J Gen Virol Faster Access
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via CrossRef
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Rowley, K. V.
Right arrow Articles by Barclay, W. S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Rowley, K. V.
Right arrow Articles by Barclay, W. S.
Agricola
Right arrow Articles by Rowley, K. V.
Right arrow Articles by Barclay, W. S.
Journal of General Virology (1999), 80, 2353-2359.
© 1999 Society for General Microbiology


Animal: RNA Viruses

Isolation and characterization of a transfectant influenza B virus altered in RNA segment 6

Kate V. Rowley1, Ruth Harvey1 and Wendy S. Barclay1

School of Animal and Microbial Sciences, University of Reading, Whiteknights, PO Box 228, Reading RG6 6AJ, UK1

Author for correspondence: Wendy Barclay.Fax +44 1189 316671. e-mail w.s.barclay{at}reading.ac.uk


   Abstract
TOP
Abstract
Introduction
Methods
Results and Discussion
References
 
This report describes the successful generation of an influenza B transfectant virus altered in RNA segment 6, which encodes the neuraminidase (NA) protein. The procedure for selection of the transfectant virus relies on the use of strain-specific anti-NA monoclonal antibodies to inhibit growth of the helper virus within the system. A transfectant virus has been engineered which has a coding change in the NA protein. This change resulted in attenuated growth in vitro that could be rescued by addition of exogenous bacterial NA. The mutant virus-associated NA activity was unstable as a result of the engineered changes. The ability to genetically manipulate influenza B virus segment 6 will allow us to assess the function of both NA and the small protein NB, also coded from this RNA, within the context of the virus infectious cycle.


   Introduction
TOP
Abstract
Introduction
Methods
Results and Discussion
References
 
Influenza B viruses have a negative-strand RNA genome of eight RNA segments complexed with nucleoprotein (NP) and polymerase subunits PB1, PB2 and PA. These ribonucleoprotein (RNP) complexes are packaged within a host cell-derived lipid envelope which displays three virally encoded glycoproteins, haemagglutinin (HA), neuraminidase (NA) and a small protein of unassigned function, NB (Lamb & Krug, 1996Down ).

It is possible to introduce specific changes into the RNA genome of influenza virus (Enami et al., 1990Down ). In this reverse genetics technique, synthetic RNP complexes are transfected into cells previously infected with helper virus. The procedure relies on a stringent selection system to isolate viruses containing the altered RNA segment from a background of helper viruses. A number of selection strategies have been employed, including host restriction (Enami et al., 1990Down ; Subbarao et al., 1993Down ; Grassauer et al., 1998Down ), temperature sensitivity (Enami & Palese, 1991Down ; Li et al., 1995Down , Egorov et al., 1998Down ), antibody-mediated negative selection (Li et al., 1992Down ; Barclay & Palese, 1995) and antibody-mediated virus trapping (Horimoto & Kawaoka, 1994Down ). The ability to genetically manipulate the influenza virus genome is a powerful method that allows valuable insight into the function of the individual virus genes.

Reverse genetics has been extensively employed to study the influenza A virus NA gene, encoded on RNA segment 6 (Bilsel et al., 1993Down ; Castrucci & Kawaoka 1993Down ; Li et al., 1993Down ; Luo et al., 1992Down , 1993Down ; Muster et al., 1991Down ; Percy et al., 1994Down ; Zheng et al., 1996Down ). In contrast, studies of the influenza B virus NA protein have been restricted to the analysis of temperature-sensitive mutants (Shibata et al., 1993Down ; Yamamoto-Goshima et al., 1994Down ) or mutants generated by passage of virus in the presence of NA-specific inhibitory compounds (Staschke et al., 1995Down ). Influenza B virus NA is also encoded by segment 6 RNA, and an additional overlapping open reading frame within this segment gives rise to the NB protein. NB is a component of the influenza B virion (Betakova et al., 1996Down ; Brassard et al., 1996Down ) and has been shown to conduct ions (Sunstrom et al., 1996Down ; Chizmakov et al., 1998Down ). These observations suggest that NB is the functional homologue of the influenza A virus protein, M2. However, since no natural mutants with lesions within the NB coding region are described, this hypothesis awaits confirmation. Here we report the first use of reverse genetics to obtain an influenza B virus altered in segment 6. This offers a new strategy for studying the functions of both NA and NB in the virus replicative cycle.


