|
|
||||||||
Animal: DNA Viruses |
Department of Human Microbiology, Sackler School of Medicine, Tel-Aviv University, Tel-Aviv 69978, Israel1
Author for correspondence: Levana Sherman.Fax +972 3 6409160. e-mail lsherman{at}post.tau.ac.il
| Abstract |
|---|
|
|
|---|
| Introduction |
|---|
|
|
|---|
The function of the HPV E2 protein in regulation of the LCR is the subject of some controversy. Initial studies have demonstrated that E2 activates transcription from the virus LCR (Phelps & Howley, 1987
; Cripe et al., 1987
; Ushikai et al., 1994
; Bouvard et al., 1994
). However, other studies have shown that in the genital HPVs, E2 represses rather than transactivates transcription from the virus early promoters (Romanczuk et al., 1990
; Bernard et al., 1989
; Tan et al., 1992
). The repression of transcription involves binding of the full-length E2 protein to E2-binding sites close to the TATA box and apparently functions by preventing binding of transcription factors required for formation of the transcription-initiation complex (Bernard et al., 1989
; Romanczuk et al., 1990
;Tan et al., 1992
, 1994
). Additional studies on the regulation of the E6 promoters of HPV-16 and HPV-18 by the homologous E2 proteins have suggested that the regulatory effect may depend on the level of E2, transactivating at a lower level and transrepressing as the level increases (Bouvard et al., 1994
; Ushikai et al., 1994
; Steger & Corbach, 1997
). Little is known about the mechanisms involved in the control of E2 protein expression. The HPV E2 protein is encoded by viral mRNAs containing multiple open reading frames (ORFs). HPV-16 expresses a variety of alternatively spliced mRNAs containing the full-length E2 ORF as an internal ORF. The majority of the E2 transcripts initiate at the p97 promoter and thus contain the E2 ORF connected via alternative splice sites to variable upstream 5' ORFs (Sherman & Alloul, 1992
). Recent translation experiments in cell-free systems and COS cells indicated that cDNAs containing the full-length E2 ORF and the related upstream ORFs of mRNA species a (880/2708), a' (880/2581) and d (226/2708) function in translation of the E2 protein, although at different efficiencies. Efficiency of translation from the d-type template was three and four times higher than that from the a- and a'-type templates, respectively. Expression from all three polycistronic templates was lower than that from a synthetic monocistronic template. Further investigation of the translation capacity of the upstream ORFs showed that the a- and a'-type templates serve for translation of E6I and mainly E7 proteins, while the d-type template functions in translation of the E6 variant, E6IV (Alloul & Sherman, 1999
). Since previous studies have established the ability of E6I and E7 proteins to function as transcriptional regulators (Shirasawa et al., 1994
; Armstrong & Roman, 1997
), the coordinated translation of these proteins with E2 could possibly affect E2-mediated transcriptional regulation of the virus LCR.
In the present study, we were interested in investigating whether the differential level of E2 protein translation from the d-, a- and a'-type mRNAs has functional consequences for the transcriptional activity of the virus LCR and whether co-translation of proteins encoded by the upstream ORFs affects E2-mediated regulation of the virus LCR.
The transcriptional activities of the polycistronic cDNAs were evaluated in transient transfection assays by using the chloramphenicol acetyltransferase (CAT) reporter gene linked to the HPV-16 LCR. The data obtained indicated that differentially spliced, E2-encoding cDNAs exerted variable levels of transrepression on the virus LCR. Transrepression activity was mainly due to E2 protein expression and correlated with the previously defined efficiencies of E2 protein translation. Low transcription-regulatory activities were also exerted by some of the 5' ORF cDNAs. The E6IV splice variant cDNA transrepressed the virus LCR while the EIC cDNA and, to a less extent, the E6I cDNA transactivated the virus LCR, thus contributing in different manners to the overall regulatory activities of the polycistronic cDNAs.
The results suggest that differential splicing within RNAs encoding E2 may regulate transcription from the virus LCR by modulating the levels of E2 protein translation and by carrying accessory ORFs for putative proteins that possess variable transcription-regulatory activities.
| Methods |
|---|
|
|
|---|
Plasmids.
|
pJS55 vectors carrying monocistronic cDNAs spanning the individual ORFs E2, E6I, E6IV, E7 and E1C were described previously (Alloul & Sherman, 1999
; Shally et al., 1996
; Sherman & Schlegel, 1996
). P. G. Fuchs (University of Cologne, Cologne, Germany) kindly provided the plasmid LCRCAT containing the HPV-16 regulatory sequences between nucleotides 7008 and 123, upstream of the CAT gene.
