|
|
||||||||
Animal: RNA Viruses |
University of Lund, Department of Cell and Molecular Biology, Section of Tumor Immunology, Sölvegatan 21, S-223 62 Lund, Sweden1
Author for correspondence: Christian Kjellman.Fax +46 46 222 9251. e-mail Christian.Kjellman{at}wblab.lu.se
| Abstract |
|---|
|
|
|---|
| Introduction |
|---|
|
|
|---|
The copy number of the HERV families varies from single copies to up to 104 copies per genome. These different copy numbers could either represent multiple integration events of the same or a closely related virus, or proviruses amplified after the original integration by, for example, retrotransposition or chromosomal rearrangements. There are indications of a negative correlation between the presence of the env gene in the provirus and the copy number, such that proviruses without env have a more retrotransposon-like structure and thereby are more amplified (Lower et al., 1996
). Even though the copy number of complete proviruses is sometimes rather limited, solitary long terminal repeats (LTRs) are more frequent. This excision of protein-coding regions from HERVs might be the result of it being harmful for an organism to carry and express functional HERVs.
The majority of the HERVs that are fixed in the population are ancient from an evolutionary point of view (at least 10100 million years old). All known HERVs are defective and cannot produce functional infectious retrovirus particles. However, all HERVs are not transcriptionally silent and different proviruses with ORFs have been reported (Lower et al., 1995
; O'Connell et al., 1984
). Moreover, retrovirus particles of HERV origin have also been reported (Lower et al., 1993
).
Using low-stringency hybridization with an ERV-9 env probe, a new HERV was identified from a glioma cDNA library (Widegren et al., 1996
). All of the endogenous retrovirus (ERV) cDNA clones isolated were polyadenylated, the longest clone being 2303 bp. The ERV was named XA34 after this cDNA clone. The clone contained the 3' end of the reverse transcriptase (RT) region, a somewhat truncated endonuclease (IN) region and only a short fragment of a transmembrane (TM) region. Southern blot analysis demonstrated that XA34 belongs to a family of HERVs with approximately 16 members (full length or close to full length) in the human genome. XA34-related elements exist in all Old World monkeys investigated. Southern blot hybridizations using an XA34 pol probe revealed a distinct but rather weak signal from a New World monkey. If this is genuine, it indicates that the first XA34 was incorporated into the primate genome more than 60 million years ago (Arnason et al., 1996
).
We previously published sequence data from five members of this family (Widegren et al., 1996
), and we now provide data from another five closely related elements. From the human genome project, it was possible to identify two large genomic clones that contain XA34-related proviruses. These proviruses are described and characterized in detail in this paper.
| Methods |
|---|
|
|
|---|
Accession numbers.
Cloning.
To identify fragments from XA34-related proviruses, PCR amplification from male genomic DNA was performed for 2030 cycles with a thermal profile of 95 °C for 30 s, 50 °C for 60 s and 72 °C for 45 s. The reaction mixture (20 µl) contained 0·1 µg of each of primers 593 (5' CGATGATCAACTATTCATAGATGG 3') and 2793 (5' TGGTGAGAGCTATGAGTTCTGC 3'), 100 ng total DNA, 2·5 mM MgCl2, 2 µM dNTPs, 0·5 µM
-35S-labelled dATP, standard buffer and 1 U Ampli-Taq polymerase (Perkin-Elmer Cetus). The PCR products were separated on an 8% wedge-shaped denaturing sequencing gel and detected by autoradiography. To recover the DNA from the dried sequencing gel, a gel slice containing the DNA fragment was excised and rehydrated in TE buffer. The sample was boiled for 10 min and used for re-amplification with the same primers under the PCR conditions described above. The amplification efficiency was increased by using 20 µM instead of 2 µM dNTPs and the re-amplified fragments were cloned into the pT7blue vector (Novagen) and sequenced.
Computer analysis.
