|
|
||||||||
Animal: DNA Viruses |
Laboratory of Virology, Research Institute for Disease Mechanism and Control, Nagoya University School of Medicine, Showa-ku, Nagoya 466-8550, Japan1
Author for correspondence: Yukihiro Nishiyama.Fax +81 52 744 2452. e-mail ynishiya{at}tsuru.med.nagoya-u.ac.jp
| Abstract |
|---|
|
|
|---|
| Introduction |
|---|
|
|
|---|
This report focuses on the product of the UL3 gene of HSV type 2 (HSV-2). The UL3 gene of HSV-2 is predicted to encode a 233 amino acid protein with a molecular mass of 26 kDa (McGeoch et al., 1991
). Homologues of the UL3 protein are encoded only among alphaherpesviruses (Davison & Scott, 1986
; McGeoch et al., 1988
; Telford et al., 1992
, 1998
; Dean & Cheung, 1993
; Yoshida et al., 1994
; Khattar et al., 1995
). There have been several reports concerning the UL3 protein, which have revealed that: (i) open reading frames (ORFs) UL3, UL4, UL10 and UL16 are dispensable for the replication of HSV-1 in cell culture (Baines & Roizman, 1991
); (ii) the UL3 protein of HSV-2 is a nuclear-localizing phosphoprotein and is not a glycoprotein (Worrad & Caradonna, 1993
); and (iii) the UL3 protein of HSV-1 is a phosphoprotein and is not a glycoprotein (Ghiasi et al., 1996
). However, the function of the UL3 protein of HSV remains unknown.
In this study, we examined the intracellular localization of the UL3 protein in infected and transfected cells. The results demonstrate that the UL3 protein has a nucleolar-localizing property and that the region containing amino acids 100164 is important for this nucleolar localization.
| Methods |
|---|
|
|
|---|
Cells and viruses.
Generation of polyclonal antisera in rabbits.
The UL3 ORF is located at the left end of the UL region of the HSV-2 genome (McGeoch et al., 1991
). The UL3 coding sequence was amplified by PCR from HSV-2 186 HindIII fragment B (Tsurumi et al., 1986
). The 5' and 3' primers used for the amplification were 5' TTCGAATTCATGGTTAAATCTCGGGTCTCA 3' and 5' AATCTCGAGTGCTTAGTCTGGTTCCGTAGA 3', respectively. EcoRI and XhoI sites were incorporated into the 5' and 3' primers, respectively, to facilitate cloning. PCR amplification was carried out as described previously (Yamada et al., 1997
). The PCR product was digested with EcoRI and XhoI and cloned in-frame downstream of the region encoding the initiating ATG plus six histidine residues in the Escherichia coli expression vector pET-28a (Novagen) to give the plasmid pET28-UL3. Expression of this fusion protein is regulated by an IPTG-inducible lac operator sequence and a phage T7 promoter. Translation is expected to terminate at the stop codon of the UL3 gene. This plasmid was transformed into E. coli strain BL21(DE3) (Novagen) which, following induction with IPTG, expressed large quantities of 6xHisUL3 fusion protein. Purification of the UL3 fusion protein and immunization of rabbits were done as described previously (Yamada et al., 1998
). Both preimmune and immune antisera were extensively adsorbed against acetone powder of E. coli strain BL21(DE3) and uninfected Vero cells prior to use, as described by Harlow & Lane (1988)
.
Construction of plasmids.
The wild-type form and deletion mutants of the UL3 protein were made as shown in Fig. 4(a)
. Nomenclature of the constructs indicates deleted amino acids; for example, MEag
81/174 indicates a truncated UL3 protein containing amino acids 180 fused to amino acids 175236 (i.e. deletion of amino acids 81174). Different parts of the UL3 coding sequence were obtained by PCR and PCR fragments were cloned into the EcoRI and XhoI sites of the eukaryotic expression vector pCR3 (Invitrogen). The N-terminal deletion mutant MN1
1/99 was made by using a 5' primer encoding an internal initiation codon. All C-terminal deletion mutants were made by introducing a termination codon. In the case of the mutant MEag
81/174, the plasmid pET28-UL3 was digested with EagI and religated (pET28-UL3Eag). The PCR fragment containing the region encoding amino acids 180 fused to that encoding amino acids 175236 was obtained by using pET28-UL3Eag as a template. UL3green fluorescent protein (GFP) fusion proteins were made as shown in Fig. 6(a)
. Different parts of the UL3 coding sequence were obtained by PCR as described above and PCR fragments were cloned into the XhoI and PstI sites of pEGFP-N1 vector (Clontech). The correctness of the constructs was analysed by sequencing.
|
|
Western blotting.