Cell cultures and transfections.
Cells were grown in Dulbecco's modified Eagle's medium (DMEM) supplemented with 10% foetal calf serum. Transient transfections were performed by a modified calcium phosphate method, as described previously (Sherman & Schlegel, 1996
). Canine foetal thymus (Cf2Th) cells were kindly provided by S. A. Aaronson (Mount Sinai Institute, New York, USA). C33-A carcinoma cells were kindly provided by R. Schlegel (Georgetown University, Washington, DC, USA).
CAT assays.
Cells were plated into 9 cm dishes and transfected with 2 (Cf2Th) or 6 µg (C33A) of the CAT reporter plasmid and 0·55 µg of the expression plasmids. The amount of transfected DNA was kept constant in all experiments by the addition of the parental vector DNA (pJS55). Cells were harvested 48 h later and CAT activity was assayed by the method of Gorman et al. (1982)
as described previously (Sherman et al., 1997
). The percentage of chloramphenicol acetylation was quantified by scanning the silica gel sheet on a Bio-Rad phosphorimager. CAT activity was normalized for transfection efficiency by co-transfecting a constant amount (1 µg) of a CMVß-galactosidase plasmid (ß-gal) into all tissue culture dishes. The amount of ß-galactosidase activity was determined by using O-nitrophenyl ß-d-galactopyranoside (ONPG) as a colorimetric substrate. Each experiment was performed at least three times.
RNA isolation and quantification.
Transfections for mRNA quantification were carried out simultaneously with the transfections for CAT analyses. Total RNA was isolated from the 9 cm dishes 48 h post-transfection by using the RNA/DNA protein reagent (TRI REAGENT) (Molecular Research Center) according to the manufacturer's instructions.
The amount of RNA and parameters for semi-quantitative PCR analysis of RNA were predetermined for each primer pair (Zhao et al., 1995
; Lupetti et al., 1996
). Reverse transcription was carried out as described previously (Sherman & Alloul, 1992
) in a total volume of 50 µl containing 1 µg total RNA (which was first denatured at 65 °C for 10 min and immediately chilled) and 0·3 µg/µl oligo(dT) (20-mer) as an antisense primer. The reaction mixture was incubated at 42 °C for 60 min. Following inactivation at 95 °C for 5 min, 510 µl of the cDNA product was used as a template for a PCR with the individual primer pairs as described previously (Sherman & Alloul, 1992
).
Primer pairs for detection of the various mRNAs were pJS55 969-s (5' TCCTGGGCAACGTGC 3') and the HPV-16 2930-as primer, which detects the a- and d-type mRNAs, or the HPV-16 2684-as primer, which detects the a'-type mRNA. PCRs were carried out for 28 cycles of 1 min at 94 °C, 1 min at 55 °C and 1 min at 72 °C. Detection of the human ß-actin mRNA was carried out with the primers actin-s (5' GAGGAATTCTGAGACCTTCAACACCCC 3') and actin-as (5' GAGAAGCTTGTGGCCATCTCTTGCTCGAAGTC 3') with the same parameters as described above for 18 cycles.
| Results |
|---|
|
|
|---|
|
|
Transfections were carried out with various amounts of DNA that represented molar equivalents of 0·55 µg of the E2 monocistronic control. The results shown in Fig. 4
, and additional experiments, indicated that all three E2 cDNAs exerted strong repression activity on the virus LCR, although at lower levels than that exhibited by equivalent amounts of the monocistronic E2 expression vector, pJS55-E2 (Fig. 4a
, b
). The bicistronic E6IVE2 (d-type) cDNA showed the strongest repression activity. The polycistronic E6IE7E2 (a-type) and E6IE7E1CE2 (a'-type) cDNAs showed similar repression activities, with somewhat stronger activity for the a-type cDNA (Fig. 4a
, b
). The repression activity was dose-dependent for each of the cDNA expression vectors, as described above for the E2 monocistronic control. The same order of repression was obtained with quantities of the various E2 cDNAs between 0·5 and 5 µg (Fig. 4a
, b
; data not shown). This order of repression activities of the E2 cDNAs was also observed in C33A epithelial cells transfected with the same amounts of DNA (data not shown).
|
|
|
To dissect the transcription-regulatory effects of the 5' ORFs, isogenic expression vectors containing truncated cDNAs that span the 5' ORF region (E2-truncated cDNAs) of mRNA species a, a' and d, as well as vectors carrying each of the individual ORFs contained in the respective cDNAs, were evaluated for the presence of dose-dependent transcription-regulatory effects towards the virus LCR.