   Methods
TOP
Abstract
Introduction
Methods
Results and Discussion
References
 
{blacksquare} Generation of plasmids.
Primers used were BNA3', 5' TCTAGA- TCTGAAGACTTAGCAGAAGCAGAGC 3', for RT (complementary to the 3' terminal 14 nucleotides of RNA) and BNA3' in combination with 5'T3H3, 5' GCGCGCAAGCTTAATTAACCCTCACTAAAAGTAGTAACAAGAGCATTTTTC 3' (complementary to the 5' terminal 22 nucleotides of cRNA and including a T3 promoter site), for PCR. The BglII/HindIII-digested PCR product was cloned into BamHI/HindIII-digested pUC19 to generate the plasmid, pT3BYNA6. A BbsI site introduced upstream of the virus sequence allowed linearization of plasmid such that T3 transcription produced RNA with authentic termini. We next generated a derivative of pT3BYNA6 containing mutations within the NA open reading frame at nucleotide positions 1229–1231 (numbering with respect to positive-sense segment 6 RNA) which introduced a SacI site as a genetic tag. Two PCR products were produced from pT3BYNA6 using primers SacI+ sense 5' CCATGGACTGACAGTGAGCTCCTT 3' with primer 5'T3H3, and SacI- antisense 5' AAGGAGCTCACTGTCAGTCCATGG 3', with primer NA2 corresponding to nucleotides 987–1007 of positive-sense segment 6 RNA, 5' GCTGAAATAAGATTGATGTGC 3'. Overlapping PCR joined them into a 568 bp product, which was cloned into pT3NA6 using restriction enzymes NcoI and HindIII to generate the plasmid pT3BYNASacI.

{blacksquare} RT–PCR and restriction enzyme digests of PCR products.
pT3BYNA6 transfectants were screened using primers BNA3' and NBSTOP, 5' AATATTGAATTCGTCGACTAATTAGGAGTGCTTTCTG 3' (complementary to nucleotides 330–350 of positive-sense segment 6 RNA). The PCR products were digested with HpaI since this site is not present in the cDNA of B/Lee/40 segment 6 but exists at nucleotides 77–82 within the B/Yamagata/88 sequence. To screen for pT3BYNASacI transfectants, we used PCR primers NA2 and 5'T3H3, which flanked the genetic tag. These PCR products were restricted with SacI.

{blacksquare} Viruses and cells.
Influenza B virus strains 2X (Barclay & Palese, 1995Down ) and B/Yamagata/88 were grown by inoculation into 10-day-old hen eggs followed by incubation at 34 °C for 2 days. Infectivity assays were performed by plaquing in MDCK cells. Briefly, viruses diluted in serum-free DMEM were inoculated onto confluent monolayers of cells in 12-well tissue culture plates. Following 1 h incubation at 34 °C, inoculum was removed and cells were overlaid with DMEM containing 0·6% Oxoid agar (Biowhittacker). Following 3 days incubation inverted at 34 °C, remaining cells were visualized by staining with crystal violet and the plaques were counted. MDBK cells for RNP transfection were grown in DMEM containing 10% FCS.

{blacksquare} Haemagglutination assay.
Viruses were diluted twofold across 96-well V-bottomed microtitre plates in PBS in a total volume of 50 µl. Fifty µl 0·5% freshly prepared chicken red blood cells were added and plates were incubated at 4 °C for 1 h.

{blacksquare} Neuraminidase assay.
An adaptation of the method of Potier et al. (1979)Down was used. Purified viruses were diluted in 0·1 M KPO4 pH 5·9 and 0·5 mM substrate 2'-(4-methylumbelliferyl)-{alpha}-d-N-acetylneuraminic acid (4-MUNANA, Sigma) was added. Assays were performed in U-bottomed microtitre plates in a total volume of 10 µl. Plates were incubated in a water bath at 37 °C for 30 min unless otherwise stated, and reactions were stopped by addition of 200 µl 0·1 M glycine pH 10·7 containing 25% ethanol. Fluorescence was read on a Biolumin 960 fluorescence spectrophotometer (Molecular Dynamics) with excitation wavelength of 360 nm and emission wavelength of 460 nm. Protein assays were performed using BCA protein assay reagent (Pierce).