Cell transfection.
Vero and COS-7 cells were transfected with 2 mg plasmid DNA by using TransIT transfection reagents LT1 (PanVera) according to the manufacturer's instructions.
Indirect immunofluorescence.
The indirect immunofluorescence assay was performed essentially as described by Ward et al. (1996)
. A goat polyclonal antibody to the B23 protein was purchased from Santa Cruz. For secondary antibodies, we used TRITC-conjugated swine anti-rabbit IgG (Dako) and FITC-conjugated donkey anti-goat IgG (Santa Cruz). Fluorescent images were viewed and recorded with the Bio-Rad MRC-series confocal imaging system. Nucleolar shape was confirmed under the phase-contrast microscope.
| Results and Discussion |
|---|
|
|
|---|
|
Intracellular localization of the UL3 protein
The intracellular localization of the UL3 protein in HSV-2-infected Vero cells was analysed by immunofluorescence assay. As shown in Fig. 2
(b), the UL3 protein localized both in the cytoplasm and in five to ten bright fluorescent granules close to the nuclear membrane in the nucleus within the first 4 h of infection. These structures became bigger (Fig. 2 c)
and showed doughnut-like forms at about 6 h post-infection (p.i.) (Fig.2d)
. By approximately 9 h p.i., cytoplasmic staining had disappeared in almost all cells (Fig. 2e
). These structures were absent from mock-infected cells (Fig. 2a
), and no significant fluorescence was observed with the preimmune serum (not shown). In addition, our preliminary experiments (not shown) showed that the UL3 protein co-localized with ICP8 at the stage of infection when it formed doughnut-like structures, as shown in Fig. 2(d, e)
.
|
|
The nucleolus is a highly structured and specialized organelle that functions as the site of both the synthesis of rRNA and the assembly and processing of preribosomal ribonucleoprotein particles (Mèlëse & Xue, 1995
). Electron microscopic studies have shown that the nucleolus is subdivided into at least three morphologically distinct components: the fibrillar centre, the dense fibrillar component (DFC) and the granular component (GC). Early steps of rRNA processing and subsequent steps of assembly and maturation of ribosomal subunits occur in the first two components. The GC is thought to be connected with later processes of rRNA maturation (Scheer & Weisenberger, 1994
). It has been shown that both Rev and Tat of HIV-1 localize to the DFC and GC and co-localize with B23 in transfected cells (Miyazaki et al., 1995
). The Tat protein, which is required for efficient viral transcription by stimulating transcription directed by the long terminal repeat sequence, has a basic region that binds to the trans-activation region of the viral RNA and is required for its nucleolar localization (Hauber et al., 1989
).
Expression and intracellular localization of mutant UL3 proteins
Two potential nuclear localization signals (NLSs) are found between amino acids 143 and 147 (NLS1) and 188 and 192 (NLS2) of HSV-2 UL3, with the sequences RQRKR and RKPRK, respectively (Worrad & Caradonna, 1993
). To study the roles of these two potential NLSs and the amino acid sequence(s) essential for nucleolar localization, we constructed five deletion mutants as described in Methods (Fig. 4
a). To examine the expression of the five deletion mutants, COS-7 cells were transfected with plasmids expressing either the wild-type or the mutant versions of the UL3 protein. The transfected cell extracts were analysed by Western blotting. As shown in Fig. 4(b)
, the wild-type UL3, the three C-terminal and one internal deletion mutants were expressed as stable proteins of the expected sizes (lanes 1, 36). However, the N-terminal deletion mutant MN1
1/99 was not detected by Western blotting (lane 2).
