|
|
||||||||
Animal: DNA Viruses |
Department of Microbiology-Immunology, Northwestern University Medical School, Room 6-231 Ward Building, 303 East Chicago Avenue, Chicago, Illinois 60611, USA1
Author for correspondence: Richard Longnecker.Fax +1 312 503 1339. e-mail r-longnecker{at}nwu.edu
| Abstract |
|---|
|
|
|---|
| Introduction |
|---|
|
|
|---|
LMP2 is transcribed by two different promoters 3 kb apart. The first exons of LMP2A and LMP2B are the only unique exons, and the remaining eight exons are common to both messages (Laux et al., 1988
, 1989
; Sample et al., 1989
). The LMP2A unique exon encodes a 119 amino acid cytoplasmic domain, while the first LMP2B exon is noncoding. The methionine at amino acid 120 is the first methionine in the first LMP2 common exon and is the initiation site for LMP2B. LMP2A and LMP2B share 12 hydrophobic transmembrane domains and a 27 amino acid carboxy-terminal domain (Laux et al., 1988
, 1989
; Sample et al., 1989
).
Analysis of LCLs infected with LMP2 mutants shows a role for LMP2A in maintaining EBV latency in EBV-infected LCLs. The 119 amino acid cytoplasmic amino-terminal domain is essential for LMP2A function. EBV+ LMP2A+ LCLs are blocked in cell surface immunoglobulin-stimulated calcium mobilization, tyrosine phosphorylation and lytic activation compared with EBV+LMP2A- LCLs (Miller et al., 1994
, 1995
). The LMP2A cytoplasmic amino-terminal domain associates with and negatively regulates Src family protein tyrosine kinases (PTKs) and Syk PTK (Burkhardt et al., 1992
; Fruehling et al., 1996
, 1998
; Fruehling & Longnecker, 1997
; Longnecker et al., 1991
; Miller et al., 1995
), while LMP2B may regulate LMP2A function by modulating spacing between individual LMP2A amino-terminal domains aggregated at the cell membrane (Longnecker & Miller, 1996
). These characteristics of LMP2A indicate a potential role in blocking induction of the lytic phase of the EBV life-cycle (Longnecker & Miller, 1996
).
Mutational analysis of LMP2 reveals that neither LMP2A nor LMP2B are required for in vitro infection or transformation of primary B cells (Kim & Yates, 1993
; Longnecker et al., 1992
, 1993a
, b
). Studies defining the nonessential nature show that LMP2- EBV-infected LCLs appear identical to wild-type EBV LCLs in initial outgrowth, subsequent growth, sensitivity to limiting cell dilution and to low serum, and growth in soft agarose. Longnecker et al. (1992
, 1993a
) sought to demonstrate that efficiency of primary B cell transformation is quantitatively unaffected by LMP2 deletion. Their approach utilized expression of lytic antigen gp350/220 after induction of lytic replication as a crude indicator of virus production. These studies found that induction of gp350/220 occurred similarly in wild-type and LMP2-deleted LCLs, and that filtered released virus yielded similar numbers of transformed clones on infection and culture of primary B cells. Recently, however, it has been reported that LMP2 expression is important for efficient B cell immortalization (Brielmeier et al., 1996
). The approach taken utilized mini-EBV plasmids, which are E. coli constructs containing the minimal EBV genomic sequences that when packaged into an EBV coat initiate and maintain proliferation of infected B cells (Kempkes et al., 1995a
). Compared with fully competent mini-EBV, LMP2-deleted mini-EBV plasmids were severely impaired in capacity to yield immortalized B cell clones (Brielmeier et al., 1996
). A key characteristic of this approach is the tendency within mini-EBVs for small mutations to be introduced into sequences they encode. This is exemplified by a report that, using this approach, spontaneous deletion of a C residue in the EBNA3A open reading frame in one mini-EBV showed EBNA3A has a phenotype for initiation of B cell transformation (Kempkes et al., 1995b
). The absence of DNA sequence data of LMP2-deleted mini-EBVs or of marker rescue studies suggests that the reduction of immortalization efficiency may result from instability of DNA in mini-EBVs causing a mutation in another gene important for immortalization.
