|
|
||||||||
Animal: RNA Viruses |
School of Animal and Microbial Sciences, University of Reading, Whiteknights, PO Box 228, Reading RG6 6AJ, UK1
Author for correspondence: Wendy Barclay.Fax +44 1189 316671. e-mail w.s.barclay{at}reading.ac.uk
| Abstract |
|---|
|
|
|---|
| Introduction |
|---|
|
|
|---|
It is possible to introduce specific changes into the RNA genome of influenza virus (Enami et al., 1990
). In this reverse genetics technique, synthetic RNP complexes are transfected into cells previously infected with helper virus. The procedure relies on a stringent selection system to isolate viruses containing the altered RNA segment from a background of helper viruses. A number of selection strategies have been employed, including host restriction (Enami et al., 1990
; Subbarao et al., 1993
; Grassauer et al., 1998
), temperature sensitivity (Enami & Palese, 1991
; Li et al., 1995
, Egorov et al., 1998
), antibody-mediated negative selection (Li et al., 1992
; Barclay & Palese, 1995) and antibody-mediated virus trapping (Horimoto & Kawaoka, 1994
). The ability to genetically manipulate the influenza virus genome is a powerful method that allows valuable insight into the function of the individual virus genes.
Reverse genetics has been extensively employed to study the influenza A virus NA gene, encoded on RNA segment 6 (Bilsel et al., 1993
; Castrucci & Kawaoka 1993
; Li et al., 1993
; Luo et al., 1992
, 1993
; Muster et al., 1991
; Percy et al., 1994
; Zheng et al., 1996
). In contrast, studies of the influenza B virus NA protein have been restricted to the analysis of temperature-sensitive mutants (Shibata et al., 1993
; Yamamoto-Goshima et al., 1994
) or mutants generated by passage of virus in the presence of NA-specific inhibitory compounds (Staschke et al., 1995
). Influenza B virus NA is also encoded by segment 6 RNA, and an additional overlapping open reading frame within this segment gives rise to the NB protein. NB is a component of the influenza B virion (Betakova et al., 1996
; Brassard et al., 1996
) and has been shown to conduct ions (Sunstrom et al., 1996
; Chizmakov et al., 1998
). These observations suggest that NB is the functional homologue of the influenza A virus protein, M2. However, since no natural mutants with lesions within the NB coding region are described, this hypothesis awaits confirmation. Here we report the first use of reverse genetics to obtain an influenza B virus altered in segment 6. This offers a new strategy for studying the functions of both NA and NB in the virus replicative cycle.
| Methods |
|---|
|
|
|---|
Generation of plasmids.
RTPCR and restriction enzyme digests of PCR products.
pT3BYNA6 transfectants were screened using primers BNA3' and NBSTOP, 5' AATATTGAATTCGTCGACTAATTAGGAGTGCTTTCTG 3' (complementary to nucleotides 330350 of positive-sense segment 6 RNA). The PCR products were digested with HpaI since this site is not present in the cDNA of B/Lee/40 segment 6 but exists at nucleotides 7782 within the B/Yamagata/88 sequence. To screen for pT3BYNASacI transfectants, we used PCR primers NA2 and 5'T3H3, which flanked the genetic tag. These PCR products were restricted with SacI.
Viruses and cells.
Influenza B virus strains 2X (Barclay & Palese, 1995
) and B/Yamagata/88 were grown by inoculation into 10-day-old hen eggs followed by incubation at 34 °C for 2 days. Infectivity assays were performed by plaquing in MDCK cells. Briefly, viruses diluted in serum-free DMEM were inoculated onto confluent monolayers of cells in 12-well tissue culture plates. Following 1 h incubation at 34 °C, inoculum was removed and cells were overlaid with DMEM containing 0·6% Oxoid agar (Biowhittacker). Following 3 days incubation inverted at 34 °C, remaining cells were visualized by staining with crystal violet and the plaques were counted. MDBK cells for RNP transfection were grown in DMEM containing 10% FCS.
Haemagglutination assay.
Viruses were diluted twofold across 96-well V-bottomed microtitre plates in PBS in a total volume of 50 µl. Fifty µl 0·5% freshly prepared chicken red blood cells were added and plates were incubated at 4 °C for 1 h.
Neuraminidase assay.