An immunofluorescence assay was used to analyse the intracellular localization of deletion mutants of the UL3 protein in transfected Vero cells 24 h after transfection. Fig. 5
shows representative immunofluorescence data from each deletion mutant. Vero cells expressing MN1
1/99 at low efficiency showed bright nucleolar staining (Fig. 5a
). The pattern of intranuclear localization of the mutant MC1
196/233 was very similar to the wild-type UL3 protein (Fig. 5b
). The potential NLS2-deletion mutant MC2
188/233 also accumulated in the nucleolus (Fig. 5c
). Although the deletion mutant MC3
165/233 was present in both the nucleus and the cytoplasm, it accumulated in the nucleolus (Fig. 5d
). These results suggested that the region containing amino acids 100164 of the UL3 protein, which is common to all four terminal deletion mutants, may be important for nucleolar localization. The internal deletion mutant MEag
142/205, which has neither potential NLS1 nor NLS2, was present both in the nucleus and the cytoplasm and was excluded from the nucleolus (Fig. 5e
), suggesting a role of the potential NLS1 for nucleolar localization. These results implied that the region containing amino acids 142164, which is common to the region 100/164 and the internal deletion of MEag
142/205 and includes the NLS1, was responsible for nucleolar localization of the UL3 protein.
|
Expression and intracellular localization of UL3GFP fusion proteins
To determine whether the region 100/164 would be sufficient to target a non-nucleolar protein to the nucleolus, the wild-type and deletion-mutant forms of the UL3 protein were fused to the N terminus of GFP, a well-characterized protein (Fig. 6
a). To examine the expression of the proteins synthesized from the hybrid genes, COS-7 cells were transfected with each plasmid under the control of the CMV immediate-early promoter. Equal aliquots of cell lysates were analysed by Western blotting. As shown in Fig. 6(b)
, a fusion protein of the expected size was produced in substantial amounts from each plasmid. These results demonstrated that the GFP portion did not affect the accumulation of the fusion proteins. Although the wild-type UL3GFP fusion protein exhibited two bands, the N-terminal mutant M
1/99GFP exhibited one band. Thus, it seems that one phosphorylation site is contained in the region containing amino acids 199.
An immunofluorescence assay was used to analyse the intracellular localization of these UL3GFP fusion proteins in transfected Vero cells 24 h after transfection. GFP expressed alone was distributed almost equally throughout the cell except for the nucleolus (Fig. 7
a). Fusion of the wild-type UL3 protein to this protein conferred nuclear and nucleolar localization (Fig. 7b
). M
1/99GFP was present in the nucleolus (Fig. 7c
) but M
1/164GFP was not (Fig. 7d
), strengthening the hypothesis that the region 100/164 of the UL3 protein is required for nucleolar localization. Although M100/164GFP was present both in the nucleus and the cytoplasm, it accumulated in the nucleolus (Fig. 7e
), indicating that the region 100/164 of the UL3 protein was sufficient for nucleolar localization. M
142/205GFP was excluded from the nucleolus (Fig. 7f
).
|
There are at least three proteins of HSV that have been demonstrated to be associated with the nucleolus. Firstly, the US11 protein localizes to the nucleoli of HSV-1-infected cells (MacLean et al., 1987
). It binds RNA and associates with ribosomal 60S subunits (Roller & Roizman, 1992
). Secondly, ICP27 possesses an RGG motif, which can function as a nucleolar targetting signal and bears similarity to a putative RNA-binding motif found in a number of cellular proteins involved in nuclear RNA processing (Mears et al., 1995
). Thirdly, the US8.5 protein localizes to the nucleoli of HSV-1-infected cells (Georgopoulou et al., 1995
), although its function remains unknown.