To resolve this issue we constructed a recombinant EBV, designated EBfaV-GFP, in which LMP2 was replaced with a reporter gene. We inserted the reporter gene encoding green fluorescent protein (GFP) into the LMP2 locus to enable visualization of infection. GFP was chosen because it fluoresces strongly and stably in many mammalian cells and can be monitored noninvasively in living cells (Chalfie, 1995
; Chalfie et al., 1994
). The enhanced form (EGFP) has modifications corresponding to human codon usage and it fluoresces 35 times more strongly than wild-type GFP (Cormack et al., 1996
; Heim et al., 1995
; Heim & Tsien, 1996
). The CMV immediate early (ie) promoter was used as it is a strong constitutive promoter in a wide range of mammalian cells.
Insertion of a neomycin resistanceCMVieEGFP cassette by homologous recombination into the LMP2 locus followed by drug selection gave rise to B95-8-derived cell lines harbouring a mixed population of recombinant (LMP2-EGFP+) and wild-type EBV. The LMP2 mutation was the same deletion mutation used by Longnecker et al. (1992
, 1993a
) and by Brielmeier et al. (1996)
. These cells were stimulated with phorbol ester and butyric acid, yielding infectious EBV consisting of a mixture of wild-type virus and recombinant virus. This mixture was used to infect primary B cells at very low multiplicity of infection, yielding LCLs which were analysed for presence of recombinant (EGFP+LMP2-) or wild-type (LMP2+) virus. Separate experiments employed two differing methodologies of B cell transformation: after infection cells were maintained either in 96-well dishes with RPMI tissue culture medium or were suspended in soft agarose over a feeder layer of previously irradiated cells. The ratio of recombinant to wild-type virus in the infection mixture was determined by Southern hybridization and compared with the ratio of recombinant LCLs to wild-type LCLs resulting from infection. Existence of a phenotype for LMP2 in efficiency of B cell transformation predicts under-representation of recombinant (EGFP+LMP2-) LCLs as a proportion of all LCLs derived from this procedure. We report here that a mixture of wild-type and recombinant (EGFP+LMP2-) EBV yields wild-type EBV and EGFP+LMP2- LCLs in proportions similar to those in the infecting virus. This indicates that in the context of the complete EBV genome, as opposed to EBV mini-plasmids, efficiency of transformation of primary B cells by EBV is unaffected by deletion of LMP2.
| Methods |
|---|
|
|
|---|
Virus and cells.
Plasmids.
Plasmid PS196, to target the CMV promoterEGFP/SV40 promoterneomycin resistance cassette into the viral genome, is based on pRL60 (Longnecker et al., 1993a
), which contains a SacI (B95-8 bp 163473)-to-KpnI (B95-8 bp 3502) fragment from EBV B95-8 DNA. The 3848 AseIEcoO109I fragment from pEGFP.N1 (Clontech Laboratories) was end-filled using DNA polymerase Klenow fragment and ligated into end-filled EcoRI/SalI-digested and phosphatase-treated pRL60. Restriction enzyme analysis confirmed the rightward direction of the EGFPneomycin resistance cassette in the plasmid, the same direction as LMP2. Plasmid pSVNaeZ, to induce lytic replication, has been described (Marchini et al., 1991
; Swaminathan et al., 1991
).
Transfection and drug selection of B95-8 cells.
DNA for transfection was banded twice on CsCl density gradients. Recombinant cell lines were generated by transfecting 107 B95-8 cells per 0·4 ml complete medium with 15 µg pPS196 and 5 µg pSVNaeZ. Cells in a 4 mm cuvette were pulsed at 230 V, 960 µF with a Gene Pulser (Bio-Rad), diluted in 5 ml complete medium, cultured for 48 h and transferred to 96-well plates at 50000 cells per well in complete medium plus G418 (Gibco-BRL) at 700 µg/ml. Half the medium was replaced every week until colonies emerged (34 weeks).
Southern blot hybridization.
Two DNA probes were used in separate Southern hybridizations. As a probe for EGFP a 791 bp BglIINotI fragment of pEFGP.NI was gel-purified. As a probe for LMP2 a 2862 bp SalIKpnI fragment (cutting at B95-8 sequence positions 644 and 3506, respectively) of pRL60 was used, which hybridizes to EBV DNA adjacent to the sequences deleted in EBfaV-GFP. 32P-radiolabelling used Ready-To-Go DNA labelling beads (Pharmacia). Genomic DNA was prepared as described (Wang et al., 1991
). DNA from wild-type or recombinant EBV cell lines was BamHI-digested, electrophoresed, transferred to nylon (GeneScreen Plus, NEN Life Sciences) and probed as described (Wang et al., 1991
). DNA from cell lines rather than virus stocks was analysed as there is no evidence that LMP2 has a virus packaging phenotype. Intensity of probe hybridization to bands was quantified by an Alpha Image 2000 image analysis system (Alpha Innotech) and confirmed using a Storm Phosphoimager (Molecular Dynamics).
