|
|
||||||||
Animal: DNA Viruses |
Virology Program, Signal Pharmaceuticals Inc., 5555 Oberlin Drive, San Diego, CA 92121, USA1
Department of Microbiology and Immunology, Indiana University School of Medicine, Indianapolis, IN 46202, USA2
The Walther Cancer Institute, Indianapolis, IN 46202, USA3
Division of Infectious Diseases, Department of Medicine, Richard L. Roudebush VA Medical Center and Indiana University School of Medicine, Indianapolis, IN 46202, USA4
Author for correspondence: Robert Kovelman.Fax +1 619 623 0870. e-mail rkovelma{at}signalpharm.com
| Abstract |
|---|
|
|
|---|
| Introduction |
|---|
|
|
|---|
A better understanding of such an association first requires a clear system of classifying HPVs. Originally, the classification of papillomaviruses into types was performed by hybridization analysis, with more detailed subtype designation being assigned on the basis of differences in restriction enzyme digestion patterns. For HPV-6, these studies led to the categorization of the genomes into a number of subtypes (Gissmann et al., 1983
; Boshart & zur Hausen, 1986
; Rando et al., 1986
). More recently, sequencing analysis has been performed on different clinical isolates or clones of HPV-6. The focus of these studies has been on certain portions of the genome, particularly parts of the upstream regulatory region (URR), which contains control elements for transcription and replication, and the coding regions for L1, L2, E6, E7 and E1
E4 (Kasher & Roman, 1988
; Farr et al., 1991
; Icenogle et al., 1991
; Rübben et al., 1992
; Yaegashi et al., 1993
; Kitasato et al., 1994
; Heinzel et al., 1995
; Roman & Brown, 1995
). On the basis of URR sequence analysis, it has been suggested that isolates of HPV-6 should be grouped into HPV-6a-related and HPV-6b-related variants (Heinzel et al., 1995
; Grassmann et al., 1996
).
Only limited sequence information is available for the E2 coding region. It is relatively divergent between the two previously sequenced HPV-6 genomes, HPV-6b (Schwarz et al., 1983
) and HPV-6a (Hofmann et al., 1995
). Thus, sequencing of the E2 coding region of genomes isolated directly from clinical samples would provide detailed, epidemiologically useful information on the relatedness of those HPVs. In addition, interest in knowing more about the sequence divergence in the E2 coding region is increased by our previous results, which showed that the E2 proteins encoded by the high-risk HPV-16 and HPV-18 are much more potent transcriptional activators than the E2 proteins encoded by the low-risk HPV-6b and HPV-11 (Kovelman et al., 1996
). In particular, we wanted to know whether the low activity of the HPV-6b E2 protein would also be found with other isolates of HPV-6. We found that the HPV genomes in the clinical isolates used for this study were clearly categorized into two groups and that the E2 proteins encoded by these two groups were both of lower activity in stimulating transcription than the E2 proteins from high-risk HPVs. Thus, this study shows that a lower level of transcriptional activation is a common property of E2 proteins from HPV-6.
| Methods |
|---|
|
|
|---|
Materials.
Plasmids.
The plasmid pSK-HPV-6vc was generated by removing the viral genome from pBR-HPV-6vc (Rando et al., 1986
) by digestion with BamHI and inserting it into the BamHI site of pBluescript SK (Stratagene). Construction of pCMV-16E2 and pCMV-6bE2 (previously named pCMV-6E2) has been described elsewhere (Kovelman et al., 1996
). The expression vector pCMV-6vcE2 was constructed in a manner such that all sequences outside the E2 coding regions in pCMV-6bE2 and pCMV-6vcE2 were identical. The reporters used to assay E2-dependent transcriptional activation (p2x2xE2BS-luc) and repression [p6bURR(promoter)-luc] have also been described previously (Kovelman et al., 1996
).
Sequencing.
The sequence of the HPV-6vc genome was determined by using appropriately spaced oligonucleotide primers with pSK-HPV-6vc as the template. In order to sequence the E2 coding region from the clinical isolates, DNA oligonucleotides with the sequences 5' AAATGGGAATGCAGTGTATGA 3' and 5' GATGTGTACACAATAAACTCA 3', which respectively hybridize to the HPV-6 genome approximately 100 base pairs upstream and 200 base pairs downstream of the E2 gene, were used to amplify a fragment by PCR with Taq polymerase, and the fragment was purified by use of the QIAquick PCR purification kit (Qiagen). This purified fragment was then used directly as the template for sequencing reactions. Sequencing of the E6/E7 region of the clinical isolates was performed in a similar manner, with DNA oligonucleotides with the sequences 5' GGTTTAAAAAATAGGAGGGACCGA 3' and 5' CCCACTGTCCTCCACCTCCTCATC 3' having been used to amplify a fragment 948 base pairs in length encompassing the E6/E7 coding regions and flanking sequences. All DNAs were sequenced at least twice on each strand. Sequencing was performed on ABI 373 or 377 automated sequencers (Perkin ElmerApplied Biosystems), with reactions and procedures being performed according to the manufacturer's instructions. All nucleotide sequence positions described are numbered according to the HPV-6b sequence.