   Results and Discussion
TOP
Abstract
Introduction
Methods
Results and Discussion
References
 
We applied a helper-dependent RNP transfection coupled with negative selection using NA strain-specific monoclonal antibodies. We first cloned segment 6 RNA of influenza B virus strain B/Yamagata/88 by RT–PCR from vRNA using previously described methods (Stevens & Barclay, 1998Down ) to generate plasmid pT3NA6. We next introduced nucleotide changes in the NA coding region by site-directed mutagenesis using PCR to create plasmid pT3NASacI (Fig. 1aDown). We screened anti-NA monoclonal antibodies and identified three which could inhibit growth of influenza B virus strain B/Lee/40 but not of B/Yamagata/88. They are known as 2D5, 3C6 and 1B9 and show different patterns of reactivity with a panel of strains of influenza B virus (data not shown). For RNP transfection, 106 MDBK cells were infected with Md2X helper virus at a multiplicity of 1. The Md2X helper virus incorporates a B/Maryland/59 HA segment in the background of seven segments from B/Lee/40 (Barclay & Palese, 1995Down ). RNP complexes derived from in vitro transcription of plasmids pT3BYNA6 or pT3BYNASacI were transfected into cells according to protocols described previously (Enami et al., 1991Down ; Barclay & Palese, 1995Down ). Supernatants were passaged twice in MDCK cells in the presence of monoclonal antibodies 2D5 and 3C6 at immunoglobulin concentrations of 10 ng/ml and 470 ng/ml, respectively, then plaqued in the presence of the same concentration of antibodies. Individual plaques were screened immunohistochemically as follows: duplicate dishes of cells infected with each plaque were screened for reactivity with anti-influenza B virus NP monoclonal antibody MAS774b (Harlan Seralabs) or with monoclonal antibody 1B9, which had not been used in the selection. Binding of primary antibody was detected by a ß-galactosidase-linked anti-mouse antibody and X-Gal substrate (Ward et al., 1994Down ). Reactivity with 1B9 indicated that the virus was a helper virus mutant which had escaped inhibition by 2D5 and 3C6 antibodies. In a typical experiment, approximately half of the viruses fell into this category. Viruses that reacted with MAS774b but failed to react with 1B9 were grown in embryonated hen's eggs. Viral RNA was extracted as previously described (Stevens & Barclay, 1998Down ) and RT–PCR was performed to confirm the origin of segment 6 (Fig. 2Down).



View larger version (48K):
[in this window]
[in a new window]
 
Fig. 1. Introduction of mutations into the influenza virus B/Yamagata/88 NA gene. (a) Schematic representation of segment 6 RNA of influenza B/Yamagata/88 virus. The two open reading frames, NA and NB are illustrated by grey bars. Numbers indicate amino acid residues within the NA protein. Coding changes introduced by the SacI mutation are underlined. (b) Comparison of influenza virus NA sequences surrounding amino acids 393 and 394. Amino acid residues for 11 influenza B virus NA proteins and five influenza A virus NA proteins are compared to the sequence of B/Memphis/3/89 NA. Residues 393 and 394 are shown in bold and underlined. Accession nos: B/Beijing/87, M54967; B/Yamagata/88, X67013; other influenza B viruses from Air et al. (1990)Down and influenza A viruses from Coleman (1989)Down .

 


View larger version (31K):
[in this window]
[in a new window]
 
Fig. 2. Restriction enzyme analysis of PCR products generated by RT–PCR from vRNA of putative transfectant viruses. (a) RT–PCR was performed with primers which amplify the 3' region of the segment 6 vRNA. In the B/Yamagata/88 strain, this region contains an HpaI site which is not present in vRNA of B/Lee/40. PCR products digested with HpaI were analysed on a 2% agarose gel stained with ethidium bromide. Approximate sizes of DNA markers (M) are shown to the left. The 367 bp products from viruses with B/Yamagata/88 sequence were cut with HpaI to yield 271 bp and 96 bp fragments. Control viruses were B/Lee/40 and B/Yamagata/88. Results for three putative transfectant viruses, NA5, NA6 and NA7 are shown. (b) RT–PCR was performed with primers which amplify the 5' region of segment 6 vRNA. The 591 bp RT–PCR product digested with SacI, C, was run next to undigested PCR product, U, on a 2% agarose gel stained with ethidium bromide. Approximate sizes of DNA markers (M) are shown to the right. PCR product from plasmid pT3NAYSacI DNA, which contains the genetic tag, was cut into 402 bp and 189 bp fragments (+ve). PCR products following RT from RNA of putative transfectant viruses isolates #15, #16 and #17 are shown.

 
We successfully isolated transfectant viruses derived from pT3BYNA6 and pT3BYNASacI. Of those viruses which failed to react with any of the three B/Lee/40-specific NA monoclonal antibodies, two out of three tested were transfectants (Fig. 2aUp, NA6 and NA7, and b, #15 and #16). The others were probably derivatives of helper virus which had acquired mutations in the 1B9 epitope. Their sequences were not determined. The stringency of the selection procedure may ultimately be improved by incorporating mutations which confer resistance to the NA-specific antiviral GG167 (Von Itzstein et al., 1993Down ; Staschke et al., 1995Down ) into pT3BYNA6, and using drug in addition to antibodies to inhibit helper virus.