A number of other viral proteins have been identified in the nucleolus. EBNA-5 of EpsteinBarr virus, together with the hsp70 protein, translocates to the nucleolus under cell density congestion or after heat shock in transfected cells (Szekely et al., 1995
). Rex of human T cell leukaemia virus type 1, nsP2 of Semliki Forest virus, the matrix protein of Newcastle disease virus and pIVa2 of adenovirus localize to the nucleolus in infected and transfected cells (Siomi et al., 1988
; Peränen et al., 1990
; Coleman & Peeples, 1993
; Lutz et al., 1996
). The capsid protein of Semliki Forest virus and MEQ of Marek's disease virus are also reported to localize to the nucleolus in transfected cells (Favre et al., 1994
; Liu et al., 1997
).
The association of the UL3 protein of HSV-2 with the nucleolus may provide new leads to uncovering its function.
| Acknowledgments |
|---|
| References |
|---|
|
|
|---|
Borer, R. A., Lehner, C. F., Eppenberger, H. M. & Nigg, E. A. (1989). Major nucleolar proteins shuttle between nucleus and cytoplasm. Cell 56, 379-390.[Medline]
Chalfie, M., Tu, Y., Euskirchen, G., Ward, W. W. & Prasher, D. C. (1994). Green fluorescent protein as a marker for gene expression. Science 263, 802-805.
Coleman, N. A. & Peeples, M. E. (1993). The matrix protein of Newcastle disease virus localizes to the nucleus via a bipartite nuclear localization signal. Virology 195, 596-607.[Medline]
Cormack, B. P., Valdivia, R. H. & Falkow, S. (1996). FACS-optimized mutants of the green fluorescent protein (GFP). Gene 173, 33-38.[Medline]
Dang, C. V. & Lee, W. M. F. (1989). Nuclear and nucleolar targeting sequences of c-erb-A, c-myb, N-myc, p53, HSP70, and HIV tat proteins. Journal of Biological Chemistry 264, 18019-18023.
Davison, A. J. & Scott, J. E. (1986). The complete DNA sequence of varicella-zoster virus. Journal of General Virology 67, 1759-1816.
Dean, H. J. & Cheung, A. K. (1993). A 3' coterminal gene cluster in pseudorabies virus contains herpes simplex virus UL1, UL2, and UL3 gene homologs and a unique UL3.5 open reading frame. Journal of Virology 67, 5955-5961.
Desai, P. & Person, S. (1998). Incorporation of the green fluorescent protein into the herpes simplex virus type 1 capsid. Journal of Virology 72, 7563-7568.
Dolan, A., Jamieson, F. E., Cunningham, C., Barnett, B. C. & McGeoch, D. J. (1998). The genome sequence of herpes simplex virus type 2. Journal of Virology 72, 2010-2021.
Fankhauser, C., Izaurralde, E., Adachi, Y., Wingfield, P. & Laemmli, U. K. (1991). Specific complex of human immunodeficiency virus type 1 rev and nucleolar B23 proteins: dissociation by the Rev response element. Molecular and Cellular Biology 11, 2567-2575.
Favre, D., Studer, E. & Michel, M. R. (1994). Two nucleolar targeting signals present in the N-terminal part of Semliki Forest virus capsid protein. Archives of Virology 137, 149-155.[Medline]
Foster, T. P., Rybachuk, G. V. & Kousoulas, K. G. (1998). Expression of the enhanced green fluorescent protein by herpes simplex virus type 1 (HSV-1) as an in vitro or in vivo marker for virus entry and replication. Journal of Virological Methods 75, 151-160.[Medline]
Georgopoulou, U., Kakkanas, A., Miriagou, V., Michaelidou, A. & Mavromara, P. (1995). Characterization of the US8.5 protein of herpes simplex virus. Archives of Virology 140, 2227-2241.[Medline]
Ghiasi, H., Perng, G.-C., Cai, S., Nesburn, A. B. & Wechsler, S. L. (1996). The UL3 open reading frame of herpes simplex virus type 1 codes for a phosphoprotein. Virus Research 44, 137-142.[Medline]
Harlow, E. & Lane, D. (1988). Antibodies: A Laboratory Manual. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory.
Hauber, J., Malim, M. H. & Cullen, B. R. (1989). Mutational analysis of the conserved basic domain of human immunodeficiency virus tat protein. Journal of Virology 63, 1181-1187.
