272-281.[Abstract]

Mackett, M., Smith, G. L. & Moss, B. (1985). The construction and characterization of vaccinia virus recombinants expressing foreign genes. In DNA Cloning: A Practical Approach, pp. 191-211. Edited by D. M. Glover. Oxford: IRL Press.

Mallon, V. R. & Holowczak, J. A. (1985). Vaccinia virus antigens on the plasma membrane of infected cells. I. Viral antigens transferred from infecting virus particles and synthesized after infection. Virology 141, 201-220.[Medline]

Mallon, V. R., Domber, E. A. & Holowczak, J. A. (1985). Vaccinia virus proteins on the plasma membranes of infected cells. II. Expression of viral antigens and killing of infected cells by vaccinia virus-specific cytotoxic T cells. Virology 145, 1-23.[Medline]

Massung, R. F., Liu, L. I., Qi, J., Knight, J. C., Yuran, T. E., Kerlavage, A. R., Parsons, J. M., Venter, J. C. & Esposito, J. J. (1994). Analysis of the complete genome of smallpox variola major virus strain Bangladesh-1975. Virology 201, 215-240.[Medline]

Moss, B. (1996). Poxviridae: the viruses and their replication. In Fields Virology, pp. 2637-2671. Edited by B. N. Fields, D. M. Knipe & P. M. Howley. Philadelphia: Lippincott–Raven.

Parkinson, J. E. & Smith, G. L. (1994). Vaccinia virus gene A36R encodes a Mr 43–50 K protein on the surface of extracellular enveloped virus. Virology 204, 376-390.[Medline]

Parkinson, J. E., Sanderson, C. M. & Smith, G. L. (1995). The vaccinia virus A38L gene product is a 33-kDa integral membrane glycoprotein. Virology 214, 177-188.[Medline]

Patel, A. H., Gaffney, D. F., Subak-Sharpe, J. H. & Stow, N. D. (1990). DNA sequence of the gene encoding a major secreted protein of vaccinia virus, strain Lister. Journal of General Virology 71, 2013-2021.[Abstract/Free Full Text]

Rodriguez, J. F. & Smith, G. L. (1990a). Inducible gene expression from vaccinia virus vectors. Virology 177, 239-250.[Medline]

Rodriguez, J. F. & Smith, G. L. (1990b). IPTG-dependent vaccinia virus: identification of a virus protein enabling virion envelopment by Golgi membrane and egress. Nucleic Acids Research 18, 5347-5351.[Abstract/Free Full Text]

Roper, R. L., Payne, L. G. & Moss, B. (1996). Extracellular vaccinia virus envelope glycoprotein encoded by the A33R gene. Journal of Virology 70, 3753-3762.[Abstract]

Rosel, J. L., Earl, P. L., Weir, J. P. & Moss, B. (1986). Conserved TAAATG sequence at the transcriptional and translational initiation sites of vaccinia virus late genes deduced by structural and functional analysis of the HindIII H genome fragment. Journal of Virology 60, 436-449.[Abstract/Free Full Text]

Shchelkunov, S. N., Massung, R. F. & Esposito, J. J. (1995). Comparison of the genome DNA sequences of Bangladesh-1975 and India-1967 variola viruses. Virus Research 36, 107-118.[Medline]

Shida, H. (1986). Nucleotide sequence of the vaccinia virus hemagglutinin gene. Virology 150, 451-462.[Medline]

Smith, G. L., Chan, Y. S. & Howard, S. T. (1991). Nucleotide sequence of 42 kbp of vaccinia virus strain WR from near the right inverted terminal repeat. Journal of General Virology 72, 1349-1376.[Abstract/Free Full Text]

Stroobant, P., Rice, A. P., Gullick, W. J., Cheng, D. J., Kerr, I. M. & Waterfield, M. D. (1985). Purification and characterization of vaccinia virus growth factor. Cell 42, 383-393.[Medline]

