|
|
||||||||
Animal: DNA Viruses |
Institut für Virologie, Freie Universität Berlin, Königin-Luise-Straße 49, 14195 Berlin, Germany1
Institut für Veterinärpathologie, FU Berlin, Str. 518, Nr. 15, 14163 Berlin, Germany2
Author for correspondence: Kerstin Borchers.Fax +49 30 8316198. e-mail borchers{at}zedat.fu-berlin.de
| Abstract |
|---|
|
|
|---|
| Introduction |
|---|
|
|
|---|
It is known from the well-studied HSV-1 that, in the natural host, the virus enters the sensory nerve endings after an initial acute infection of peripheral tissues and is transported to neuronal cell bodies by retrograde axonal transport (reviewed in Roizman & Sears, 1987
). HSV-1 remains life-long in these non-proliferating cells in a non-integrated form (Mellerick & Fraser, 1987
).
The virus is undetectable by classical diagnostic techniques during the latent phase. Reactivation occurs periodically, however, and virus is then transported anterograde via the axon from the nerve cell body to the original peripheral site of infection, where it causes recurrent lesions through productive virus replication. Stroop et al. (1984)
detected the so-called latency-associated transcripts (LATs), which comprise a family of overlapping transcripts, the only detectable RNAs in the nuclei of latently HSV-1-infected neurons or of T cells, in the case of MDV (Shek et al., 1983
). HSV-1 LATs are about 2 and 1·3 kb in length and represent introns derived from the processing of an 8·3 kb precursor mRNA. Moreover, the 2 kb LAT is complementary to the HSV-1 immediate-early (IE) gene ICP0 and partially overlaps the 3' end of the corresponding transcript (Rock et al., 1987
; Dobson et al., 1989
). RNA antisense to gene ICP0 has also been detected for HSV-2 and BHV-1 (Kutish et al., 1990
; Tenser et al., 1991
; reviewed in Jones, 1998
), while PRV, MDV and FHV-1 express transcripts derived from gene ICP4, another IE gene (Cheung, 1989
, 1991
; Li et al., 1994
; Cantello et al., 1994
; Kawaguchi et al., 1994
). In the case of EHV-1, Chesters et al. (1997)
found gene 64-specific (HSV-1 ICP4 gene homologue) LATs in peripheral blood leukocytes (PBL). We and others discovered EHV-1 LATs derived from gene 63 (HSV-1 ICP0 gene homologue) in trigeminal ganglia (Baxi et al., 1995
; Borchers et al., 1999
). Gene 63 belongs to the early kinetic class of viral genes (Bowles et al., 1997
). The majority of the LATs studied to date, however, are transcribed from IE genes. Although the function and significance of the LATs remain undefined, they are considered to represent latency markers.
Conflicting results have been reported on the tissue tropism of latent EHV-4. Thus, on the one hand, EHV-4 has been found to establish latency in lymph nodes of the respiratory tract and in PBL (Welch et al., 1992
; Edington et al., 1994
). Although EHV-4 has, on rare occasions, been shown to be viraemic, in contrast to EHV-1, this is not a dominant feature of EHV-4 pathogenesis (Allen & Bryans, 1986
; Edington et al., 1994
). Recently, in situ PCR studies on trigeminal ganglia of naturally infected horses demonstrated that EHV-4 DNA is located in the nuclei of these cells (Borchers et al., 1997
).
In order to investigate the transcriptional activity of latent EHV-4, we used trigeminal ganglia that tested positive for EHV-4 DNA by gene 33-specific nested PCR (nPCR). Nested RTPCR (nRTPCR) analysis demonstrated that latent EHV-4 expresses transcripts complementary to gene 63 and gene 64 mRNA in these tissues.
| Methods |
|---|
|
|
|---|
Sample origin.
Tissue DNA extraction and nPCR.