Comparing the activities of the E2-truncated cDNAs with those of the E2-containing cDNAs showed marked differences in the regulatory activities (Fig. 7
). These were exhibited in Cf2Th and C33A cells. The d-type truncated cDNA, E6IVE2(N), like the related E2-containing cDNA (E6IVE2), showed negative regulatory activity towards the virus LCR. However, this activity was much lower than that exhibited by the E2 ORF-containing cDNA (10 times lower) (Fig. 7a
, b
). Repression by the truncated d-type cDNA was dose-dependent, increasing with larger amounts of the plasmid. These results suggested that the E6IV protein encoded by the d-type truncated cDNA can function in repression of the virus LCR. Since the d-type truncated DNA contains sequences encoding part of the N-terminal domain of E2 (nucleotides 27552891), which could possibly function in transcriptional repression of the virus LCR, we tested the activity of another E6IV expression vector that lacks the E2 N-terminal domain (Sherman & Schlegel, 1996
). Results obtained from these assays showed comparable levels of transcriptional repression from the E6IVE2(N) and the E6IV vectors, both of which were dose-dependent (data not shown), supporting the conclusion that the E6 splice variant E6IV functions as a transcriptional repressor of the virus LCR and that sequences in the N terminus of E2 (encoded by nucleotides 27552891) have no transcription-regulatory activity towards the virus LCR. The latter conclusion is in agreement with previous reports locating the E2 regulatory activity between nucleotides 2931 and 3130 (Giri & Yaniv, 1988
).
|
Assessing the transcription-regulatory activities of the individual ORFs contained in the a-type cDNA, including E6I and E7, towards the virus LCR did not reveal suppressing activities. On the contrary, the E6I cDNA generated weak transcriptional activation of the HPV-16 LCR (Fig. 8a
). This low positive activity, although observed repeatedly in independent assays, did not exhibit a dose-dependent relationship in the range 0·55 µg of transfected DNA.
|
Unlike the a- and d-type truncated cDNAs, the a'-type truncated cDNA showed dose-dependent activation of the virus LCR. In addition to the E6I and E7 ORFs, the a'-type cDNA contains the E1 splice variant ORF, E1C, described previously (Sherman & Alloul, 1992
). The 82 amino acid E1 splice variant protein consists mostly of the carboxy domain (76 amino acids) of E1. Transfection of increasing amounts of DNA of the E1C expression vector (A. Gluchov, N. Alloul and L. Sherman, unpublished data) with the virus LCRCAT plasmid showed dose-dependent activation of the virus LCR (Fig. 8a
). Further co-transfection experiments carried out with different amounts of the E1C cDNA together with the E2 monocistronic cDNA, each on a separate vector, together with the LCR reporter, resulted in a reduction in the E2-mediated transrepression of the virus LCR (Fig. 8b
). This antagonistic effect of E1C was observed with a range of amounts of transfected DNA (0·55 µg). Taken together, these results suggest that the positive regulatory activity of the a'-type truncated cDNA was probably due to the function of the putative E1C protein and that repression of the virus LCR mediated by the a'-type cDNA probably resulted from the E2 gene product, which overrides the positive transcription-regulatory activities of the accessory E1C and possibly E6I proteins.
| Discussion |
|---|
|
|
|---|
We showed previously that HPV-16 expresses a variety of alternatively spliced polycistronic mRNAs that encode the E2 protein from an internal ORF (Sherman & Alloul, 1992
). Further studies on the translational capacities of species a, a' and d indicated different efficiencies of E2 translation from the respective templates. Expression from all three polycistronic templates was lower than that obtained from a synthetic monocistronic control containing the E2 ORF (Alloul & Sherman, 1999
). Although transcripts that contain the E2 ORF as the first 5' ORF have not been identified previously, evidence for the existence of promoters within the E7 ORF that could potentially initiate transcription of E2-encoding transcripts has been provided (Higgins et al., 1992
; Hemstrom Nilsson et al., 1996
; Bohm et al., 1993
).