Assays.
Transfection of C33-A cells by the calcium phosphate method and keratinocytes by lipofection was performed as described previously (Kovelman et al., 1996
). Briefly, cells were lysed 2 days after transfection and luciferase and ß-galactosidase activities were determined. Except where noted, the data shown reflect luciferase activities normalized to ß-galactosidase activities, with the results for lysates of control cells transfected with the reporter and an empty expression vector being set to a value of 1.
| Results |
|---|
|
|
|---|
|
|
|
|
HPV-6vc was originally thought to be a novel, potentially oncogenic form of HPV-6 because of its isolation from a verrucous carcinoma (Rando et al., 1986
). On the basis of its previously reported restriction enzyme digestion pattern, HPV-6vc would be considered an HPV-6a subtype (Rando et al., 1986
). As summarized in Table 1
, our sequencing results clearly demonstrate that the entire HPV-6vc genome is closely related to that of a previously sequenced clone of HPV-6a isolated from benign tissue and confirm that HPV-6vc is a member of the HPV-6a group. As shown above in support of this classification, we isolated HPV genomes from benign condylomata acuminata that were identical to that of HPV-6vc in their E2, E6 and E7 coding regions.
Transcriptional regulation by HPV-6 E2 proteins
We showed previously that the E2 proteins from HPV-6b and HPV-11 are much weaker transcriptional activators than the E2 proteins from HPV-16 or HPV-18 (Kovelman et al., 1996
). Since most of the clinical isolates we have analysed are categorized as HPV-6a, not HPV-6b, we undertook a comparison of the transcriptional regulatory activities of the HPV-6a and HPV-6b E2 proteins. We cloned the E2 coding regions from HPV-6b and, as a representative of the HPV-6a group, HPV-6vc downstream of the CMV immediate early promoter and we transfected these plasmids and an E2-dependent reporter plasmid into a genital epithelial cell line, C33-A. Using a reporter plasmid (p2x2xE2BS-luc) that we had shown previously to be sensitive in differentiating the relative activities of E2 proteins (Kovelman et al., 1996
), we found that the HPV-6a and HPV-6b E2 proteins were of roughly comparable activities (Fig. 4
). Slightly enhanced activity with the HPV-6a protein was observed with some of the amounts of input DNA tested in this transfection, but this difference in activity was very small when compared with the difference in activities between either of the HPV-6 E2 proteins and the HPV-16 E2 protein (Fig. 4
), in accordance with our previous findings from comparisons of HPV-6b and HPV-16 E2 proteins (Kovelman et al., 1996
).
|
|
|
| Discussion |
|---|
|
|
|---|
The E2 sequences in these clinical samples, originally categorized as HPV-6a on the basis of PstI digestion pattern (Roman & Brown, 1995
), fell into two groups. The sequence of one group was essentially identical to that of HPV-6b in the E2 coding region. The sequence of the E2 coding region of the other group was essentially identical to that of HPV-6vc, which we also sequenced from a previously cloned genome (Rando et al., 1986
), and it was closely related to that of a previously sequenced clone of HPV-6a (Hofmann et al., 1995
). Categorization of these clinical samples correlated with their previous grouping according to the sequence of the upstream portion of the URR (Roman & Brown, 1995
), with one exception. Although samples 1084 and 1125 were in the same group in the previous study, they are clearly distinguished into the HPV-6a and HPV-6b categories, respectively, according to their E2 sequences. This difference and related sequencing results with the cloned HPV6-W50, which has an HPV-6a PstI digestion profile but an HPV-6b E2 sequence, reveal a divergence between HPV subtype designations based on restriction digestion and those based on E2 sequences.
Chan et al. (1992)
suggested previously that designating HPV-6 subtypes on the basis of restriction enzyme digestion was inappropriate when one considered that the sequence divergence was, in fact, of the order of 1% and that the term `variant' would be more descriptive. To establish phylogenetic associations, Heinzel et al. (1995)
used the presence of a 20 bp insertion at nt 7719 to separate HPV isolates into HPV-6a variants (those containing this insertion) and HPV-6b variants (those which did not). Sequence comparisons indicated that HPV-6vc was more closely related to the previously sequenced isolate of HPV-6a than to HPV-6b. On the basis of an analysis of URR sequences and the presence or absence of the 20-mer, Grassmann et al. (1996
) have also divided HPV-6 isolates into two groups, one containing HPV-6b, HPV6-W50 and HPV6-T70 and the other containing HPV-6a and HPV-6vc. Interestingly, our E2, E6 and E7 data on these cloned genomes are consistent with this grouping.