DNA from equine tissues was extracted as detailed elsewhere (Slater et al., 1994
). All tissue manipulations were performed in an EHV-1- and EHV-4-free flow cabinet to avoid contamination. The quantity of DNA was monitored by spectrophotometry and the quality by amplification of a 248 bp ß-actin fragment (upstream primer 5' GTGTGGTGCCAAATCTTCTCC 3'; downstream primer 5' GCGCTCGTCGTCGACAACGG 3').
The nPCR for EHV-4 genes 33, 63 and 64 were established on the basis of the sequences published by Telford et al. (1998)
by using computer software (Oligo version 4.0 for Macintosh), with one exception: gene 64 primers 3 and 4 were derived from the EHV-1 sequence (Telford et al., 1992
). These primers have only two and three mismatches with the EHV-4 sequence, respectively, leading to cross-reactivity with EHV-4. Since this primer pair was used in the second round of nPCR, after an EHV-4-specific amplification with primers 1 and 2, the resulting amplification product was EHV-4 specific. Details of the primers and amplification products are given in Table 1
and Fig. 1
. The PCR mixtures (50 µl) contained 1 µg cellular DNA, 0·4 µM of each primer, 0·2 mM dNTPs, 1·5 U Taq polymerase (Qiagen) and 1xreaction buffer, as well as 1x Q-solution (Qiagen). Finally, the aqueous phase was covered with a drop of mineral oil (Sigma).
|
|
Gene 33-specific nested primer sets were used for the detection of EHV-1 DNA and primers derived from genes 63 and 64 were used for the amplification of LAT fragments, as described elsewhere (Borchers et al., 1999
).
Purified DNA from EHV-4 strain T252 and EHV-1 strain Mar87 was used as a positive control. At least one reagent control was included in each nPCR experiment.
The PCR products were analysed in an ethidium bromide-stained 1% agarose gel. The sensitivity of all nPCRs was calculated to be 1 fg purified EHV-4 DNA after the second round of PCR. With the exception of the gene 64-specific primers 3 and 4, none of the EHV-4-specific nPCR primers showed cross-reactivity with EHV-1 DNA.
RNA extraction from tissues and infected cell cultures and analysis by nRTPCR.
For the detection of viral transcripts, RNA was extracted from horse tissues using the TRIzol reagent (Life Technologies) according to the manufacturer's instructions. As a positive control, equine dermal (ED) cells grown in Dulbecco's modified Eagle's minimum essential medium supplemented with 5% foetal calf serum were infected with 1 p.f.u. per cell of EHV-4 (strain T252) or EHV-1 (strain Mar87). After 24 h (EHV-1) or 48 h (EHV-4), the infected cells were harvested and pelleted. Finally, 2x106 cells were used for RNA extraction. Isolated RNA was further treated with DNase I (Boehringer) at 37 °C for 40 min to digest any contaminating viral DNA. The enzyme was removed by applying the sample to an RNeasy spin column (Qiagen). To prove the absence of viral DNA, 1 µg of each RNA preparation, including that of infected cells, was tested by EHV-1 and EHV-4 gene 63 nPCR. None of the preparations contained viral DNA, as shown for representative samples analysed with EHV-4 gene 63 nested primers (Fig. 2
). Virus DNA-free RNA (2 µg) was then reverse-transcribed using Expand reverse transcriptase (Boehringer) and random-hexamer primers (50 pmol/µl). After the reverse transcription reaction the enzyme was inactivated by incubation for 5 min at 95 °C. One-tenth of the cDNA was subjected to EHV-1 and EHV-4 nPCRs. Expression of ß-actin mRNAs in all tissue samples was used as a control of RNA quality.
|
Determination of the orientation of viral transcripts.| Results |
|---|
|
|
|---|
|
According to the observation that the 2 kb LAT of HSV-1 appears not to be polyadenylated (Wagner et al., 1988
), we used random-hexamer primers for in vitro reverse transcription. The cDNA obtained was then submitted to gene 33-, 63- and 64-specific nPCR. Cells productively infected with EHV-4 served as a positive control. RNA derived from these cells was nRTPCR positive for all three genes. In comparison, EHV-4 gene 63 and gene 64 transcripts were amplified from the trigeminal ganglia of horses 16, 656, 915, 1697, 2155 and 2163 (Table 2
). In horse 584, we only found gene 64 transcripts and we detected gene 33-specific transcripts in addition to those derived from genes 63 and 64 in horse 2163. All other ganglia were negative for gene 33 transcripts (data not shown).