The introduction of a SacI restriction enzyme site at nucleotides 1229–1231 resulted in a change in amino acids 393 and 394 of the NA protein from aspartate-alanine to glutamate-leucine. These residues are conserved in all influenza B viruses sequenced to date except B/Hong Kong/73, which possesses glutamate at residue 393. There is also variation within the homologous regions of influenza A virus NA (Fig. 1bUp). We predicted that changes in this region might affect NA enzyme activity, since reference to the three-dimensional structure of influenza virus B/Beijing/87 NA protein revealed that these residues were situated in the head region of the protein near to the enzyme active site (Burmeister et al., 1992Down ). A crude measure of NA enzyme activity is the loss of red blood cell agglutination when plates are incubated at temperatures at which the NA is active. This is due to cleavage of sialic acid receptors from the erythrocytes. We performed haemagglutination assays with isolate #15 derived from pT3BYNASacI (Fig. 2b)Up and with the wild-type transfectant virus NA6 (Fig. 2a)Up. After noting the HA titres, we shifted the plates to 37 °C and continued the incubation for a further 2 h. We noticed that whilst haemagglutination was lost from wells containing high concentrations of wild-type virus, this effect was not seen for the mutant, suggesting that the mutant virus NA was less active (Fig. 3Down).



View larger version (113K):
[in this window]
[in a new window]
 
Fig. 3. Haemagglutination activity of transfectant virus. Loss of HA activity at 37 °C was compared for wild-type (NA6) and transfectant virus (#15). Viruses were diluted twofold across the plate from left to right and incubated with 50 µl 0·5% suspension of freshly washed chicken red blood cells. A row of red blood cells without virus is shown at the bottom of each panel as a negative control. The upper panel shows HA activity following incubation at 4 °C. In the lower panel plates were shifted to 37 °C after the appearance of HA and monitored after a further 2 h.

 
Changes in NA enzyme activity may lead to attenuation of virus growth. Following low multiplicity infection of MDCK cells, the mutant virus #15 showed lower titres of released virus than the wild-type virus until 60 h post-infection, but at 72 h, titres of both viruses were comparable (Fig. 4aDown). The attenuation of mutant virus titre at early times was overcome by propagating the virus in the presence of 0·025 mg/ml exogenous bacterial NA (purified from Clostridium perfringens, Sigma) (Fig. 4b)Down. Neuraminidase acts late in the virus life-cycle to aid release of progeny viruses from the cell (Palese et al., 1974Down ). When NA activity is decreased, HA on progeny viruses binds sialic acid residues at the infected cell surface, preventing release of virus. However, at late times after infection, or in the presence of exogenous bacterial NA, the amount of NA in the system has increased and this facilitates release of the mutant virus.



View larger version (20K):
[in this window]
[in a new window]
 
Fig. 4. Growth phenotype of transfectant virus. (a) Multistep growth analysis of transfectant virus. MDCK cells were infected with NA6 virus (wild-type) or isolate #15 (YNASacI) at an m.o.i. of 0·001 and overlaid with serum-free DMEM containing 2 µg/ml trypsin. At 12 h intervals, supernatants were removed and released virus titrated by plaque assay in MDCK cells in the presence of 2 µg/ml trypsin. (b) Multistep growth analysis of transfectant virus in the presence of exogenous NA. Growth analysis was repeated as in (a) in the presence of 0·025 µg/ml endogenous bacterial NA from Clostridium perfringens (Sigma).