Our data also indicate that there is no correlation between HPV-6vc-related genes and malignant progression. In fact, the E2 coding regions of eight of ten samples from condylomata acuminata fell into the same category as HPV-6vc, even though HPV-6vc was originally isolated from a carcinoma (Rando et al., 1986
). In addition, HPV6-T70, which was also isolated from malignant tissue, was found to be similar to HPV-6b according to our E2/E6/E7 sequencing, further underlining the lack of correlation between the type of lesion and the presence of particular HPV coding sequences.
This study also extends our initial observation that the HPV-6b E2 protein is less active than the HPV-16 E2 protein, both as a positive and as a negative regulator of transcription (Kovelman et al., 1996
), to a second HPV-6 E2 protein. A corollary to this finding is that a number of amino acid changes throughout the three domains of the E2 protein do not affect its activity. The E2 protein is a critical regulator of transcription and replication and any changes in its function are likely to have important consequences for the life-cycle of the virus as well as the clinical manifestation of the infection. Previously, we described a sensitive reporter system to detect a difference in activity between the E2 proteins from high-risk and low-risk HPV types (Kovelman et al., 1996
). In the current study, use of this system demonstrated that the HPV-6a E2 protein was similarly weak as a transcriptional activator in comparison with the HPV-6b E2 protein (Fig. 4
). In addition to these experiments in C33-A cells, we also assayed transcriptional activation by the two proteins in primary human keratinocytes, the normal host cell for HPVs. The HPV-6a and HPV-6b E2 proteins were virtually identical in their ability to stimulate transcription from the E2-dependent reporter in these primary cells (Fig. 6
). Thus, our previous finding that the activity of the HPV-6b E2 protein is much lower than that of E2 proteins from high-risk HPVs (Kovelman et al., 1996
) was not a result of the HPV-6b E2 having undergone a deleterious mutation in vitro. In addition, we found that the HPV-6a and HPV-6b E2 proteins were indistinguishable in their ability to repress transcription in vivo (Fig. 5
). Thus, we have demonstrated significant conservation of E2 function in HPV-6 from clinical samples, confirming the relevance in vivo of previous studies that employed the HPV-6b E2 protein as the prototype for its class. It will be of interest to extend this comparative analysis of the function of these categories of E2 protein to include its other functions, in particular its key role in controlling papillomavirus replication in conjunction with the E1 protein.
| Acknowledgments |
|---|
| Footnotes |
|---|
| References |
|---|
|
|
|---|
Boshart, M. & zur Hausen, H. (1986). Human papillomaviruses in Buschke-Löwenstein tumors: physical state of the DNA and identification of a tandem duplication in the noncoding region of a human papillomavirus 6 subtype. Journal of Virology 58, 963-966.
Chan, S. Y., Bernard, H. U., Ong, C. K., Chan, S. P., Hofmann, B. & Delius, H. (1992). Phylogenetic analysis of 48 papillomavirus types and 28 subtypes and variants: a showcase for the molecular evolution of DNA viruses. Journal of Virology 66, 5714-5725.
Chin, M. T., Hirochika, R., Hirochika, H., Broker, T. R. & Chow, L. T. (1988). Regulation of human papillomavirus type 11 enhancer and E6 promoter by activating and repressing proteins from the E2 open reading frame: functional and biochemical studies. Journal of Virology 62, 2994-3002.
Dostatni, N., Lambert, P. F., Sousa, R., Ham, J., Howley, P. M. & Yaniv, M. (1991). The functional BPV-1 E2 trans-activating protein can act as a repressor by preventing formation of the initiation complex. Genes & Development 5, 1657-1671.
Farr, A., Wang, H., Kasher, M. S. & Roman, A. (1991). Relative enhancer activity and transforming potential of authentic human papillomavirus type 6 genomes from benign and malignant lesions. Journal of General Virology 72, 519-526.
Gissmann, L., Wolnik, L., Ikenberg, H., Koldovsky, U., Schnurch, H. G. & zur Hausen, H. (1983). Human papillomavirus types 6 and 11 DNA sequences in genital and laryngeal papillomas and in some cervical cancers. Proceeding of the National Academy of Sciences, USA 80, 560-563.