In order to confirm that the positive RTPCR resulted from the detection of transcripts and not from contamination of samples with viral DNA, all RNA preparations were treated with DNase and checked by nPCR prior to RTPCR analysis. As shown in Fig. 2
, none of the preparations used was EHV-4 DNA positive. The same control experiment was done to exclude contamination with EHV-1 DNA (data not shown).
Since the inner primer pair of the EHV-4 gene 64 nPCR cross-reacts with EHV-1, we checked all ganglion samples for EHV-1 gene 64-specific sequences. As described elsewhere (Borchers et al., 1999
) and as shown for representative animals 16, 1207, 1672, 2103, 656 and 915 (Fig. 3c
), none of the ganglia contained EHV-1 gene 64 transcripts, as shown by using nested primer pairs amplifying the LAT region defined by Chesters et al. (1997)
. However, in the ganglia of horses 656 and 915, we described previously the presence of EHV-1-specific LATs derived from gene 63 (Borchers et al., 1999
), an LAT region published by Baxi et al. (1995)
. As already mentioned above and demonstrated in Fig. 3(a, b)
, these two ganglia also contained EHV-4 gene 63 and 64 transcripts. Since both the EHV-1 and EHV-4 gene 63 nPCRs are type-specific, we could discriminate between EHV-1- and EHV-4-specific LATs.
|
|
| Discussion |
|---|
|
|
|---|
Tissues of 17 horses, all exhibiting severe clinical signs, that have been subjected to autopsy were used for this study. More than half of the animals (11 of 17) had evidence of EHV-4 infection based on the detection of EHV-4 DNA in the trigeminal ganglia by a sensitive type-specific nPCR. Five of the 11 animals were positive for both EHV-4 and EHV-1, but there was no obvious relationship between either infection and the clinical signs reported at the time of death. However, the presence of latent EHV-4 in trigeminal ganglia may be significant, as it would provide a reservoir from which latent EHV-4 could be reactivated and spread to the nasal mucosa, where transmission to susceptible hosts via the respiratory tract would be facilitated. EHV-4 is most likely to enter the trigeminal ganglion via nasal epithelium, as shown for EHV-1 (Baxi et al., 1995
; Bartels et al., 1998
) and PRV (Kritas et al., 1994
, 1995
). The existence of ganglionic latency suggests that reactivation results in anterograde axonal distribution of infectious virus to the respiratory site of recurrence without viraemia. This is in accordance with the finding that EHV-4 has seldom been found in the peripheral blood (Matsumura et al., 1992
).
Because Northern blot hybridization of RNA preparations from latently infected tissues gave no signals, even when 32P-labelled viral genomic or subgenomic probes were used (data not shown), we preferred the more sensitive nRTPCR technique for transcript analysis. Genes 63 and 64 were chosen as targets as both encode LATs in other alphaherpesviruses. EHV-4 DNA-positive trigeminal ganglia were used for RNA preparation and subsequent nRTPCR. Only samples that were completely free of viral DNA were used for cDNA production. We detected transcripts derived from genes 63 and 64 in six of the ganglia, whereas a seventh ganglion contained only gene 64-specific transcripts. Recently, the same tissues were analysed for latent EHV-1 (Borchers et al., 1999
) and we emphasize that they were negative for EHV-1-specific gene 64 transcripts. However, EHV-1 gene 63-specific transcripts were detected in the ganglia of horses 656 and 915. Thus, in contrast to EHV-1 and most other alphaherpesviruses, EHV-4 expressed LATs derived from both genes 63 and 64. Our failure to detect LATs in all of the EHV-4 DNA-positive trigeminal ganglia (Table 1
) may be due to small numbers of neuronal cells being latently infected. Thus, even in experimentally infected animals, EHV-1 LATs were found in only 2/4 ponies (Baxi et al., 1995
) and FHV-1 transcripts in 3/5 cats (Ohmura et al., 1993
).