 
The complementation of virus growth by addition of exogenous NA suggested that the mutant phenotype was indeed due to a decrease of NA enzyme activity. To confirm this hypothesis, the activity of virion-associated NA was tested using 4-MUNANA (Potier et al., 1979Down ) as substrate. Both viruses were propagated to high titres in eggs and then concentrated by ultracentrifugation through a 30% sucrose cushion. Total protein assays combined with Coomassie gel analysis of virus preparations were used to standardize virus inputs to the NA assay. The mutant virus showed a slightly lower rate of substrate conversion and enzyme activity than wild-type (Fig. 5aDown). We next assessed the possibility that the engineered mutations have affected the stability of the NA enzyme. Indeed, mutations at the catalytic site of influenza A virus NA protein have been shown to decrease the stability of NA (McKimm-Breschkin et al., 1996Down ; Colacino et al., 1997Down ). We incubated equal concentrations of purified viruses overnight at 34 °C, 37 °C or 39 °C and tested the remaining NA activity. The activity of wild-type virus was relatively unaffected whereas that of the mutant was substantially decreased with the effect increasing at higher temperatures (Fig. 5b)Down. Thus, when virus is incubated at growth temperatures of 34–37 °C the half-life of the NA enzyme is very short, leading to a lower release of virus until such time when NA is so abundant that a sufficient enzyme concentration is reached. We investigated the plaquing ability of virus #15 at 34 °C, 37 °C and 39 °C. Plaques were formed at all temperatures, but the appearance of the plaques became smaller and clearer as the temperature increased (data not shown). The wild-type virus also formed plaques at these temperatures but there was no obvious difference in their appearance. Recently the NA protein of an influenza A virus selected for resistance to GG167 was shown to be thermally unstable due to a coding change at the enzyme active site. The NA was found to exist as monomers instead of tetramers and the authors assumed that the monomers were either inactive or less active as enzymes. In that case a salt bridge between the altered residue and an amino acid at the intersubunit interface was destabilized (Colacino et al., 1997Down ). We have not assessed the oligomeric form of our mutant. However, by reference to the published structure of influenza virus B/Beijing NA (Burmeister et al., 1992Down ), we propose that alteration of amino acids 393 and 394 might also affect intersubunit interactions.



View larger version (23K):
[in this window]
[in a new window]
 
Fig. 5. Neuraminidase enzyme assay of transfectant virus. (a) Initial rates of activity. Viruses were grown in eggs and concentrated by centrifugation through 30% sucrose in 100 mM NaCl, 10 mM Tris–HCl (pH 7·8), 1 mM EDTA. Protein content was assayed by BCA kit (Pierce). Samples of 250 ng of each virus were incubated with 0·5 mM 4-MUNANA for 2 to 12 min. (b) NA activity of transfectant virus after overnight incubation at different temperatures. Aliquots of each virus were incubated overnight on ice or at 34 °C, 37 °C, 39 °C and then 250 ng was incubated with 0·5 mM 4-MUNANA for 30 min.

 
Several influenza virus mutants with decreased NA enzyme activity have recently been described in the literature (Staschke et al., 1995Down ;Blick et al., 1995Down , 1998Down ;Gubareva et al., 1996Down , 1998Down ;McKimm-Breschkin et al., 1996Down , 1998Down ; Tai et al., 1998Down ). This group of mutants have been isolated by passage in the presence of NA enzyme inhibitors and are resistant to the compounds. We tested whether our mutant influenza B virus showed resistance to the antiviral agent GG167 (zanamavir), which targets NA activity (Von Itzstein et al., 1993Down ). This was not the case. Both the wild-type and the mutant virus were equally sensitive to the compound and were equally inhibited at a range of drug concentrations from 0·3 to 0·0003 µg/ml (data not shown). Interestingly, we again noticed that for both viruses, the appearance of the plaques became smaller but clearer as drug concentration increased and NA activity concomitantly decreased (data not shown). It is still possible that the mutant virus could show a difference in drug sensitivity during growth in a different system. It has been reported that an influenza B virus which was resistant to GG167 in vivo did not display this phenotype when tested in MDCK cells in vitro (Gubareva et al., 1998Down ). Infection of ferrets with virus #15 in the presence of GG167 would be required to establish if this were the case for our mutant. The phenotype of our mutant virus clearly differs from that reported for the majority of influenza GG167-resistant viruses, which turn out to have acquired mutations in both NA and HA proteins that act synergistically to confer drug resistance (Staschke et al., 1995Down ; Blick et al., 1995Down , 1998Down ; Gubareva et al., 1996Down ; McKimm-Breschkin et al., 1996Down , 1998Down ). The lower affinity of the mutant HAs for the sialic acid receptor, which offsets the decreased activity of the NA enzyme during virus release, results in attenuation throughout multi-cycle replication because viruses bind and enter cells less well. Thus these viruses do not attain wild-type titres even at late times after infection, whereas our mutant #15 does (Fig. 4Up). In summary, using traditional methods for isolating NA mutants, concomitant changes in HA are likely to be selected. Indeed, it was found that HA mutants were the first to arise during GG167 selection (Blick et al., 1998Down ). In contrast, the reverse genetics procedure described here allows the introduction of changes in NA without additional changes in HA. Sequence comparisons of the entire HA open reading frames of virus NA6 and virus #15 have shown that there were no additional changes selected in the HA protein in the transfectant virus.