An adaptation of the method of Potier et al. (1979)
was used. Purified viruses were diluted in 0·1 M KPO4 pH 5·9 and 0·5 mM substrate 2'-(4-methylumbelliferyl)-
-d-N-acetylneuraminic acid (4-MUNANA, Sigma) was added. Assays were performed in U-bottomed microtitre plates in a total volume of 10 µl. Plates were incubated in a water bath at 37 °C for 30 min unless otherwise stated, and reactions were stopped by addition of 200 µl 0·1 M glycine pH 10·7 containing 25% ethanol. Fluorescence was read on a Biolumin 960 fluorescence spectrophotometer (Molecular Dynamics) with excitation wavelength of 360 nm and emission wavelength of 460 nm. Protein assays were performed using BCA protein assay reagent (Pierce).
| Results and Discussion |
|---|
|
|
|---|
|
|
The introduction of a SacI restriction enzyme site at nucleotides 12291231 resulted in a change in amino acids 393 and 394 of the NA protein from aspartate-alanine to glutamate-leucine. These residues are conserved in all influenza B viruses sequenced to date except B/Hong Kong/73, which possesses glutamate at residue 393. There is also variation within the homologous regions of influenza A virus NA (Fig. 1b
). We predicted that changes in this region might affect NA enzyme activity, since reference to the three-dimensional structure of influenza virus B/Beijing/87 NA protein revealed that these residues were situated in the head region of the protein near to the enzyme active site (Burmeister et al., 1992
). A crude measure of NA enzyme activity is the loss of red blood cell agglutination when plates are incubated at temperatures at which the NA is active. This is due to cleavage of sialic acid receptors from the erythrocytes. We performed haemagglutination assays with isolate #15 derived from pT3BYNASacI (Fig. 2b)
and with the wild-type transfectant virus NA6 (Fig. 2a)
. After noting the HA titres, we shifted the plates to 37 °C and continued the incubation for a further 2 h. We noticed that whilst haemagglutination was lost from wells containing high concentrations of wild-type virus, this effect was not seen for the mutant, suggesting that the mutant virus NA was less active (Fig. 3
).
|
|
|
The mutations in the NA protein of BYNASacI at residues 393 and 394 are located in the head region of the enzyme (Burmeister et al., 1992
). Some natural isolates show sequence variation in this area. For example at amino acid 397 a histidine in B/Beijing is changed to proline in B/Yamagata NA (Fig. 1b)
(Burmeister et al., 1993
). That this does not result in any loss of enzyme activity is not surprising since during natural evolution of influenza B virus strains, attenuating mutations are unlikely to be selected. However, it is likely that engineered mutations could affect the surrounding structure and compromise enzyme activity. Indeed, using site-directed mutagenesis of NA proteins expressed from recombinant SV40 viruses, Air et al. (1990)
showed that single amino acid changes at residues 251, 364 or 368 all decreased NA enzyme activity. The work presented here offers the ability to examine the effects of those and other mutations in NA on the phenotype of the virus. It will also enable the study of isolated mutations with the potential to confer resistance to NA inhibitors, as well as allowing insight into the role of the NB protein.
| Acknowledgments |
|---|
| References |
|---|
|
|
|---|
Barclay, W. S. & Palese, P. (1995). Influenza B viruses with site-specific mutations introduced into the HA gene. Journal of Virology 69, 1275-1279.[Abstract]
Betakova, T., Nermut, M. V. & Hay, A. J. (1996). The NB protein is an integral component of the membrane of influenza B virus. Journal of General Virology 77, 2689-2694.
Bilsel, P., Castrucci, M. R. & Kawaoka, Y. (1993). Mutations in the cytoplasmic tail of influenza A virus neuraminidase affect incorporation into virions. Journal of Virology 67, 6762-6767.
Blick, T. J., Tiong, T., Sahasrabudhe, A., Varghese, J. N., Colman, P. M., Hart, G. J., Bethell, R. C. & McKimm-Breschkin, J. L. (1995). Generation and characterisation of an influenza virus neuraminidase variant with decreased sensitivity to the neuraminidase specific inhibitor 4-guanadino-Neu5Ac2en. Virology 214, 475-484.[Medline]
Blick, T. J., Sahasrabudhe, A., McDonald, M., Owens, I. J., Morley, P. J., Fenton, R. J. & McKimm-Breschkin, J. L. (1998). The interaction of neuraminidase and hemagglutinin mutations in influenza virus in resistance to 4-Guanidino-Neu5Ac2en. Virology 246, 95-103.[Medline]
Brassard, D. L., Leser, G. P. & Lamb, R. A. (1996). Influenza B virus NB glycoprotein is a component of virions. Virology 220, 350-360.[Medline]
Burmeister, W. P., Ruigrock, R. W. H. & Cusack, S. (1992). The 2·2
resolution crystal structure of influenza B neuraminidase and its complex with sialic acid. EMBO Journal 11, 49-56.[Medline]
Burmeister, W. P., Baudin, F., Cusack, S. & Ruigrok, R. W. H. (1993). Comparison of structure and sequence of influenza B/Yamagata and B/Beijing neuraminidase shows a conserved head but much greater variability in the stalk and NB protein. Virology 192, 683-686.[Medline]
Castrucci, M. R. & Kawaoka, Y. (1993). Biologic importance of stalk length in influenza A virus. Journal of Virology 67, 759-764.