In the present study, we wished to establish the importance of differential splicing within the E2-encoding mRNAs with respect to the function of E2 as a transcriptional regulator. In the first part of this study, we analysed the ability of the various E2 cDNAs to regulate transcription from the virus LCR. We showed that expression of monocistronic as well as polycistronic E2-encoding cDNAs from an SV40-based vector (pJS55) transrepressed the virus LCR in a dose-dependent manner. Transrepression was observed with a range of amounts of transfected DNA (0·55 µg). Similar amounts of DNA of CMV-based expression plasmids encoding the E2 proteins of HPV-8 (Stubenrauch & Pfister, 1994
; Stubenrauch et al., 1996
) and HPV-18 (Steger & Corbach, 1997
) were also reported to transrepress the homologous virus LCRs.
Transrepression activity was specific for the virus LCR and was exhibited in different cell types including Cf2Th and C33A cells, respectively of fibroblast and epithelial origin.
Co-transfection of equimolar amounts of the E2 polycistronic cDNAs with the LCRCAT reporter resulted in different levels of transrepression of the virus LCR. Data obtained from functional analyses of related cDNAs bearing mutations in, or truncation of, the E2 ORF indicated that transrepression was due principally to E2 expression.
Specific activities of the polycistronic cDNA in transrepression were lower than that exhibited by the monocistronic cDNA and correlated with the previously defined activities of the respective cDNAs in translation of the E2 protein. These results support the functional relevance of alternative splicing in E2-mediated regulation of the virus LCR.
Alternative splicing within the E2-encoding mRNAs not only affects the translation efficiency of the E2 ORF but also dictates the organization of the preceding ORFs. The results of this study showed that cDNAs carrying the 5' ORF regions of species a' and d retained some transregulatory activities towards the virus LCR.
Further analyses of the transcription-regulatory activities of cDNAs containing the individual ORFs expressed from the same SV40-based vector showed that the E6IV, E1C and, to a lesser extent, E6I putative accessory proteins, but not the E7 protein, function in transregulation of the virus LCR, either in a positive (E1C and possibly E6I) or a negative (E6IV) manner. Hence, co-expression of the respective proteins from the natural polycistronic mRNAs would either increase or decrease the E2-mediated transrepression of the virus LCR. Co-translation of E6IV or E6I together with E2 protein from the d-and a-type templates, respectively, was demonstrated previously (Alloul & Sherman, 1999
).
Despite the fact that translation of E1C protein from the polycistronic a'-type template was not detected previously (Alloul & Sherman, 1999
), the data presented herein on the positive regulatory activity of the related mutant cDNA (carrying a mutation in the E2 ORF), or truncated cDNA, support the ability of the a'-type mRNA to function in translation of the E1C splice-variant protein. The inability to detect the protein could result from low levels of expression and/or instability of the protein.
The data presented in this study on the ability of the E1C cDNA to reduce E2-mediated transrepression are consistent with previous observations showing that an E1 polypeptide spanning the C-terminal domain of bovine papillomavirus type 1 (residues 132605) is able to repress E2-mediated transactivation of the viral p89 promoter (Ferran & McBride, 1998
). Further studies of E1C transactivation and modulation of E2 transrepression are needed.
A low transactivation activity, which was dose-dependent over a small range of low doses of transfected DNA, was also previously attributed to the E6I splice variant (Shirasawa et al., 1994
). Our data on transactivation with the monocistronic E6I expression plasmid are consistent with E6I acting as a weak transcriptional activator. The inability to detect the transactivation function with the a-type mutated cDNAs (bearing a mutation in or a truncation of the E2 ORF) could be due to differences in the amount of E6I translated from the respective vectors. Quantitative in vitro translation analyses indicated that the a- and a'-type vectors served mainly for translation of E7 (Alloul & Sherman, 1999
).
The studies reported herein provide evidence that alternative splicing within E2-encoding mRNAs principally affects the function of E2 as a transcriptional regulator by controlling the levels of E2 translation and, in addition, by defining the organization of the 5' ORFs, thereby enabling the expression of putative accessory proteins that possess different regulatory activities.