Production of virus stock.
Cells harbouring EBfaV-GFP were stimulated to release virus by 4 days culture in complete medium plus phorbol ester TPA (12-O-tetradecanoyl phorbol-13-acetate, 20 ng/ml) and butyric acid (3 mM; Sigma). Cells were centrifuged (5 min/1500 r.p.m.) and supernatant filtered through a 0·45 µm celluloseacetate filter and stored at -140 °C.
Infection of cells and production of LCLs.
Cells were infected by incubating virus with cells (105 cells for titration of virus stocks; 107 cells per 96-well plate for LCL production) in 1 ml medium for 1 h at 37 °C with agitation. Cells were centrifuged (5 min/1500 r.p.m.), supernatant discarded and cells resuspended in complete medium. Virus stocks were assayed for infectious `green' units on Daudi cells, which are readily infectable with EBV. Stocks of EBfaV-GFP typically contained sufficient virus for 1 µl to yield 250500 EGFP-expressing cells. Infection of human cells was in cyclosporin A (1 µg/ml) to suppress donor EBV-directed T cells (Chang & Lung, 1994
; Okano et al., 1990
). Half the medium was replaced every week until colonies emerged (34 weeks).
Growth of infected cells in soft agarose.
Immortalization of primary B cells yielding either wild-type or recombinant LMP2-infected LCLs was by plating in soft agarose over an irradiated (4000 Rads) fibroblast feeder layer as described (Sugden & Mark, 1977
). Primary human B cells were infected with EBfaV-GFP at very low multiplicity, yielding 310 LCLs per 96-well plate. Cells were plated in 0·3% low melting point agarose (Fisher Biotech) in 96-well plates at approximately 3x105 cells/ml. After 57 weeks, the wells were scored for macroscopic cell growth and EGFP fluorescence.
Visualization of GFP.
Fluorescence in infected cells was measured 2436 h post-infection using a Zeiss Axioskop microscope or by flow cytometry. For photomicroscopy, unfixed infected cells were placed on a slide and overlaid with a coverslip.
Flow cytometry.
Flow cytometry used a FacsCalibur (Becton Dickinson) with CellQuest software. The instrument was adjusted so that fluorescence of uninfected cells fell within the first decade of the logarithmic scale on which the emission is displayed. The mean fluorescent intensity of negative controls ranged from 2·5 to 3·5. Plots show at least 10000 events.
PCR.
A standard protocol was employed (Vahey et al., 1995
). Primers detecting LMP2 sequences were PS003, CTTCTTGCCCGTTCTCTTTCTTAG and PS004, CTTCTGTACGCTAGTATCAGGAGC. These primers amplify a 546 bp fragment.
Primers for EBV gene BHRF1 were BHFR1-C, GTGCATGGAAATGGTA and BHRF1-D, AAGGCTTGGGTCTCC. These primers yield a product of 239 bp.
Electron microscopy.
EBfaV-GFP virus, diluted 1:25 in water, was pelleted onto Formvar-coated grids (Ted Pella) by ultracentrifugation in a Beckman Airfuge as described (Herold et al., 1991
). Grids, fixed in 1% glutaraldehyde and stained with 1% phosphotungstic acid, were examined in a JEOL 1220 electron microscope. Counts were the sum of at least six grids, examined on two separate occasions. The number of nucleocapsids per virion was scored only when clearly discernible.
| Results |
|---|
|
|
|---|
|
|
|
Dilution of the EBfaV-GFP virus stock and measurement of the number of EGFP-positive cells after infection yielded a linear relationship, with a maximum of 3045% of cells being positive. Fig. 2(c)
shows infected Daudi cells viewed by phase-contrast illumination (panel 1), the same field by fluorescence (panel 2) and panel 3 shows approximately 30% of Daudi cells expressing EGFP, as measured by flow cytometry.