Symons, J. A., Alcamí, A. & Smith, G. L. (1995). Vaccinia virus encodes a soluble type I interferon receptor of novel structure and broad species specificity. Cell 81, 551-560.[Medline]

Tomley, F. M., Binns, M. M., Campbell, J. & Boursnell, M. E. G. (1988). Sequence analysis of an 11·2 kilobase, near-terminal BamHI fragment of fowlpox virus. Journal of General Virology 69, 1025-1040.[Abstract/Free Full Text]

Turner, G. S. (1967). Respiratory infection of mice with vaccinia virus. Journal of General Virology 1, 399-402.[Abstract/Free Full Text]

Ueda, Y., Morikawa, S. & Matsuura, Y. (1990). Identification and nucleotide sequence of the gene encoding a surface antigen induced by vaccinia virus. Virology 177, 588-594.[Medline]

Weis, W. I., Kahn, R., Fourme, R., Drickamer, K. & Hendrickson, W. A. (1991). Structure of the calcium-dependent lectin domain from a rat mannose-binding protein determined by MAD phasing. Science 254, 1608-1615.[Abstract/Free Full Text]

Weis, W. I., Drickamer, K. & Hendrickson, W. A. (1992). Structure of a C-type mannose-binding protein complexed with an oligosaccharide. Nature 360, 127-134.[Medline]

Yuen, L. & Moss, B. (1987). Oligonucleotide sequence signaling transcriptional termination of vaccinia virus early genes. Proceedings of the National Academy of Sciences, USA 84, 6417-6421.[Abstract/Free Full Text]

Received 17 February 1999; accepted 21 April 1999.


This article has been cited by other articles:


Home page
J. Gen. Virol.Home page
N. Jacobs, R. A.-J. Chen, C. Gubser, P. Najarro, and G. L. Smith
Intradermal immune response after infection with Vaccinia virus.
J. Gen. Virol., May 1, 2006; 87(Pt 5): 1157 - 1161.
[Abstract] [Full Text] [PDF]


Home page
Mol. Biol. CellHome page
S. Palacios, L. H. Perez, S. Welsch, S. Schleich, K. Chmielarska, F. Melchior, and J. K. Locker
Quantitative SUMO-1 Modification of a Vaccinia Virus Protein Is Required for Its Specific Localization and Prevents Its Self-Association
Mol. Biol. Cell, June 1, 2005; 16(6): 2822 - 2835.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
C. L. Afonso, G. Delhon, E. R. Tulman, Z. Lu, A. Zsak, V. M. Becerra, L. Zsak, G. F. Kutish, and D. L. Rock
Genome of Deerpox Virus
J. Virol., January 15, 2005; 79(2): 966 - 977.
[Abstract] [Full Text] [PDF]


Home page
J. Gen. Virol.Home page
D. C. Tscharke, P. C. Reading, and G. L. Smith
Dermal infection with vaccinia virus reveals roles for virus proteins not seen using other inoculation routes
J. Gen. Virol., August 1, 2002; 83(8): 1977 - 1986.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
S. Voigt, G. R. Sandford, L. Ding, and W. H. Burns
Identification and Characterization of a Spliced C-Type Lectin-Like Gene Encoded by Rat Cytomegalovirus
J. Virol., January 15, 2001; 75(2): 603 - 611.
[Abstract] [Full Text]


Home page
J. Virol.Home page
C. L. Afonso, E. R. Tulman, Z. Lu, L. Zsak, G. F. Kutish, and D. L. Rock
The Genome of Fowlpox Virus
J. Virol., April 15, 2000; 74(8): 3815 - 3831.
[Abstract] [Full Text]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via CrossRef
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Wilcock, D.
Right arrow Articles by Smith, G. L.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Wilcock, D.
Right arrow Articles by Smith, G. L.
Agricola
Right arrow Articles by Wilcock, D.
Right arrow Articles by Smith, G. L.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
INT J SYST EVOL MICROBIOL MICROBIOLOGY J GEN VIROL
J MED MICROBIOL ALL SGM JOURNALS