Khattar, S. K., van Drunen Littel-van den Hurk, S., Babiuk, L. A. & Tikoo, S. K. (1995). Identification and transcriptional analysis of a 3'-coterminal gene cluster containing UL1, UL2, UL3, and UL3.5 open reading frames of bovine herpesvirus-1. Virology 213, 28-37.[Medline]
Leopardi, R. & Roizman, B. (1996). Functional interaction and colocalization of the herpes simplex virus 1 major regulatory protein ICP4 with EAP, a nucleolar-ribosomal protein. Proceedings of the National Academy of Sciences, USA 93, 4572-4576.
Liu, J.-L., Lee, L. F., Ye, Y., Qian, Z. & Kung, H.-J. (1997). Nucleolar and nuclear localization properties of a herpesvirus bZIP oncoprotein, MEQ. Journal of Virology 71, 3188-3196.
Lutz, P., Puvion-Dutilleul, F., Lutz, Y. & Kedinger, C. (1996). Nucleoplasmic and nucleolar distribution of the adenovirus IVa2 gene product. Journal of Virology 70, 3449-3460.
McGeoch, D. J., Dalrymple, M. A., Davison, A. J., Dolan, A., Frame, M. C., McNab, D., Perry, L. J., Scott, J. E. & Taylor, P. (1988). The complete DNA sequence of the long unique region in the genome of herpes simplex virus type 1. Journal of General Virology 69, 1531-1574.
McGeoch, D. J., Cunningham, C., McIntyre, G. & Dolan, A. (1991). Comparative sequence analysis of the long repeat regions and adjoining parts of the long unique regions in the genomes of herpes simplex viruses types 1 and 2. Journal of General Virology 72, 3057-3075.
MacLean, C. A., Rixon, F. J. & Marsden, H. S. (1987). The products of gene US11 of herpes simplex virus type 1 are DNA-binding and localize to the nucleoli of infected cells. Journal of General Virology 68, 1921-1937.
Mears, W. E., Lam, V. & Rice, S. A. (1995). Identification of nuclear and nucleolar localization signals in the herpes simplex virus regulatory protein ICP27. Journal of Virology 69, 935-947.
Mèlëse, T. & Xue, Z. (1995). The nucleolus: an organelle formed by the act of building a ribosome. Current Opinion in Cell Biology 7, 319-324.[Medline]
Miyazaki, Y., Takamatsu, T., Nosaka, T., Fujita, S., Martin, T. E. & Hatanaka, M. (1995). The cytotoxicity of human immunodeficiency virus type 1 Rev: implications for its interaction with the nucleolar protein B23. Experimental Cell Research 219, 93-101.[Medline]
Peculis, B. A. & Gall, J. G. (1992). Localization of the nucleolar protein NO38 in amphibian oocytes. Journal of Cell Biology 116, 1-14.
Peränen, J., Rikkonen, M., Liljeström, P. & Kääriäinen, L. (1990). Nuclear localization of Semliki Forest virus-specific nonstructural protein nsP2. Journal of Virology 64, 1888-1896.
Rikkonen, M., Peränen, J. & Kääriäinen, L. (1992). Nuclear and nucleolar targeting signals of Semliki Forest virus nonstructural protein nsP2. Virology 189, 462-473.[Medline]
Roizman, B. & Sears, A. E. (1996). Herpes simplex viruses and their replication. In Fields Virology, pp. 2231-2295. Edited by B. N. Fields, D. M. Knipe & P. M. Howley. Philadelphia: LippincottRaven.
Roller, R. J. & Roizman, B. (1992). The herpes simplex virus 1 RNA binding protein US11 is a virion component and associates with ribosomal 60S subunits. Journal of Virology 66, 3624-3632.