Characterization of LCLs derived from infection with mixed EBfaV-GFP/wild-type EBV
To quantify a potential phenotype of LMP2 in efficiency of immortalization of B cells, virus stock EBfaV-GFP, containing wild-type EBV and EGFP+LMP2- recombinant virus in proportions 82·4:17·6, was used to infect primary B cells from healthy donors. The rationale of this experiment was that if LMP2 has no effect on efficiency of immortalization of B cells, the ratio of wild-type to recombinant genotypes of resulting LCLs should resemble the ratio in the infecting virus. Infected cells were placed in 96-well plates at 105 cells per well and incubated at 37 °C, 5% CO2 until clones emerged, (45 weeks) then transferred to 24-well plates. Fewer than 10 clones grew on each 96-well plate. After further growth, cells were harvested and subjected to PCR analysis of the EBV genomes present. LMP2 primers PS003 and PS004 amplify a 546 bp fragment. As a control for efficacy of PCR, primers detecting EBV gene BHRF1 yielding a 239 bp band were included in each reaction. A total of 94 LCLs were evaluated for EGFP expression and genome structure validated by PCR, with Fig. 3(a)
showing representative PCR results. All PCR reactions were duplicated on different days. Fig. 3(b)
, showing EBV BHRF1 sequences in representative samples, confirms efficacy of PCR. To assess sensitivity of detection of wild-type EBV DNA with primers PS003 and PS004, dilutions of DNA from 105 wild-type-infected LCLs in DNA from EBV-negative BJAB cells were added to DNA from 105 LMP2- LCLs (Fig. 3c)
. Primers PS003 and PS004 yielded a detectable amplification product with DNA diluted to 1:100 (Fig. 3c)
. These results demonstrate that a single wild-type EBV genome is readily detected in a background of 10100 mutant genomes.
Of 94 LCLs established by infection with EBfaV-GFP, PCR using LMP2 primers showed that wild-type EBV sequences were present in 83 (88·3%), and that in 11 LCLs (11·7%) LMP2 was deleted (Table 1
), each of which expressed EGFP. Southern hybridization was performed to verify the LMP2 mutation and the absence of wild-type LMP2 in the pure recombinant infected cells. Using representative mutant- and wild-type-infected LCLs, with probe specific for LMP2, only the 6·5 kbp fragment was detected, characteristic of insertion of the EGFPneomycin resistance cassette and deletion of LMP2 sequences (data not shown). Even on long exposure, no 9·6 kbp fragment characteristic of wild-type EBV was detected. Absence of LMP2 protein expression or any truncation product was confirmed by immunofluorescence. As expected LMP2A expression was not detected in newly derived LMP2-deleted LCLs, or the previously derived LMP2 deletion mutant LCLs (Longnecker et al., 1993b
), whereas it was readily detected in wild-type-infected control LCLs (data not shown). Taken together with the results from PCR showing that a single copy of wild-type EBV is detectable in a background of 100 mutant genomes, these data confirm the absence of wild-type EBV genomes in LMP2- mutant LCLs. LMP2-deleted LCLs not expressing EGFP did not arise. Interestingly, 25 of 94 LCLs (26·6%) showed a mixed infection (Table 1
) with wild-type EBV infection and EGFP expression in the same cell line. The low multiplicity at which primary B cells were infected (
1 transforming unit of virus/106 B cells) and the high rate at which LCLs were co-infected prompted us to examine EBfaV-GFP virus stocks by electron microscopy to determine whether appreciable numbers of virions contained multiple nucleocapsids, as it has been reported that EBV virion envelopes may contain multiple capsids (Hummeler et al., 1966
; Toplin & Schidlovsky, 1966
).
|
Theoretical outcomes of infection in terms of wild-type or recombinant genomes delivered by a single virion from virus EBfaV-GFP, based on proportions of wild-type and recombinant EBV genomes and numbers of nucleocapsids per envelope, are calculated in Table 2
. In summary the data shows that 73·3% of virions contain pure wild-type EBV DNA, 9·6% of virions contain pure recombinant LMP2-EGFP+ EBV DNA, and 16·9% of virions contain a mixture of wild-type and recombinant viral DNA. These numbers agree well with the actual results of 61·7%, 11·7% and 26·6%, respectively (Table 1
).