The mutations in the NA protein of BYNASacI at residues 393 and 394 are located in the head region of the enzyme (Burmeister et al., 1992Down ). Some natural isolates show sequence variation in this area. For example at amino acid 397 a histidine in B/Beijing is changed to proline in B/Yamagata NA (Fig. 1b)Up (Burmeister et al., 1993Down ). That this does not result in any loss of enzyme activity is not surprising since during natural evolution of influenza B virus strains, attenuating mutations are unlikely to be selected. However, it is likely that engineered mutations could affect the surrounding structure and compromise enzyme activity. Indeed, using site-directed mutagenesis of NA proteins expressed from recombinant SV40 viruses, Air et al. (1990)Down showed that single amino acid changes at residues 251, 364 or 368 all decreased NA enzyme activity. The work presented here offers the ability to examine the effects of those and other mutations in NA on the phenotype of the virus. It will also enable the study of isolated mutations with the potential to confer resistance to NA inhibitors, as well as allowing insight into the role of the NB protein.


   Acknowledgments
 
The University of Reading Research Endowment Fund supported this work. We also thank Glaxo-Wellcome for supplying 4-guanidino-Neu5Ac2en (GG-167), Dr Thomas Moran, Mount Sinai Medical Centre, New York, USA for sharing anti-NA monoclonal antibodies, Dr Graeme Laver, Australian National University, Canberra for the generous gift of influenza B/HK/73 HG virus cores used to isolate polymerase proteins and Dr Dee Gor, Glaxo-Wellcome, Stevenage, UK for sequencing the NA6 and mutant #15 HA genes.


   References
TOP
Abstract
Introduction
Methods
Results and Discussion
References
 
Air, G. M., Laver, W. G., Luo, M., Stray, S. J., Legrone, G. & Webster, R. G. (1990). Antigenic sequence, and crystal variation in influenza B neuraminidase. Virology 177, 578-587.[Medline]

Barclay, W. S. & Palese, P. (1995). Influenza B viruses with site-specific mutations introduced into the HA gene. Journal of Virology 69, 1275-1279.[Abstract]

Betakova, T., Nermut, M. V. & Hay, A. J. (1996). The NB protein is an integral component of the membrane of influenza B virus. Journal of General Virology 77, 2689-2694.[Abstract/Free Full Text]

Bilsel, P., Castrucci, M. R. & Kawaoka, Y. (1993). Mutations in the cytoplasmic tail of influenza A virus neuraminidase affect incorporation into virions. Journal of Virology 67, 6762-6767.[Abstract/Free Full Text]

Blick, T. J., Tiong, T., Sahasrabudhe, A., Varghese, J. N., Colman, P. M., Hart, G. J., Bethell, R. C. & McKimm-Breschkin, J. L. (1995). Generation and characterisation of an influenza virus neuraminidase variant with decreased sensitivity to the neuraminidase specific inhibitor 4-guanadino-Neu5Ac2en. Virology 214, 475-484.[Medline]

Blick, T. J., Sahasrabudhe, A., McDonald, M., Owens, I. J., Morley, P. J., Fenton, R. J. & McKimm-Breschkin, J. L. (1998). The interaction of neuraminidase and hemagglutinin mutations in influenza virus in resistance to 4-Guanidino-Neu5Ac2en. Virology 246, 95-103.[Medline]

Brassard, D. L., Leser, G. P. & Lamb, R. A. (1996). Influenza B virus NB glycoprotein is a component of virions. Virology 220, 350-360.[Medline]

Burmeister, W. P., Ruigrock, R. W. H. & Cusack, S. (1992). The 2·2 resolution crystal structure of influenza B neuraminidase and its complex with sialic acid. EMBO Journal 11, 49-56.[Medline]

Burmeister, W. P., Baudin, F., Cusack, S. & Ruigrok, R. W. H. (1993). Comparison of structure and sequence of influenza B/Yamagata and B/Beijing neuraminidase shows a conserved head but much greater variability in the stalk and NB protein. Virology 192, 683-686.[Medline]

Castrucci, M. R. & Kawaoka, Y. (1993). Biologic importance of stalk length in influenza A virus. Journal of Virology 67, 759-764.[Abstract/Free Full Text]

Chizmakov, I., Ogden, D., Betakova, T., Phillips, A. & Hay, A. (1998). Cl- and H+ permeability formed by expression of NB protein from influenza B virus. Biophysical Journal 74, A319.

Colacino, J. M., Chirgadze, N. Y., Garman, E., Murit, G., Loncharich, R. J., Baxter, A. J., Staschke, K. A. & Laver, W. G. (1997). A single sequence change destabilizes the influenza virus neuraminidase. Virology 236, 66-75.[Medline]

Coleman, P. M. (1989). Neuraminidase: enzyme and antigen. In The Influenza Viruses, pp. 175-210. Edited by R. M. Krug. New York: Plenum Press.