Scheer, U. & Weisenberger, D. (1994). The nucleolus. Current Opinion in Cell Biology 6, 354-359.[Medline]
Schmidt-Zachmann, M. S. & Nigg, E. A. (1993). Protein localization to the nucleolus: a search for targeting domains in nucleolin. Journal of Cell Science 105, 799-806.[Abstract]
Siomi, H., Shida, H., Nam, S. H., Nosaka, T., Maki, M. & Hatanaka, M. (1988). Sequence requirements for nucleolar localization of human T cell leukemia virus type 1 pX protein, which regulates viral RNA processing. Cell 55, 197-209.[Medline]
Szekely, L., Jiang, W.-Q., Pokrovskaja, K., Wiman, K. G., Klein, G. & Ringertz, N. (1995). Reversible nucleolar translocation of EpsteinBarr virus-encoded EBNA-5 and hsp70 proteins after exposure to heat shock or cell density congestion. Journal of General Virology 76, 2423-2432.
Telford, E. A. R., Watson, M. S., McBride, K. & Davison, A. J. (1992). The DNA sequence of equine herpesvirus-1. Virology 189, 304-316.[Medline]
Telford, E. A. R., Watson, M. S., Perry, J., Cullinane, A. A. & Davison, A. J. (1998). The DNA sequence of equine herpesvirus-4. Journal of General Virology 79, 1197-1203.[Abstract]
Towbin, H., Staehelin, T. & Gordon, J. (1979). Electrophoretic transfer of proteins from polyacrylamide gels to nitrocellulose sheets: procedure and some applications. Proceedings of the National Academy of Sciences, USA 76, 4350-4354.
Tsurumi, T., Maeno, K. & Nishiyama, Y. (1986). Molecular cloning of herpes simplex virus type 2 DNA. Journal of Biochemistry 99, 981-984.
Ward, P. L., Ogle, W. O. & Roizman, B. (1996). Assemblons: nuclear structures defined by aggregation of immature capsids and some tegument proteins of herpes simplex virus 1. Journal of Virology 70, 4623-4631.
Worrad, D. M. & Caradonna, S. (1993). The herpes simplex virus type 2 UL3 open reading frame encodes a nuclear localizing phosphoprotein. Virology 195, 364-376.[Medline]
Yamada, H., Daikoku, T., Yamashita, Y., Jiang, Y.-M., Tsurumi, T. & Nishiyama, Y. (1997). The product of the US10 gene of herpes simplex virus type 1 is a capsid/tegument-associated phosphoprotein which copurifies with the nuclear matrix. Journal of General Virology 78, 2923-2931.[Abstract]
Yamada, H., Jiang, Y.-M., Oshima, S.-i., Daikoku, T., Yamashita, Y., Tsurumi, T. & Nishiyama, Y. (1998). Characterization of the UL55 gene product of herpes simplex virus type 2. Journal of General Virology 79, 1989-1995.[Abstract]
Yoshida, S., Lee, L. F., Yanagida, N. & Nazerian, K. (1994). Identification and characterization of a Marek's disease virus gene homologous to glycoprotein L of herpes simplex virus. Virology 204, 414-419.[Medline]
Received 24 February 1999;
accepted 28 April 1999.
This article has been cited by other articles:
![]() |
N. S. Markovitz The Herpes Simplex Virus Type 1 UL3 Transcript Starts within the UL3 Open Reading Frame and Encodes a 224-Amino-Acid Protein J. Virol., October 1, 2007; 81(19): 10524 - 10531. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. R. Boyne and A. Whitehouse Nucleolar trafficking is essential for nuclear export of intronless herpesvirus mRNA PNAS, October 10, 2006; 103(41): 15190 - 15195. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. Ning and C. Shih Nucleolar Localization of Human Hepatitis B Virus Capsid Protein J. Virol., December 15, 2004; 78(24): 13653 - 13668. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. G. Klupp, H. Granzow, W. Fuchs, E. Mundt, and T. C. Mettenleiter Pseudorabies Virus UL3 Gene Codes for a Nuclear Protein Which Is Dispensable for Viral Replication J. Virol., January 1, 2004; 78(1): 464 - 472. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Michienzi, S. Li, J. A. Zaia, and J. J. Rossi A nucleolar TAR decoy inhibitor of HIV-1 replication PNAS, October 29, 2002; 99(22): 14047 - 14052. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| INT J SYST EVOL MICROBIOL | MICROBIOLOGY | J GEN VIROL |
| J MED MICROBIOL | ALL SGM JOURNALS | |