The absence of gene 33 transcripts in all ganglia harbouring gene 63 and gene 64 transcripts, with the exception of one (animal 2163), suggested that these tissues were latently infected. In order to prove this, we analysed the polarity of the transcripts. Whereas gene 63- and 64-specific transcripts had antisense orientation, the gene 33 transcripts had the same sense as the mRNA. In contrast, in RNA preparations of productively infected cells, transcripts of both polarities were detected. Hence, complementary mRNAs are probably produced by opposite transcription of the same DNA segment in productively infected cells. The detection of gene 33-specific transcripts with sense orientation in one ganglion may result from spontaneous reactivation that did not yield detectable levels of infectious virus.
In summary, we found EHV-4 DNA in 11 of 17 naturally infected equine trigeminal ganglia, five of which were simultaneously EHV-1 DNA positive. Transcripts derived from genes 63 and 64 were discovered in six of the EHV-4 DNA-positive ganglia. The antisense polarity of the transcripts strongly suggests that they are real LATs. Further studies are necessary to define the full size of these transcripts and their functional role in natural infection.
| Acknowledgments |
|---|
| References |
|---|
|
|
|---|
Bartels, T., Steinbach, F., Hahn, G., Ludwig, H. & Borchers, K. (1998). In situ study on the pathogenesis and immune reaction of equine herpesvirus type 1 (EHV-1) infections in mice. Immunology 93, 329-334.[Medline]
Baxi, M. K., Efstathiou, S., Lawrence, G., Whalley, J. M., Slater, J. D. & Field, H. J. (1995). The detection of latency-associated transcripts of equine herpesvirus 1 in ganglionic neurons. Journal of General Virology 76, 3113-3118.
Borchers, K., Wolfinger, U., Lawrenz, B., Schellenbach, A. & Ludwig, H. (1997). Equine herpesvirus 4 DNA in trigeminal ganglia of naturally infected horses detected by direct in situ PCR. Journal of General Virology 78, 1109-1114.[Abstract]
Borchers, K., Wolfinger, U., Schellenbach, A., Lawrenz, B., Glitz, F. & Ludwig, H. (1999). Equid herpesvirus type 1 (EHV-1) and trigeminal ganglia of naturally infected horses: detection of DNA and latency associated transcripts (LATs) by RT-PCR. In Proceedings of the 18th International Conference on Equine Infectious Diseases, pp. 147-152. Edited by U. Wernery, J. F. Wade, J. A. Mumford & O.-R. Kaaden. Newmarket: R & W Publications.
Bowles, D. E., Holden, V. R., Zhao, Y. & O'Callaghan, D. J. (1997). The ICP0 protein of equine herpesvirus 1 is an early protein that independently transactivates expression of all classes of viral promoters. Journal of Virology 71, 4904-4914.[Abstract]
Cantello, J. L., Anderson, A. S. & Morgan, R. W. (1994). Identification of latency-associated transcripts that map antisense to the ICP4 homolog gene of Marek's disease virus. Journal of Virology 68, 6280-6290.
Chesters, P. M., Allsop, R., Purewal, A. & Edington, N. (1997). Detection of latency-associated transcripts of equid herpesvirus 1 in equine leukocytes but not in trigeminal ganglia. Journal of Virology 71, 3437-3443.[Abstract]
Cheung, A. K. (1989). Detection of pseudorabies virus transcripts in trigeminal ganglia of latently infected swine. Journal of Virology 63, 2908-2913.