Chizmakov, I., Ogden, D., Betakova, T., Phillips, A. & Hay, A. (1998). Cl- and H+ permeability formed by expression of NB protein from influenza B virus. Biophysical Journal 74, A319.
Colacino, J. M., Chirgadze, N. Y., Garman, E., Murit, G., Loncharich, R. J., Baxter, A. J., Staschke, K. A. & Laver, W. G. (1997). A single sequence change destabilizes the influenza virus neuraminidase. Virology 236, 66-75.[Medline]
Coleman, P. M. (1989). Neuraminidase: enzyme and antigen. In The Influenza Viruses, pp. 175-210. Edited by R. M. Krug. New York: Plenum Press.
Egorov, A., Brandt, S., Sereinig, S., Romanova, J., Ferko, B., Katinger, D., Grassauer, A., Alexandrova, G., Katinger, H. & Muster, T. (1998). Transfectant influenza A viruses with long deletions in the NS1 protein grow efficiently in Vero cells. Journal of Virology 72, 6437-6441.
Enami, M. & Palese, P. (1991). High efficiency formation of influenza virus transfectants. Journal of Virology 65, 2711-2731.
Enami, M., Luytjes, W., Krystal, M. & Palese, P. (1990). Introduction of site-specific mutations into the genome of influenza virus. Proceedings of the National Academy of Sciences, USA 87, 3802-3805.
Grassauer, A., Egorov, A. Y., Ferko, B., Romanova, I., Katinger, H. & Muster, T. (1998). A host restriction-based selection system for influenza haemagglutinin transfectant viruses. Journal of General Virology 79, 1405-1409.[Abstract]
Gubareva, L. V., Bethell, R., Hart, G. J., Murti, K. G., Penn, C. R. & Webster, R. G. (1996). Characterisation of mutants of influenza A virus selected with the neuraminidase inhibitor 4-guanadino-Neu5Ac2en. Journal of Virology 70, 1818-1827.[Abstract]
Gubareva, L. V., Matrosovich, M. N., Brenner, M. K., Bethell, R. C. & Webster, R. G. (1998). Evidence for zanamavir resistance in an immunocompromised child infected with influenza B virus. Journal of Infectious Diseases 178, 1257-1262.[Medline]
Horimoto, T. & Kawaoka, Y. (1994). Reverse genetics provides direct evidence for a correlation of haemagglutinin cleavability and virulence of an avian influenza A virus. Journal of Virology 68, 3120-3128.
Lamb, R. A. & Krug, R. M. (1996). Orthomyxoviridae: the viruses and their replication. In Fields Virology, pp. 1353-1396. Edited by B. N. Fields, D. M. Knipe & P. M. Howley. Philadelphia: LippincottRaven.
Li, S. Q., Schulman, J. L., Moran, T., Bona, C. & Palese, P. (1992). Influenza A virus transfectants with chimaeric haemagglutinins containing epitopes from different subtypes. Journal of Virology 66, 399-404.
Li, S. Q., Schulman, J., Itamura, S. & Palese, P. (1993). Glycosylation of neuraminidase determines the neurovirulence of influenza A/WSN/33 virus. Journal of Virology 67, 6667-6673.
Li, S. Q., Xu, M. L. & Coelingh, K. (1995). Electroporation of influenza virus ribonucleoprotein complexes for the rescue of nucleoprotein and matrix genes. Virus Research 37, 153-161.[Medline]
Luo, G. X., Bergmann, M., Garcia-Sastre, A. & Palese, P. (1992). Mechanism of attenuation of a chimaeric influenza A/B transfectant virus. Journal of Virology 66, 4670-4685.
Luo, G. X., Chung, J. & Palese, P. (1993). Alterations of the stalk of the influenza virus neuraminidase deletions and insertions. Virus Research 29, 141-153.[Medline]
McKimm-Breschkin, J. L., McDonald, M., Blick, T. J. & Colman, P. M. (1996). Mutation in the influenza virus neuraminidase gene resulting in decreased sensitivity to the neuraminidase inhibitor 4-guanadino-Neu5Ac2en leads to instability of the enzyme. Virology 225, 240-242.[Medline]
McKimm-Breschkin, J. L., Sahasrabudhe, A., Blick, T. J., McDonald, M., Colman, P. M., Hart, G. J., Bethell, R. C. & Varghese, J. N. (1998). Mutations in a conserved residue in the influenza virus neuraminidase active site decreases sensitivity to Neu5Ac2en-derived inhibitors. Journal of Virology 72, 2456-2462.