Egorov, A., Brandt, S., Sereinig, S., Romanova, J., Ferko, B., Katinger, D., Grassauer, A., Alexandrova, G., Katinger, H. & Muster, T. (1998). Transfectant influenza A viruses with long deletions in the NS1 protein grow efficiently in Vero cells. Journal of Virology 72, 6437-6441.[Abstract/Free Full Text]

Enami, M. & Palese, P. (1991). High efficiency formation of influenza virus transfectants. Journal of Virology 65, 2711-2731.[Abstract/Free Full Text]

Enami, M., Luytjes, W., Krystal, M. & Palese, P. (1990). Introduction of site-specific mutations into the genome of influenza virus. Proceedings of the National Academy of Sciences, USA 87, 3802-3805.[Abstract/Free Full Text]

Grassauer, A., Egorov, A. Y., Ferko, B., Romanova, I., Katinger, H. & Muster, T. (1998). A host restriction-based selection system for influenza haemagglutinin transfectant viruses. Journal of General Virology 79, 1405-1409.[Abstract]

Gubareva, L. V., Bethell, R., Hart, G. J., Murti, K. G., Penn, C. R. & Webster, R. G. (1996). Characterisation of mutants of influenza A virus selected with the neuraminidase inhibitor 4-guanadino-Neu5Ac2en. Journal of Virology 70, 1818-1827.[Abstract]

Gubareva, L. V., Matrosovich, M. N., Brenner, M. K., Bethell, R. C. & Webster, R. G. (1998). Evidence for zanamavir resistance in an immunocompromised child infected with influenza B virus. Journal of Infectious Diseases 178, 1257-1262.[Medline]

Horimoto, T. & Kawaoka, Y. (1994). Reverse genetics provides direct evidence for a correlation of haemagglutinin cleavability and virulence of an avian influenza A virus. Journal of Virology 68, 3120-3128.[Abstract/Free Full Text]

Lamb, R. A. & Krug, R. M. (1996). Orthomyxoviridae: the viruses and their replication. In Fields Virology, pp. 1353-1396. Edited by B. N. Fields, D. M. Knipe & P. M. Howley. Philadelphia: Lippincott–Raven.

Li, S. Q., Schulman, J. L., Moran, T., Bona, C. & Palese, P. (1992). Influenza A virus transfectants with chimaeric haemagglutinins containing epitopes from different subtypes. Journal of Virology 66, 399-404.[Abstract/Free Full Text]

Li, S. Q., Schulman, J., Itamura, S. & Palese, P. (1993). Glycosylation of neuraminidase determines the neurovirulence of influenza A/WSN/33 virus. Journal of Virology 67, 6667-6673.[Abstract/Free Full Text]

Li, S. Q., Xu, M. L. & Coelingh, K. (1995). Electroporation of influenza virus ribonucleoprotein complexes for the rescue of nucleoprotein and matrix genes. Virus Research 37, 153-161.[Medline]

Luo, G. X., Bergmann, M., Garcia-Sastre, A. & Palese, P. (1992). Mechanism of attenuation of a chimaeric influenza A/B transfectant virus. Journal of Virology 66, 4670-4685.

Luo, G. X., Chung, J. & Palese, P. (1993). Alterations of the stalk of the influenza virus neuraminidase – deletions and insertions. Virus Research 29, 141-153.[Medline]

McKimm-Breschkin, J. L., McDonald, M., Blick, T. J. & Colman, P. M. (1996). Mutation in the influenza virus neuraminidase gene resulting in decreased sensitivity to the neuraminidase inhibitor 4-guanadino-Neu5Ac2en leads to instability of the enzyme. Virology 225, 240-242.[Medline]

McKimm-Breschkin, J. L., Sahasrabudhe, A., Blick, T. J., McDonald, M., Colman, P. M., Hart, G. J., Bethell, R. C. & Varghese, J. N. (1998). Mutations in a conserved residue in the influenza virus neuraminidase active site decreases sensitivity to Neu5Ac2en-derived inhibitors. Journal of Virology 72, 2456-2462.[Abstract/Free Full Text]

Muster, T., Subbarao, E. K., Enaimi, M., Murphy, B. R. & Palese, P. (1991). An influenza A virus containing influenza B virus 5' and 3' non-coding regions on the neuraminidase gene is attenuated in mice. Proceedings of the National Academy of Sciences, USA 88, 5177-5181.[Abstract/Free Full Text]

Palese, P., Tobita, K., Ueda, M. & Compans, R. W. (1974). Characterisation of temperature sensitive influenza virus mutants defective in neuraminidase. Virology 61, 397-410.[Medline]