|
|
|
| Discussion |
|---|
|
|
|---|
While previous studies indicate that LMP2 does not affect efficiency of B cell transformation, they do not constitute formal analysis of this efficiency. The recent report by Brielmeier et al. (1996)
suggests that LMP2 greatly influences the efficiency of this process. In their study with EBV mini-plasmids to immortalize primary B cells, the LMP2-deleted mini-plasmid yielded 52 clones, of which 50 showed the presence of co-infecting helper virus. The remaining two carried a wild-type LMP2 and mutant allele in the EBV mini-plasmid, which was packaged as a dimer, indicating recombination of the mini-EBV genome with a wild-type genome restoring the LMP2 mutation and which could have restored additional second-site mutations. Thus Brielmeier and colleagues could not demonstrate B cell immortalization by EBV mini-plasmids bearing pure LMP2-deleted genomes. In contrast, wild-type LMP2 mini-plasmids readily yielded LCLs. This study showed that loss of LMP2 causes an extreme difference in immortalization efficiency, with complete inability of the LMP2-deleted mini-plasmid to immortalize B cells, contrasting with earlier findings that LMP2 is not absolutely required for B cell immortalization. Here we report an alternative methodology in which a mixture of wild-type EBV and LMP2-deleted EBV was used to immortalize primary B cells. Measurement of the ratio of wild-type to LMP2-deleted virus in the inoculum and comparison with that ratio in resulting LCLs permits careful determination of any phenotype for LMP2 in B cell immortalization efficiency. If LMP2 does not affect immortalization efficiency, the ratio of wild-type to recombinant genomes in the input virus together with counts of viral envelopes with one, two or three nucleocapsids, predicts that pure wild-type EBV LCLs, pure recombinant LCLs and LCLs with mixed infection will make up 73·3%, 9·6% and 16·9%, respectively, of the products of immortalization.
In this study infection of primary B cells with this mixture of wild-type and LMP2-deleted virus and subsequent growth of these cells in liquid tissue culture medium yielded pure wild-type EBV LCLs, pure recombinant LCLs and LCLs with mixed infection in the proportions 61·7%, 11·7% and 26·6%, respectively (Table 1
), which are indistinguishable from the predicted result.
To address the possibility that the anchorage-independent culture of primary B cells in soft agarose might reveal a phenotype for LMP2 that is too subtle to be observed in liquid tissue culture conditions, and to duplicate conditions used by Brielmeier and colleagues, immortalization of primary B cells was repeated using soft agarose. Pure wild-type EBV LCLs, pure recombinant LCLs and LCLs with mixed infection arose in proportions 77·6%, 8·2% and 22·4%, respectively, again resembling the predicted result. The similar rates of post-immortalization outgrowth of newly transformed wild-type and LMP2-deleted LCLs confirm previous results (Longnecker et al., 1993a
, b
) and show that macroscopic detection of LCLs is unaffected by the absence of LMP2.
Several explanations may account for differences between our findings and those of Brielmeier and colleagues. First, genetic manipulations involved in production of the EBV mini-plasmid used in their studies may have introduced mutations into other EBV genes important for immortalization. A simple marker rescue of the LMP2 mutation should exclude this possibility. Second, orientation of the selectable marker in the system of Brielmeier and colleagues is the opposite to that used here, suggesting a downstream transcriptional effect on other genes, such as LMP1, required for B cell immortalization (Kaye et al., 1993
). A third possibility which logically cannot be excluded is that redundancy exists between LMP2 and an unknown EBV gene product not encoded in the mini-plasmid, such that immortalization efficiency is unaffected by deletion of either of these components but diminished in the absence of both.
Of the three explanations for the discrepant results, the first arguing for incorporation of another mutation into the LMP2-deleted mini-EBV seems the most plausible. In fact, in a previous publication from the Hammerschmidt laboratory (Kempkes et al., 1995b
), the appearance of an unintended mutation occurred in the EBNA3A gene which adversely affected immortalization of primary B cells, making the addition of a second-site mutation a real possibility.
The careful analysis of LMP2 function in B cell immortalization conducted here shows that LMP2 has no role in B cell immortalization by EBV using standard cell culture techniques. Interestingly, a recent report by Caldwell et al. (1998)
, shows in some situations LMP2 expression affects cell survival of B cells in LMP2A transgenic mice. In that system, LMP2A was the only viral gene expressed in the murine B cells. In tissue culture, there are nine additional proteins expressed in EBV-infected lymphocytes which may be dominant over potential LMP2A functions. Cell culture systems able to separate LMP2A function from other viral genes may allow identification of specific LMP2 functions, but in the context of primary B cell immortalization by the entire EBV genome, it is clear that LMP2 has no role.
| Acknowledgments |
|---|
| References |
|---|
|
|
|---|
Burkhardt, A. L., Bolen, J. B., Kieff, E. & Longnecker, R. (1992). An EpsteinBarr virus transformation-associated membrane protein interacts with src family tyrosine kinases. Journal of Virology 66, 5161-5167.