The Wisconsin package version 9.1-unix (Genetics Computer Group, Madison, WI, USA) (Devereux et al., 1984
) was used for DNA sequence analysis. The database used for NetBlast homology searches was a continuously updated version of the GenBank nucleotide database. Alignments were made primarily with the PILEUP and LINEUP programs of the GCG package. Phylogeny was analysed with a UNIX version of PAUP (Swofford, 1992
). Trees were constructed with a heuristic tree-search and bootstrap analysis for 1000 replications with the parsimony optimality criterion by using PAUP and the trees were displayed with DRAWGRAM of the PHYLIP software package (Felsenstein, 1993
). Percentage identity was determined by using FASTA of the GCG package. The TFSEARCH and MOTIF programs were used with a threshold score of 85·0 to search the on-line TRANSFAC database (Heinemeyer et al., 1998
) for potential transcription factor-binding sites.
Southern blot analysis.
The pol fragments of 155156 bp from XA39, XA40, XA41 and XA42 were used for Southern blot analysis. These pol probes were labelled with [
-32P]dCTP by means of PCR from cloned material. The labelling reactions (20 µl) contained 3 ng template, 10 ng primer 593, 50 µM each of dATP, dTTP and dGTP, 15 µM [
-32P]dCTP, 2·5 mM MgCl2, PCR buffer (Perkin-Elmer Cetus) and 1 U Ampli-Taq polymerase (Perkin-Elmer Cetus). The reactions were run for six cycles of 94 °C for 60 s, 54 °C for 60 s and 72 °C for 4 min.
Total genomic DNA from human, chimpanzee (Pan troglodytes), orangutan (Pongo pygmaeus), squirrel monkey (Saimiri sciureus), macaque (Macaca fascicularis) and rat (Rattus norvegicus) was digested with PstI and separated on a 0·7% agarose gel and the resultant DNA was vacuum-blotted to a Biodyne B membrane (PALL). Hybridization was carried out overnight in Rapid Hybridization solution (Amersham) at 65 °C. The filter was washed in several steps with decreasing concentrations of SSC/SDS and an increasing temperature. The final washing conditions were 1x SSC0·5% SDS at 65 °C for 90 min.
| Results |
|---|
|
|
|---|
|
|
|
The first of the two XA34-related elements identified is contained within a 177 kb genomic clone (accession number Z95126; bases 4453051154) isolated from human chromosome Xq21.1Xq21.3. Of the newly identified HERVs, XA42 contains the most similar pol region, exhibiting 90% identity over the region analysed. When the genomic clone was mapped by using PstI, the predicted fragment corresponding to the pol probe shown in Fig. 2
was 2224 bp in length. As this virus is located on the X chromosome, it would be expected that this probe would result in a stronger band when hybridizing to female rather than male DNA. Such a band can be observed at 2·2 kb, as shown in Fig. 2
. When referring to base positions in this HERV, base 44530 in the genomic clone (Z95126) is denoted as base 1.
The second genomic clone (accession number AC000378), of 133 kb, was isolated from human chromosome 11p15.5. This clone contains an XA34-like HERV situated between bases 89430 and 95587, with a pol sequence that is 100% identical to XA41 over the region analysed. Base 89430 in clone AC000378 is denoted as base 1 in this HERV. On mapping the genomic clone with PstI, the predicted fragment corresponding to the pol probe shown in Fig. 2
was found to be 3485 bp in length. A human Krüppel-related zinc finger gene, ZNF195 (accession number AF003540; Hussey et al., 1997
), was found to be located upstream of the HERV; the longest ZNF195 expressed sequence tag (EST) identified from GenBank (accession number AA505095) was found to terminate 243 bp upstream of this HERV element with a poly(A) tail. ESTs terminating within the HERV sequence, and thereby representing possible read-through transcripts from ZNF195, have also been identified (C. Kjellman & B. Widegren, unpublished results).