Cheung, A. K. (1991). Cloning of the latency gene and the early protein 0 gene of pseudorabies virus. Journal of Virology 65, 5260-5271.
Dobson, A. T., Sederati, F., Devi-Rao, G., Flanagan, W. M., Farrell, M. J., Stevens, J. G., Wagner, E. K. & Feldman, L. T. (1989). Identification of the latency-associated transcript promoter by expression of rabbit beta-globin mRNA in mouse sensory nerve ganglia latently infected with a recombinant herpes simplex virus. Journal of Virology 63, 3844-3851.
Edington, N., Welch, H. M. & Griffiths, L. (1994). The prevalence of latent equid herpesviruses in the tissues of 40 abattoir horses. Equine Veterinary Journal 26, 140-142.[Medline]
Gaskell, R. M., Dennis, P. E., Goddard, L. E., Cocker, F. M. & Wills, J. M. (1985). Isolation of felid herpesvirus I from the trigeminal ganglia of latently infected cats. Journal of General Virology 66, 391-394.
Jones, C. (1998). Alphaherpesvirus latency: its role in disease and survival of the virus in nature. Advances in Virus Research 51, 81-133.[Medline]
Kawaguchi, Y., Maeda, K., Miyazawa, T., Ono, M., Kai, C. & Mikami, T. (1994). Nucleotide sequence and characterization of the feline herpesvirus type 1 immediately early gene. Virology 204, 430-435.[Medline]
Kritas, S. K., Pensaert, M. B. & Mettenleiter, T. C. (1994). Role of envelope glycoproteins gI, gp63 and gIII in the invasion and spread of Aujeszky's disease virus in the olfactory nervous pathway of the pig. Journal of General Virology 75, 2319-2327.
Kritas, S. K., Nauwynck, H. J. & Pensaert, M. B. (1995). Dissemination of wild-type and gC-, gE- and gI-deleted mutants of Aujeszky's disease virus in the maxillary nerve and trigeminal ganglion of pigs after intranasal inoculation. Journal of General Virology 76, 2063-2066.
Kutish, G., Mainprize, T. & Rock, D. (1990). Characterization of the latency-related transcriptionally active region of the bovine herpesvirus 1 genome. Journal of Virology 64, 5730-5737.
Li, D.-S., Pastorek, J., Zelník, V., Smith, G. D. & Ross, L. J. N. (1994). Identification of novel transcripts complementary to the Marek's disease virus homologue of the ICP4 gene of herpes simplex virus. Journal of General Virology 75, 1713-1722.
Matsumura, T., Sugiura, T., Imagawa, H., Fukunaga, Y. & Kamada, M. (1992). Epizootiological aspects of type 1 and type 4 equine herpesvirus infections among horse populations. Journal of Veterinary Medical Science 54, 207-211.[Medline]
Mellerick, D. M. & Fraser, N. W. (1987). Physical state of the latent herpes simplex virus genome in a mouse model system: evidence suggesting an episomal state. Virology 158, 265-275.[Medline]
Mitchell, W. J., Deshmane, S. L., Dolan, A., McGeoch, D. J. & Fraser, N. W. (1990). Characterization of herpes simplex virus type 2 transcription during latent infection of mouse trigeminal ganglia. Journal of Virology 64, 5342-5348.
Ohlinger, V. F., Heck, R., Behrens, P., Rziha, H.-J., Weiland, F. & Wittmann, G. (1987). Die Infektion von Zellen des hämatopoetischen Systems durch das Aujeszkyvirus Neue Aspekte für Immunbiologie und Praxis? Tierärztliche Umschau 3, 210-219.
Ohmura, Y., Ono, E., Matsuura, T., Kida, H. & Shimizu, Y. (1993). Detection of feline herpesvirus 1 transcripts in trigeminal ganglia of latently infected cats. Archives of Virology 129, 341-347.[Medline]
Rock, D. L., Hagemoser, W. A., Osorio, F. A. & Reed, D. E. (1986). Detection of bovine herpesvirus type 1 RNA in trigeminal ganglia of latently infected rabbits by in situ hybridization. Journal of General Virology 67, 2515-2520.