Caldwell, R. G., Wilson, J. B., Anderson, S. J. & Longnecker, R. (1998). EpsteinBarr virus LMP2A drives B cell development and survival in the absence of normal B cell receptor signals. Immunity 9, 405-411.[Medline]
Chalfie, M. (1995). Green fluorescent protein. Photochemistry and Photobiology 62, 651-656.[Medline]
Chalfie, M., Tu, Y., Euskirchen, G., Ward, W. W. & Prasher, D. C. (1994). Green fluorescent protein as a marker for gene expression. Science 263, 802-805.
Chang, R. S. & Lung, M. L. (1994). A modified procedure for the propagation of wild-type EpsteinBarr virus in cultures of marmoset blood cells. Journal of Virological Methods 46, 167-178.[Medline]
Chen, F., Zou, J. Z., di Renzo, L., Winberg, G., Hu, L. F., Klein, E., Klein, G. & Ernberg, I. (1995). A subpopulation of normal B cells latently infected with EpsteinBarr virus resembles Burkitt lymphona cells in expressing EBNA-1 but not EBNA-2 or LMP1. Journal of Virology 69, 3752-3758.[Abstract]
Cormack, B. P., Valdivia, R. H. & Falkow, S. (1996). FACS-optimized mutants of the green fluorescent protein (GFP). Gene 173, 33-38.[Medline]
Fruehling, S. & Longnecker, R. (1997). The immunoreceptor tyrosine-based activation motif of EpsteinBarr virus LMP2A is essential for blocking BCR-mediated signal transduction. Virology 235, 241-251.[Medline]
Fruehling, S., Lee, S. K., Herrold, R., Frech, B., Laux, G., Kremmer, E., Grasser, F. A. & Longnecker, R. (1996). Identification of latent membrane protein 2A (LMP2A) domains essential for the LMP2A dominant-negative effect on B-lymphocyte surface immunoglobulin signal transduction. Journal of Virology 70, 6216-6226.[Abstract]
Fruehling, S., Swart, R., Dolwick, K. M., Kremmer, E. & Longnecker, R. (1998). Tyrosine 112 of latent membrane protein 2A is essential for protein tyrosine kinase loading and regulation of EpsteinBarr virus latency. Journal of Virology 72, 7796-7806.
Heim, R. & Tsien, R. Y. (1996). Engineering green fluorescent protein for improved brightness, longer wavelengths and fluorescence resonance energy transfer. Current Biology 6, 178-182.[Medline]
Heim, R., Cubitt, A. B. & Tsien, R. Y. (1995). Improved green fluorescence (letter). Nature 373, 663-664.[Medline]
Herold, B. C., WuDunn, D., Soltys, N. & Spear, P. G. (1991). Glycoprotein C of herpes simplex virus type 1 plays a principal role in the adsorption of virus to cells and in infectivity. Journal of Virology 65, 1090-1098.
Hummeler, K., Henle, G. & Henle, W. (1966). Fine structure of a virus in cultured lymphoblasts from Burkitt lymphoma. Journal of Bacteriology 91, 1366-1368.
Kaye, K. M., Izumi, K. M. & Kieff, E. (1993). EpsteinBarr virus latent membrane protein 1 is essential for B-lymphocyte growth transformation. Proceedings of the National Academy of Sciences, USA 90, 9150-9154.
Kempkes, B., Pich, D., Zeidler, R. & Hammerschmidt, W. (1995a). Immortalization of human primary B lymphocytes in vitro with DNA. Proceedings of the National Academy of Sciences, USA 92, 5875-5879.
Kempkes, B., Pich, D., Zeidler, R., Sugden, B. & Hammerschmidt, W. (1995b). Immortalization of human B lymphocytes by a plasmid containing 71 kilobase pairs of EpsteinBarr virus DNA. Journal of Virology 69, 231-238.[Abstract]
Kieff, E. (1996). EpsteinBarr virus and its replication. In Fundamental Virology, pp. 1109-1162. Edited by B. Fields, D. Knipe & P. Howley. New York: Raven Press.
Kim, O. J. & Yates, J. L. (1993). Mutants of EpsteinBarr virus with a selective marker disrupting the TP gene transform B cells and replicate normally in culture. Journal of Virology 67, 7634-7640.