A schematic alignment of the two XA34-like HERVs, XA34 and XA38 is shown in Fig. 3
. Further analyses of different regions in the two XA34-related HERVs are described below. Within the genomic clone Z95126, it was possible to identify two similar (89% identical) 450 bp potential LTR regions separated by 5·7 kb and organized as direct repeats (positions 1453 and 61676614). Similarly, in the second genomic clone, AC000378, it was also possible to identify two direct repeats (435 bp) sharing 90% identity and separated by 5·3 kb (positions 1436 and 57096146). In clone Z95126, a direct repeat of 5 bp was located directly upstream of the potential 5' LTR and downstream of the potential 3' LTR, thus delineating the boundaries of the HERV (Fig. 4
). The alignment of these LTR regions in Fig. 4
demonstrates the loss of the dinucleotides AA at the 5' end and TT at the 3' end from the HERVs as a result of processing during the integration event (Temin, 1981
). There is also a short (5 bp) inverted repeat starting with the nucleotides TG at the ends of the potential LTRs, as underlined in Fig. 4
. Because of the low sequence similarity to other characterized LTRs, it is not feasible to use homology alone to define different regions of the potential LTRs. However, it is possible to identify the TATA box (at base 340 in Fig. 4
), the poly(A) signal (at base 410 in Fig. 4
) and clustered potential sites for binding of transcription factors such as Sp1, GATA, AML-1a, STATx, CREB, cEBP, AP-4 and AP-1 (data not shown) in the LTR-like regions. The junction between the R and U5 sequences is located at the polyadenylation site 1625 bp downstream of the poly(A) signal and the U3R junction is found at the CAP site 2030 bp downstream of the TATA box (Guntaka, 1993
). The potential U3 regions from these two HERVs share very little sequence similarity, whereas the potential R and U5 regions exhibit a high degree of identity (75%) (Fig. 4
).
|
|
Downstream from the 5' LTRs, both HERV-Fa and HERV-Fb have potential leader/gag regions (HERV-Fa, bases 4602408; HERV-Fb, bases 4342435) of 2 kb. HERV-Fa and HERV-Fb share similarity (70% nucleotide identity) over the complete gag region. However, at the nucleotide level, it is very difficult to align accurately the first 1·5 kb after the LTR of HERV-Fa or HERV-Fb with the gag regions of known retroviruses or retrovirus sequences. The final 0·5 kb of the gag region is more similar (55% nucleotide identity) to RTVLH-RGH2. However, the deduced amino acid sequences of the complete capsid (CA) region (region I in Fig. 3
) of HERV-Fa (bases 14402199) and HERV-Fb (bases 14642220) were aligned over 267 amino acids with the corresponding regions of known HERVs. Only a single maximum-parsimony tree was reconstructed (Fig. 5a
) following 1000 bootstrap replications using the heuristic tree search. This tree groups the two HERV-Fs together and demonstrates that the HERV-H family, as represented by RTVL-H2 and RTVLH-RGH2, is the most closely related ERV family. Over the CA region, the amino acid identity between HERV-Fa and HERV-Fb is 63% and it is 35% between RTVL-H2 and HERV-Fa. Within the CA region in both HERV-Fa and HERV-Fb, a conserved major homology region was identified with 50% (HERV-Fa) and 35% (HERV-Fb) amino acid identity to the MuLV major homology region (Strambio-de-Castillia & Hunter, 1992
; Zlotnick et al., 1998
). Immediately after the CA region, both HERV-Fa and HERV-Fb contain lysine-rich basic sequences with two conserved zinc-binding motifs (CX2CX4HX4C). These are characteristic of potential nucleic acid-binding protein (NC) regions. The coding potential of the HERV-Fa and HERV-Fb gag regions is disrupted by stop codons and introduced frame-shift mutations (Fig. 6
).