Muster, T., Subbarao, E. K., Enaimi, M., Murphy, B. R. & Palese, P. (1991). An influenza A virus containing influenza B virus 5' and 3' non-coding regions on the neuraminidase gene is attenuated in mice. Proceedings of the National Academy of Sciences, USA 88, 5177-5181.
Palese, P., Tobita, K., Ueda, M. & Compans, R. W. (1974). Characterisation of temperature sensitive influenza virus mutants defective in neuraminidase. Virology 61, 397-410.[Medline]
Percy, N., Barclay, W. S., Garcia-Sastre, A. & Palese, P. (1994). Expression of a foreign protein by influenza A virus. Journal of Virology 68, 4486-4492.
Potier, M., Mameli, L., Belisle, M., Dallaire, L. & Melancon, S. B. (1979). Fluorimetric assay of neuraminidase with a sodium (4-methylumbelliferyl-
-d-N-acetylneurminate) substrate. Analytical Biochemistry 94, 287-296.[Medline]
Shibata, S., Yamamoto-Goshima, F., Maeno, K., Hanaichi, T., Fukjita, Y., Nakajima, K., Imai, M., Komatsu, T. & Sugiura, S. (1993). Characterisation of a temperature-sensitive influenza B virus mutant defective in neuraminidase. Journal of Virology 67, 3264-3273.
Staschke, K. A., Coalcino, J. M., Baxter, A. J., Air, G. M., Bansal, A., Hornback, W. J., Monroe, J. E. & Laever, W. G. (1995). Molecular basis for the resistance of influenza viruses to 4-Guanidino-Neu5Ac2en. Virology 214, 642-646.[Medline]
Stevens, M. & Barclay, W. S. (1998). The N-terminal extension of the influenza B virus nucleoprotein is not required for nuclear accumulation or the expression and replication of a model RNA. Journal of Virology 72, 5307-5312.
Subbarao, E. K., Kawaoka, Y. & Murphy, B. R. (1993). Rescue of an influenza A virus wild-type PB2 gene and a mutant derivative bearing a site-specific temperature-sensitive and attenuating mutation. Journal of Virology 678, 7223-7228.
Sunstrom, N. A., Premkumar, L. S., Premkumar, A., Ewart, G., Cox, G. B. & Gage, P. W. (1996). Ion channels formed by NB, an influenza B virus protein. Journal of Membrane Biology 150, 127-132.[Medline]
Tai, C. Y., Escarpe, P. A., Sidwell, R. W., Williams, M. A., Lew, W., Wu, H., Kim, C. U. & Mendell, D. B. (1998). Characterization of human influenza virus variants selected in vitro in the presence of the neuraminidase inhibitor GS4071. Antimicrobial Agents and Chemotherapy 42, 3234-3241.
Von Itzstein, M., Wu, W. Y., Kok, G. B., Pegg, M. S., Dyason, J. C., Jin, B., Phan, T. V., Smythe, M. L., White, H. F., Oliver, S. W., Colman, P. M., Varghese, J. N., Ryan, D. M., Woods, J. M., Bethell, R. C., Hotham, V. J., Cameron, J. M. & Penn, C. R. (1993). Rational design of potent sialidase-based inhibitors of influenza-virus replication. Nature 363, 418-423.[Medline]
Ward, T., Pipkin, P. A., Clarkson, N. A., Stone, D. M., Minor, P. D. & Almond, J. W. (1994). Decay accelerating factor CD55 is identified as the receptor for echovirus 7 using CELICS, a rapid immune-focal cloning method. EMBO Journal 13, 5070-5074.[Medline]
Yamamoto-Goshima, F., Maeno, K., Morishita, T., Ueda, M., Fujita, Y., Nakajima, K. & Yoshi, S. (1994). Role of neuraminidase in the morphogenesis of influenza B virus. Journal of Virology 68, 1250-1254.
Zheng, H. Y., Paelese, P. & Garcia-Sastre, A. (1996). Nonconserved nucleotides at the 3'-end and 5'-end of an influenza A virus RNA play an important role in viral RNA replication. Virology 217, 242-251.[Medline]
Received 9 April 1999;
accepted 1 June 1999.
This article has been cited by other articles:
![]() |
F. T. Vreede, H. Gifford, and G. G. Brownlee Role of Initiating Nucleoside Triphosphate Concentrations in the Regulation of Influenza Virus Replication and Transcription J. Virol., July 15, 2008; 82(14): 6902 - 6910. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| INT J SYST EVOL MICROBIOL | MICROBIOLOGY | J GEN VIROL |
| J MED MICROBIOL | ALL SGM JOURNALS | |