Rock, D. L., Nesburn, A. B., Ghiasi, H., Ong, J., Lewis, T. L., Lokensgard, J. R. & Wechsler, S. L. (1987). Detection of latency-related viral RNAs in trigeminal ganglia of rabbits latently infected with herpes simplex virus type 1. Journal of Virology 61, 3820-3826.
Roizman, B. & Sears, A. E. (1987). An inquiry into the mechanisms of herpes simples virus latency. Annual Reviews in Microbiology 41, 543-571.[Medline]
Shek, W. R., Calnek, B. W., Schat, K. A. & Chen, C. H. (1983). Characterization of Marek's disease virus-infected lymphocytes: discrimination between cytolytically and latently infected cells. Journal of the National Cancer Institute 70, 485-491.
Slater, J. D., Borchers, K., Thackray, A. M. & Field, H. J. (1994). The trigeminal ganglion is a location for equine herpesvirus 1 latency and reactivation in the horse. Journal of General Virology 75, 2007-2016.
Smith, D. J., Iqbal, J., Purewal, A., Hamblin, A. S. & Edington, N. (1998). In vitro reactivation of latent equid herpesvirus-1 from CD5+/CD8+ leukocytes indirectly by IL-2 or chorionic gonadotrophin. Journal of General Virology 79, 2997-3004.[Abstract]
Stroop, W. G., Rock, D. L. & Fraser, N. W. (1984). Localization of herpes simplex virus in the trigeminal and olfactory systems of the mouse central nervous system during acute and latent infections by in situ hybridization. Laboratory Investigations 51, 27-38.
Telford, E. A. R., Watson, M. S., McBride, K. & Davison, A. J. (1992). The DNA sequence of equine herpesvirus-1. Virology 189, 304-316.[Medline]
Telford, E. A. R., Watson, M. S., Perry, J., Cullinane, A. A. & Davison, A. J. (1998). The DNA sequence of equine herpesvirus-4. Journal of General Virology 79, 1197-1203.[Abstract]
Tenser, B. R., Edris, W. A., Hay, K. A. & de Galan, B. E. (1991). Expression of herpes simplex virus type 2 latency-associated transcript in neurons and nonneurons. Journal of Virology 65, 2745-2750.
Wagner, E. K., Devi-Rao, G., Feldman, L. T., Dobson, A. T., Zhang, Y.-F., Flanagan, W. M. & Stevens, J. G. (1988). Physical characterization of the herpes simplex virus latency-associated transcript in neurons. Journal of Virology 62, 1194-1202.
Welch, H. M., Bridges, C. G., Lyon, A. M., Griffiths, L. & Edington, N. (1992). Latent equid herpesviruses 1 and 4: detection and distinction using the polymerase chain reaction and co-cultivation from lymphoid tissues. Journal of General Virology 73, 261-268.
Received 18 February 1999;
accepted 26 April 1999.
This article has been cited by other articles:
![]() |
Y. Ou, K. A. Davis, V. Traina-Dorge, and W. L. Gray Simian Varicella Virus Expresses a Latency-Associated Transcript That Is Antisense to Open Reading Frame 61 (ICP0) mRNA in Neural Ganglia of Latently Infected Monkeys J. Virol., August 1, 2007; 81(15): 8149 - 8156. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Perez, M. Inman, A. Doster, and C. Jones Latency-Related Gene Encoded by Bovine Herpesvirus 1 Promotes Virus Growth and Reactivation from Latency in Tonsils of Infected Calves J. Clin. Microbiol., January 1, 2005; 43(1): 393 - 401. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| INT J SYST EVOL MICROBIOL | MICROBIOLOGY | J GEN VIROL |
| J MED MICROBIOL | ALL SGM JOURNALS | |