|
|
HERV-Fa and HERV-Fb share 80% sequence identity (at the DNA level) in the RT gene; this represents the most conserved genetic region within the retroviruses. A maximum-parsimony tree (Fig. 5c
) was reconstructed after a heuristic tree search and 1000 bootstrap replications with the aligned sequences of 651 amino acids spanning part of the RT region and part of the IN region (region III in Fig. 3
), and this tree clearly groups HERV-Fa, HERV-Fb and XA34 together and separates them from the RTVLH-RGH family. Over ~205 amino acids in the C terminus of the conserved RT, there is approximately 3842% amino acid identity between the HERV-Fs and XA34 and RTVLH-RGH1 (Table 2
). The amino acid identity between the HERV-Fs, HUMER4-1, ERV9, HERV-W and RTVLH-RGH1 is summarized in Table 2
. HERV-Fa, HERV-Fb, XA34 and XA38 all carry large deletions that result in somewhat truncated C-terminal portions of the IN gene and a truncation (HERV-Fa) or deletion (HERV-Fb, XA34 and XA38) of the surface protein (SU) gene in the env region. However, given that the truncations observed in the four different HERVs are not in exactly the same position within the IN gene (300 bp variation) (Fig. 3
), these are probably due to independent events. HERV-Fa has the deletion at position 5034 and HERV-Fb has the deletion at position 5150. There are no ORFs that have the potential to encode functional proteins within the RT or truncated IN regions (Fig. 6
).
|
The Southern blot analysis indicates the presence of HERV-F-related elements in the genome of a New World primate (squirrel monkey) (Fig. 2b
). One means of identifying the time at which the ERV was integrated is to analyse the two LTRs of a specific provirus and compare the divergence between these two LTRs and relate it to the divergence of other cellular genes from different species (Dangel et al., 1995
). In order to be able to do this, one has to assume that the LTRs of a particular ERV have evolved independently since the time of integration. One also has to assume that the LTRs were identical when the retrovirus was originally integrated. Analysis of the LTRs of HERV-Fa shows that there are 36 base pair exchanges in 2x442 bp and 40 base pair exchanges in 2x433 bp in HERV-Fb. This gives an approximate divergence of 0·041 base pair exchanges per position for HERV-Fa and 0·046 base pair exchanges per position for HERV-Fb. If the same calculations are made for the LTRs of HERV-K (C4) (Dangel et al., 1994
, 1995
), a divergence of 0·039 base pair exchanges per position (42 bp exchanges in 2x538 bp) is obtained. The time for the integration of HERV-K has been estimated to be just after the split between the New World and Old World primates, as based on the divergence of the short intron 9 of the C4 gene (Dangel et al., 1995
). The divergence of this marker between human and macaque (Macaca mulatta) is approximately 0·029 base pair exchanges per position (24 bp exchanges in 2x412 bp) and that between human and cotton top tamarin (Sanguinus oedipus), a New World monkey, is approximately 0·053 base pair exchanges per position (43 bp exchanges in 2x409 bp). If this approximation was widened to include the HERV-Fs, it would indicate that HERV-K (C4) and the HERV-Fs were integrated at approximately the same time, i.e. after the split of the New and Old World monkeys. However, it should be stressed that there are no guarantees of equal mutation rates in different HERV integrations.
| Discussion |
|---|
|
|
|---|
The LTRs of the HERV-Fs were identified and found to share no sequence similarity to LTRs of other known HERVs. The LTRs of HERV-Fa differ strongly from HERV-Fb within the 5' region (potential U3) but are more similar within the 3' region (R and U5). A high degree of variation in the U3 region, particularly in the enhancer sequences, has been demonstrated in other retrovirus families (Majors, 1990
). Given that the LTRs of HERV-Fa and HERV-Fb share very little sequence similarity in U3, these two proviruses are likely to be the result of two separate germline infections of distinct but related retroviruses. This is also supported by the fact that there is no sequence similarity between the flanking regions of the two HERV-Fs, clearly demonstrating that these proviruses are not the result of a gene amplification.