Grassmann, K., Wilczynski, S. P., Cook, N., Rapp, B. & Iftner, T. (1996). HPV6 variants from malignant tumors with sequence alterations in the regulatory region do not reveal differences in the activities of the oncogene promoters but do contain amino acid exchanges in the E6 and E7 proteins. Virology 223, 185-197.[Medline]
Heinzel, P. A., Chan, S. Y., Ho, L., O'Connor, M., Balaram, P., Campo, M. S., Fujinaga, K., Kiviat, N., Kuypers, J., Pfister, H., Steinberg, B. M., Tay, S. K., Villa, L. L. & Bernard, H. U. (1995). Variation of human papillomavirus type 6 (HPV-6) and HPV-11 genomes sampled throughout the world. Journal of Clinical Microbiology 33, 1746-1754.[Abstract]
Hofmann, K. J., Cook, J. C., Joyce, J. G., Brown, D. R., Schultz, L. D., George, H. A., Rosolowsky, M., Fife, K. H. & Jansen, K. U. (1995). Sequence determination of human papillomavirus type 6a and assembly of virus-like particles in Saccharomyces cerevisiae. Virology 209, 506-518.[Medline]
Icenogle, J. P., Sathya, P., Miller, D. L., Tucker, R. A. & Rawls, W. E. (1991). Nucleotide and amino acid sequence variation in the L1 and E7 open reading frames of human papillomavirus type 6 and type 16. Virology 184, 101-107.[Medline]
Kasher, M. S. & Roman, A. (1988). Characterization of human papillomavirus type 6b DNA isolated from an invasive squamous carcinoma of the vulva. Virology 165, 225-233.[Medline]
Kitasato, H., Delius, H., zur Hausen, H., Sorger, K., Rösl, F. & de Villiers, E.-M. (1994). Sequence rearrangements in the upstream regulatory region of human papillomavirus type 6: are these involved in malignant transition? Journal of General Virology 75, 1157-1162.
Kovelman, R., Bilter, G. K., Glezer, E., Tsou, A. Y. & Barbosa, M. S. (1996). Enhanced transcriptional activation by E2 proteins from the oncogenic human papillomaviruses. Journal of Virology 70, 7549-7560.[Abstract]
Krige, D., Mills, H. R., Berrie, E. L., Doherty, N. C., Jones, D. K., Ryan, C. A., Davies, H., Myint, S., McCance, D. J., Layton, G. T. & French, T. J. (1997). Sequence variation in the early genes E1E4, E6 and E7 of human papilloma virus type 6. Virus Research 49, 187-191.[Medline]
Oft, M., Bohm, S., Wilczynski, S. P. & Iftner, T. (1993). Expression of the different viral mRNAs of human papilloma virus 6 in a squamous-cell carcinoma of the bladder and the cervix. International Journal of Cancer 53, 924-931.
Rando, R. F., Groff, D. E., Chirikjian, J. G. & Lancaster, W. D. (1986). Isolation and characterization of a novel human papillomavirus type 6 DNA from an invasive vulvar carcinoma. Journal of Virology 57, 353-356.
Roman, A. & Brown, D. (1995). Sequence variation in the extreme 5' end of the human papillomavirus type 6a long control region. Journal of Infectious Diseases 171, 697-700.[Medline]
Rübben, A., Beaudenon, S., Favre, M., Schmitz, W., Spelten, B. & Grussendorf-Conen, E.-I. (1992). Rearrangements of the upstream regulatory region of human papillomavirus type 6 can be found in both Buschke-Löwenstein tumours and in condylomata acuminata. Journal of General Virology 73, 3147-3153.
Schwarz, E., Dürst, M., Demankowski, C., Lattermann, O., Zech, R., Wolfsperger, E., Suhai, S. & zur Hausen, H. (1983). DNA sequence and genome organization of genital human papillomavirus type 6b. EMBO Journal 2, 2341-2348.[Medline]
Thierry, F. & Yaniv, M. (1987). The BPV1-E2 trans-acting protein can be either an activator or a repressor of the HPV18 regulatory region. EMBO Journal 6, 3391-3397.[Medline]
Wilczynski, S. P., Oft, M., Cook, N., Liao, S. Y. & Iftner, T. (1993). Human papillomavirus type 6 in squamous cell carcinoma of the bladder and cervix. Human Pathology 24, 96-102.[Medline]
Yaegashi, N., Xi, L., Batra, M. & Galloway, D. A. (1993). Sequence and antigenic diversity in two immunodominant regions of the L2 protein of human papillomavirus types 6 and 16. Journal of Infectious Diseases 168, 743-747.[Medline]
zur Hausen, H. (1991). Human papillomaviruses in the pathogenesis of anogenital cancer. Virology 184, 9-13.[Medline]
Received 6 April 1999;
accepted 25 May 1999.
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| INT J SYST EVOL MICROBIOL | MICROBIOLOGY | J GEN VIROL |
| J MED MICROBIOL | ALL SGM JOURNALS | |