Klein, G., Lindahl, T., Jondal, M., Leibold, W., Menezes, J., Nilsson, K. & Sundstrom, C. (1974). Continuous lymphoid cell lines with characteristics of B cells (bone-marrow-derived), lacking the EpsteinBarr virus genome and derived from three human lymphomas. Proceedings of the National Academy of Sciences, USA 71, 3283-3286.
Klein, G., Clements, G., Zeuthen, J. & Westman, A. (1976). Somatic cell hybrids between human lymphoma lines. II. Spontaneous and induced patterns of the EpsteinBarr virus (EBV) cycle. International Journal of Cancer 17, 715-724.
Laux, G., Perricaudet, M. & Farrell, P. J. (1988). A spliced EpsteinBarr virus gene expressed in immortalized lymphocytes is created by circularization of the linear viral genome. EMBO Journal 7, 769-774.[Medline]
Laux, G., Economou, A. & Farrell, P. J. (1989). The terminal protein gene 2 of EpsteinBarr virus is transcribed from a bidirectional latent promoter region. Journal of General Virology 70, 3079-3084.
Longnecker, R. (1998). Molecular biology of EpsteinBarr virus. In Human Tumor Viruses, pp. 133-172. Edited by D. McCance. Washington DC: ASM Press.
Longnecker, R. & Miller, C. (1996). Regulation of EpsteinBarr virus latency by latent membrane protein 2. Trends in Microbiology 4, 38-42.[Medline]
Longnecker, R., Druker, B., Roberts, T. M. & Kieff, E. (1991). An EpsteinBarr virus protein associated with cell growth transformation interacts with a tyrosine kinase. Journal of Virology 65, 3681-3692.
Longnecker, R., Miller, C. L., Miao, X.-Q., Marchini, A. & Kieff, E. (1992). The only domain which distinguishes EpsteinBarr virus latent membrane 2A (LMP2A) from LMP2B is dispensable for lymphocyte infection and growth transformation in vitro, and LMP2A is therefore nonessential. Journal of Virology 66, 6461-6469.
Longnecker, R., Miller, C. L., Miao, X.-Q., Tomkinson, B. & Kieff, E. (1993a). The last seven transmembrane and carboxy terminal cytoplasmic domains of EpsteinBarr virus latent membrane protein 2 (LMP2) are dispensable for lymphocyte infection and growth transformation in vitro. Journal of Virology 67, 2006-2013.
Longnecker, R., Miller, C. L., Tomkinson, B., Miao, X. Q. & Kieff, E. (1993b). Deletion of DNA encoding the first five transmembrane domains of EpsteinBarr virus latent membrane proteins 2A and 2B. Journal of Virology 67, 5068-5074.
Marchini, A., Tomkinson, B., Cohen, J. I. & Kieff, E. (1991). BHRF1, the EpsteinBarr virus gene with homology to Bc12, is dispensable for B-lymphocyte transformation and virus replication. Journal of Virology 65, 5991-6000.
Miller, G. & Lipman, M. (1973). Release of infectious EpsteinBarr virus by transformed marmoset leukocytes. Proceedings of the National Academy of Sciences, USA 70, 190-194.
Miller, G., Shope, T., Lisco, H., Stitt, D. & Lipman, M. (1972). EpsteinBarr virus: transformation, cytopathic changes, and viral antigens in squirrel monkey and marmoset leukocytes. Proceedings of the National Academy of Sciences, USA 69, 383-387.
Miller, C. L., Lee, J. H., Kieff, E. & Longnecker, R. (1994). An integral membrane protein (LMP2) blocks reactivation of EpsteinBarr virus from latency following surface immunoglobulin crosslinking. Proceedings of the National Academy of Sciences, USA 91, 772-776.
Miller, C. L., Burkhardt, A. L., Lee, J. H., Stealey, B., Longnecker, R., Bolen, J. B. & Kieff, E. (1995). Integral membrane protein 2 of EpsteinBarr virus regulates reactivation from latency through dominant negative effects on protein-tyrosine kinases. Immunity 2, 155-166.[Medline]
Miyashita, E. M., Yang, B., Babcock, G. J. & Thorley-Lawson, D. A. (1997). Identification of the site of EpsteinBarr virus persistence in vivo as a resting B cell. Journal of Virology 71, 4882-4891.[Abstract]
Okano, M., Taguchi, Y., Nakamine, H., Pirruccello, S. J., Davis, J. R., Beisel, K. W., Kleveland, K. L., Sanger, W. G., Fordyce, R. R. & Purtilo, D. T. (1990). Characterization of EpsteinBarr virus-induced lymphoproliferation derived from human peripheral blood mononuclear cells transferred to severe combined immunodeficient mice. American Journal of Pathology 137, 517-522.[Abstract]
Qu, L. & Rowe, D. (1992). EpsteinBarr virus latent gene expression in uncultured peripheral blood lymphocytes. Journal of Virology 66, 3715-3724.