The HERV-F gag genes differ strongly from other known gag genes; however, the potential CA gene and conserved zinc-binding motifs of a lysine-rich potential NC gene were identified in both HERV-Fs. These gene products usually represent the most conserved proteins of the gag region (McClure et al., 1988
). It was found that the HERV-Fs and the related XA34 and XA38 all have deletions within the C-terminal portion of the IN gene and the N-terminal portion of the SU gene. The fact that these deletions have not taken place at exactly the same location in each gene indicates that these deletions have occurred as separate events that for some reason have been directed towards this particular region. One can speculate that these deletions took place before the integration into the germline, thus facilitating the retroviruses in becoming endogenous. It is also possible that the deletions took place after integration, thereby silencing both the IN and the env genes. The truncation of the env gene gives the HERV a more retrotransposon-like structure. Except for an ORF spanning the PR region of HERV-Fb, the HERV-Fs were not found to contain any longer ORFs within the gag, pol or env regions.
HERV-Fa and HERV-Fb can be grouped together by phylogenetic analysis of their capsid, protease, polymerase and transmembrane protein regions. These analyses and the rather low degree of similarity in RT demonstrate that they are clearly separated from other known HERVs, the HERV-H family being their closest relative. The phylogeny of the different regions follows a similar pattern, in that neither of the two HERV-Fs shows any sign of recombination with other HERV families. We have discussed previously a possible recombination between XA34 and ERV-9, since the region upstream of the XA34 Alu is rather similar to the ERV-9 env, but here we also included the env region located downstream of the Alu in the analyses and we cannot conclude that such a recombination has occurred.
Southern blot hybridization using pol probes from different HERV-F-related proviruses demonstrates the presence of approximately 16 HERV-F family members in the human genome. Database analysis of genomic sequences also revealed a number of elements that contain just HERV-F-like LTRs and gag regions (e.g. accessions Z86001, Z83745 and AC002416). Therefore, it is probably correct to assume that the HERV-F family, in common with many other ERV families, contains a large number of truncated HERV remnants dispersed over the genome. The 16 members identified by Southern blot hybridization define the number of pol-containing HERV-F-related elements in the genome.
Southern blot hybridization of XA34-related elements demonstrated the presence of these HERVs in all Old World primate samples analysed. However, it was also possible to detect HERV-F bands in New World primates, e.g. XA42 (Fig. 2b
), therefore suggesting that the first integration took place more than 60 million years ago (Arnason et al., 1996
). Of course, it is also possible that the hybridization to the New World primate DNA reflects cross-hybridization to the more conserved pol regions of unrelated proviruses. However, the absence of signal from the hybridization to rat DNA, which carries many C-type ERVs, is an indication of a rather high specificity of the hybridization. The specificity is also supported by the fact that cross-hybridization to the HERV-H family, which is the most closely related family, with approximately 1000 members (Mager & Henthorn, 1984
), would be expected to give a much larger number of bands than the relatively small number detected with the XA39 and XA42 probes. We also tried to relate the divergence between the 5' and 3' LTRs of the HERV-F family with the divergence of the HERV-K (C4) LTRs and that of the short intron 9 of the C4 gene (Dangel et al., 1995
). The time of integration for HERV-K was estimated to be just after the split between the New World and Old World primates (Dangel et al., 1995
). Our analyses indicated that the HERV-F LTRs and HERV-K (C4) LTRs have the same degree of divergence, indicating that these HERVs were integrated at about the same time. This calculation contradicts the interpretation of the Southern blot analysis, as this indicates that the HERV-Fs were integrated before the split between the New World and Old World primates. However, it should be remembered that there is an inevitable degree of uncertainty when calculating rates of divergence, particularly over such short genetic regions, and that there are no guarantees of equal mutational rates in the different HERV elements. There is of course also the possibility of cross-hybridization between conserved pol regions of different retrovirus origin in Southern blot analysis. In order to be able to determine with absolute certainty whether the HERV-F family is present in New World primates, the potential elements should be cloned and sequenced.
| Acknowledgments |
|---|
| Footnotes |
|---|
| References |
|---|
|
|
|---|
Cianciolo, G. J., Copeland, T. D., Oroszlan, S. & Snyderman, R. (1985). Inhibition of lymphocyte proliferation by a synthetic peptide homologous to retroviral envelope proteins. Science 230, 453-455.