Percy, N., Barclay, W. S., Garcia-Sastre, A. & Palese, P. (1994). Expression of a foreign protein by influenza A virus. Journal of Virology 68, 4486-4492.[Abstract/Free Full Text]

Potier, M., Mameli, L., Belisle, M., Dallaire, L. & Melancon, S. B. (1979). Fluorimetric assay of neuraminidase with a sodium (4-methylumbelliferyl-{alpha}-d-N-acetylneurminate) substrate. Analytical Biochemistry 94, 287-296.[Medline]

Shibata, S., Yamamoto-Goshima, F., Maeno, K., Hanaichi, T., Fukjita, Y., Nakajima, K., Imai, M., Komatsu, T. & Sugiura, S. (1993). Characterisation of a temperature-sensitive influenza B virus mutant defective in neuraminidase. Journal of Virology 67, 3264-3273.[Abstract/Free Full Text]

Staschke, K. A., Coalcino, J. M., Baxter, A. J., Air, G. M., Bansal, A., Hornback, W. J., Monroe, J. E. & Laever, W. G. (1995). Molecular basis for the resistance of influenza viruses to 4-Guanidino-Neu5Ac2en. Virology 214, 642-646.[Medline]

Stevens, M. & Barclay, W. S. (1998). The N-terminal extension of the influenza B virus nucleoprotein is not required for nuclear accumulation or the expression and replication of a model RNA. Journal of Virology 72, 5307-5312.[Abstract/Free Full Text]

Subbarao, E. K., Kawaoka, Y. & Murphy, B. R. (1993). Rescue of an influenza A virus wild-type PB2 gene and a mutant derivative bearing a site-specific temperature-sensitive and attenuating mutation. Journal of Virology 678, 7223-7228.

Sunstrom, N. A., Premkumar, L. S., Premkumar, A., Ewart, G., Cox, G. B. & Gage, P. W. (1996). Ion channels formed by NB, an influenza B virus protein. Journal of Membrane Biology 150, 127-132.[Medline]

Tai, C. Y., Escarpe, P. A., Sidwell, R. W., Williams, M. A., Lew, W., Wu, H., Kim, C. U. & Mendell, D. B. (1998). Characterization of human influenza virus variants selected in vitro in the presence of the neuraminidase inhibitor GS4071. Antimicrobial Agents and Chemotherapy 42, 3234-3241.[Abstract/Free Full Text]

Von Itzstein, M., Wu, W. Y., Kok, G. B., Pegg, M. S., Dyason, J. C., Jin, B., Phan, T. V., Smythe, M. L., White, H. F., Oliver, S. W., Colman, P. M., Varghese, J. N., Ryan, D. M., Woods, J. M., Bethell, R. C., Hotham, V. J., Cameron, J. M. & Penn, C. R. (1993). Rational design of potent sialidase-based inhibitors of influenza-virus replication. Nature 363, 418-423.[Medline]

Ward, T., Pipkin, P. A., Clarkson, N. A., Stone, D. M., Minor, P. D. & Almond, J. W. (1994). Decay accelerating factor CD55 is identified as the receptor for echovirus 7 using CELICS, a rapid immune-focal cloning method. EMBO Journal 13, 5070-5074.[Medline]

Yamamoto-Goshima, F., Maeno, K., Morishita, T., Ueda, M., Fujita, Y., Nakajima, K. & Yoshi, S. (1994). Role of neuraminidase in the morphogenesis of influenza B virus. Journal of Virology 68, 1250-1254.[Abstract/Free Full Text]

Zheng, H. Y., Paelese, P. & Garcia-Sastre, A. (1996). Nonconserved nucleotides at the 3'-end and 5'-end of an influenza A virus RNA play an important role in viral RNA replication. Virology 217, 242-251.[Medline]

Received 9 April 1999; accepted 1 June 1999.


This article has been cited by other articles:


Home page
J. Virol.Home page
F. T. Vreede, H. Gifford, and G. G. Brownlee
Role of Initiating Nucleoside Triphosphate Concentrations in the Regulation of Influenza Virus Replication and Transcription
J. Virol., July 15, 2008; 82(14): 6902 - 6910.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via CrossRef
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Rowley, K. V.
Right arrow Articles by Barclay, W. S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Rowley, K. V.
Right arrow Articles by Barclay, W. S.
Agricola
Right arrow Articles by Rowley, K. V.
Right arrow Articles by Barclay, W. S.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
INT J SYST EVOL MICROBIOL MICROBIOLOGY J GEN VIROL
J MED MICROBIOL ALL SGM JOURNALS