Rickinson, A. & Kieff, E. (1996). EpsteinBarr virus. In Fields Virology, pp. 2397-2446. Edited by B. Fields, D. Knipe & P. Howley. Philadelphia: LippincottRaven.
Sample, J., Liebowitz, D. & Kieff, E. (1989). Two related EpsteinBarr virus membrane proteins are encoded by separate genes. Journal of Virology 63, 933-937.
Sugden, B. & Mark, W. (1977). Clonal transformation of adult human leukocytes by EpsteinBarr virus. Journal of Virology 23, 503-508.
Swaminathan, S., Tomkinson, B. & Kieff, E. (1991). Recombinant EpsteinBarr virus with small RNA (EBER) genes deleted transforms lymphocytes and replicates in vitro. Proceedings of the National Academy of Sciences, USA 88, 1546-1550.
Tierney, R. J., Steven, N., Young, L. S. & Rickinson, A. B. (1994). EpsteinBarr virus latency in blood mononuclear cells: analysis of viral gene transcription during primary infection and in the carrier state. Journal of Virology 68, 7374-7385.
Toplin, I. & Schidlovsky, G. (1966). Partial purification and electron microscopy of virus in the EB-3 cell line derived from a Burkitt lymphoma. Science 152, 1084-1085.
Vahey, M. T., Wong, M. T. & Michael, N. L. (1995). A standard PCR protocol: rapid isolation of DNA and PCR assay for ß-globin. In PCR Primer: A Laboratory Manual, pp. 17-22. Edited by C. W. Dieffenbach & G. S. Dveksler. New York: Cold Spring Harbor Laboratory Press.
Wang, F., Marchini, A. & Kieff, E. (1991). EpsteinBarr virus (EBV) recombinants: use of positive selection markers to rescue mutants in EBV-negative B-lymphoma cells. Journal of Virology 65, 1701-1709.
Received 6 January 1999;
accepted 24 March 1999.
This article has been cited by other articles:
![]() |
M. Dorner, F. Zucol, C. Berger, R. Byland, G. T. Melroe, M. Bernasconi, R. F. Speck, and D. Nadal Distinct Ex Vivo Susceptibility of B-Cell Subsets to Epstein-Barr Virus Infection According to Differentiation Status and Tissue Origin J. Virol., May 1, 2008; 82(9): 4400 - 4412. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Mancao and W. Hammerschmidt Epstein-Barr virus latent membrane protein 2A is a B-cell receptor mimic and essential for B-cell survival Blood, November 15, 2007; 110(10): 3715 - 3721. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. J. Martin, J. M. Lee, D. Walls, and S. D. Hayward Manipulation of the Toll-Like Receptor 7 Signaling Pathway by Epstein-Barr Virus J. Virol., September 15, 2007; 81(18): 9748 - 9758. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Fukuda and R. Longnecker Epstein-Barr Virus Latent Membrane Protein 2A Mediates Transformation through Constitutive Activation of the Ras/PI3-K/Akt Pathway J. Virol., September 1, 2007; 81(17): 9299 - 9306. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. P. Rechsteiner, C. Berger, M. Weber, J. A. Sigrist, D. Nadal, and M. Bernasconi Silencing of latent membrane protein 2B reduces susceptibility to activation of lytic Epstein-Barr virus in Burkitt's lymphoma Akata cells J. Gen. Virol., May 1, 2007; 88(5): 1454 - 1459. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. M. Brinkmann and T. F. Schulz Regulation of intracellular signalling by the terminal membrane proteins of members of the Gammaherpesvirinae. J. Gen. Virol., May 1, 2006; 87(Pt 5): 1047 - 1074. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Chen, M. DiVisconte, X. Jiang, C. Quink, and F. Wang Epstein-Barr Virus with the Latent Infection Nuclear Antigen 3B Completely Deleted Is Still Competent for B-Cell Growth Transformation In Vitro J. Virol., April 1, 2005; 79(7): 4506 - 4509. [Abstract] [Full Text] [P |