Dangel, A. W., Mendoza, A. R., Baker, B. J., Daniel, C. M., Carroll, M. C., Wu, L. C. & Yu, C. Y. (1994). The dichotomous size variation of human complement C4 genes is mediated by a novel family of endogenous retroviruses, which also establishes species-specific genomic patterns among Old World primates. Immunogenetics 40, 425-436.[Medline]
Dangel, A. W., Baker, B. J., Mendoza, A. R. & Yu, C. Y. (1995). Complement component C4 gene intron 9 as a phylogenetic marker for primates: long terminal repeats of the endogenous retrovirus ERV-K(C4) are a molecular clock of evolution. Immunogenetics 42, 41-52.[Medline]
Devereux, J., Haeberli, P. & Smithies, O. (1984). A comprehensive set of sequence analysis programs for the VAX. Nucleic Acids Research 12, 387-395.
Felsenstein, J. (1993). PHYLIP (phylogeny inference package) version 3.5c. Distributed by the author. Department of Genetics, University of Washington, Seattle, WA, USA.
Guntaka, R. V. (1993). Transcription termination and polyadenylation in retroviruses. Microbiological Reviews 57, 511-521.
Heinemeyer, T., Wingender, E., Reuter, I., Hermjakob, H., Kel, A. E., Kel, O. V., Ignatieva, E. V., Ananko, E. A., Podkolodnaya, O. A., Kolpakov, F. A., Podkolodny, N. L. & Kolchanov, N. A. (1998). Databases on transcriptional regulation: TRANSFAC, TRRD and COMPEL. Nucleic Acids Research 26, 362-367.
Hussey, D. J., Parker, N. J., Hussey, N. D., Little, P. F. & Dobrovic, A. (1997). Characterization of a KRAB family zinc finger gene, ZNF195, mapping to chromosome band 11p15.5. Genomics 45, 451-455.[Medline]
Larsson, E., Kato, N. & Cohen, M. (1989). Human endogenous proviruses. Current Topics in Microbiology and Immunology 148, 115-132.[Medline]
Lower, R., Boller, K., Hasenmaier, B., Korbmacher, C., Muller-Lantzsch, N., Lower, J. & Kurth, R. (1993). Identification of human endogenous retroviruses with complex mRNA expression and particle formation. Proceedings of the National Academy of Sciences, USA 90, 4480-4484.
Lower, R., Tonjes, R. R., Korbmacher, C., Kurth, R. & Lower, J. (1995). Identification of a Rev-related protein by analysis of spliced transcripts of the human endogenous retroviruses HTDV/HERV-K. Journal of Virology 69, 141-149.[Abstract]
Lower, R., Lower, J. & Kurth, R. (1996). The viruses in all of us: characteristics and biological significance of human endogenous retrovirus sequences. Proceedings of the National Academy of Sciences, USA 93, 5177-5184.
McClure, M. A., Johnson, M. S., Feng, D. F. & Doolittle, R. F. (1988). Sequence comparisons of retroviral proteins: relative rates of change and general phylogeny. Proceedings of the National Academy of Sciences, USA 85, 2469-2473.
Maeda, N. (1985). Nucleotide sequence of the haptoglobin and haptoglobin-related gene pair. The haptoglobin-related gene contains a retrovirus-like element. Journal of Biological Chemistry 260, 6698-6709.
Mager, D. L. & Freeman, J. D. (1987). Human endogenous retroviruslike genome with type C pol sequences and gag sequences related to human T-cell lymphotropic viruses. Journal of Virology 61, 4060-4066.
Mager, D. L. & Henthorn, P. S. (1984). Identification of a retrovirus-like repetitive element in human DNA. Proceedings of the National Academy of Sciences, USA 81, 7510-7514.
Majors, J. (1990). The structure and function of retroviral long terminal repeats. Current Topics in Microbiology and Immunology 157, 49-92.[Medline]
O'Connell, C., O'Brien, S., Nash, W. G. & Cohen, M. (1984). ERV3, a full-length human endogenous provirus: chromosomal localization and evolutionary relationships. Virology 138, 225-235.[Medline]
Ono, M., Yasunaga, T., Miyata, T. & Ushikubo, H. (1986). Nucleotide sequence of human endogenous retrovirus genome related to the mouse mammary tumor virus genome. Journal of Virology 60, 589-598.
Patience, C., Wilkinson, D. A. & Weiss, R. A. (1997). Our retroviral heritage. Trends in Genetics 13, 116-120.[Medline]
Repaske, R., O'Neill, R. R., Steele, P. E. & Martin, M. A. (1983). Characterization and partial nucleotide sequence of endogenous type C retrovirus segments in human chromosomal DNA. Proceedings of the National Academy of Sciences, USA 80, 678-682.
Repaske, R., Steele, P. E., O'Neill, R. R., Rabson, A. B. & Martin, M. A. (1985). Nucleotide sequence of a full-length human endogenous retroviral segment. Journal of Virology 54, 764-772.
Smit, A. F. (1996). The origin of interspersed repeats in the human genome. Current Opinion in Genetics and Development 6, 743-748.[Medline]
Strambio-de-Castillia, C. & Hunter, E. (1992). Mutational analysis of the major homology region of MasonPfizer monkey virus by use of saturation mutagenesis. Journal of Virology 66, 7021-7032.
Swofford, D. (1992). PAUP: phylogenetic analysis using parsimony, version 3.0s. Illinois Natural History Survey, Champaign, IL, USA.
Temin, H. M. (1981). Structure, variation and synthesis of retrovirus long terminal repeat. Cell 27, 1-3.[Medline]
Widegren, B., Kjellman, C., Aminoff, S., Sahlford, L. G. & Sjögren, H.-O. (1996). The structure and phylogeny of a new family of human endogenous retroviruses. Journal of General Virology 77, 1631-1641.
Zlotnick, A., Stahl, S. J., Wingfield, P. T., Conway, J. F., Cheng, N. & Steven, A. C. (1998). Shared motifs of the capsid proteins of hepadnaviruses and retroviruses suggest a common evolutionary origin. FEBS Letters 431, 301-304.[Medline]
Received 19 February 1999;
accepted 1 June 1999.
This article has been cited by other articles:
![]() |
S. Ohkura, M. W. Yap, T. Sheldon, and J. P. Stoye All Three Variable Regions of the TRIM5{alpha} B30.2 Domain Can Contribute to the Specificity of Retrovirus Restriction. J. Virol., September 1, 2006; 80(17): 8554 - 8565. [Abstract] [Full Text] [PDF] |
||||
![]() |
I. Laprevotte, M. Pupin, E. Coward, G. Didier, C. Terzian, C. Devauchelle, and A. Henaut HIV-1 and HIV-2 LTR Nucleotide Sequences: Assessment of the Alignment by N-block Presentation, "Retroviral Signatures" of Overrepeated Oligonucleotides, and a Probable Important Role of Scrambled Stepwise Duplications/Deletions in Molecular Evolution Mol. Biol. Evol., July 1, 2001; 18(7): 1231 - 1245. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| INT J SYST EVOL MICROBIOL | MICROBIOLOGY | J GEN VIROL |
| J MED MICROBIOL | ALL SGM JOURNALS | |