E2-encoding mRNAs expressed from circular viral DNA terminate at the early polyadenylation site located downstream from the E5 ORF. Previous studies demonstrated the coordinated translation of E2 and E5 proteins from bicistronic constructs containing the full-length E2 and E5 ORFs of HPV-16 (Johnsen et al., 1995
). The E2 cDNAs described in this study lack the sequences downstream from the E2 ORF, including that of the E5 ORF region. Whether E5 is translated together with E2 from the polycistronic mRNAs and whether it affects E2 transregulatory function remains to be established.
It is tempting to speculate that differential splicing, and possibly alternative initiation, of E2-encoding mRNAs serve as mechanisms to control the activity of the p97 promoter during the virus life-cycle. The HPV life-cycle is strictly linked to epithelial differentiation. After infection of basal cells, HPV genomes are maintained as episomes and transcription of the early genes required for cell immortalization, E6E7, and virus replication, E1 and E2, is directed by the p97 promoter. At this stage, low, transactivating levels of E2 may be required. Upon differentiation, when differentiation-dependent promoters located within the E7 ORF of HPV-16 (Higgins et al., 1992
; Hemstrom Nilsson et al., 1996
) are activated, high levels of E2 may be needed to suppress further transcription from p97.
Further studies will be needed to establish whether differential splicing and possibly promoter usage by mRNAs encoding E2 are related to cell differentiation and stage of virus replication.
| Acknowledgments |
|---|
| References |
|---|
|
|
|---|
Armstrong, D. J. & Roman, A. (1997). The relative ability of human papillomavirus type 6 and human papillomavirus type 16 E7 proteins to transactivate E2F-responsive elements is promoter- and cell-dependent. Virology 239, 238-246.[Medline]
Bernard, B. A., Bailly, C., Lenoir, M. C., Darmon, M., Thierry, F. & Yaniv, M. (1989). The human papillomavirus type 18 (HPV18) E2 gene product is a repressor of the HPV18 regulatory region in human keratinocytes. Journal of Virology 63, 4317-4324.
Bohm, S., Wilczynski, S. P., Pfister, H. & Iftner, T. (1993). The predominant mRNA class in HPV16-infected genital neoplasias does not encode the E6 or the E7 protein. International Journal of Cancer 55, 791-798.
Boukamp, P., Petrussevska, R. T., Breitkreutz, D., Hornung, J., Markham, A. & Fusenig, N. E. (1988). Normal keratinization in a spontaneously immortalized aneuploid human keratinocyte cell line. Journal of Cell Biology 106, 761-771.
Bouvard, V., Storey, A., Pim, D. & Banks, L. (1994). Characterization of the human papillomavirus E2 protein: evidence of trans-activation and trans-repression in cervical keratinocytes. EMBO Journal 13, 5451-5459.[Medline]
Cripe, T. P., Haugen, T. H., Turk, J. P., Tabatabai, F., Schmid, P. G.III, Durst, M., Gissmann, L., Roman, A. & Turek, L. P. (1987). Transcriptional regulation of the human papillomavirus 16 E6-E7 promoter by a keratinocyte-dependent enhancer, and by viral E2 trans-activator and repressor gene products: implications for cervical carcinogenesis. EMBO Journal 6, 3745-3753.[Medline]
de Villiers, E. M. (1989). Heterogeneity of the human papillomavirus group. Journal of Virology 63, 4898-4903.
Doorbar, J., Parton, A., Hartley, K., Banks, L., Crook, T., Stanley, M. & Crawford, L. (1990). Detection of novel splicing patterns in a HPV16-containing keratinocyte cell line. Virology 178, 254-262.[Medline]
Ferran, M. C. & McBride, A. A. (1998). Transient viral DNA replication and repression of viral transcription are supported by the C-terminal domain of the bovine papillomavirus type 1 E1 protein. Journal of Virology 72, 796-801.
Giri, I. & Yaniv, M. (1988). Structural and mutational analysis of the E2 trans-activating proteins of papillomaviruses reveals three distinct functional domains. EMBO Journal 7, 2823-2829.[Medline]
Gorman, C. M., Moffat, L. F. & Howard, B. H. (1982). Recombinant genomes which express chloramphenicol acetyltransferase in mammalian cells. Molecular and Cellular Biology 2, 1044-1051.
Hemstrom Nilsson, C., Bakos, E., Petry, K. U., Schneider, A. & Durst, M. (1996). Promoter usage in the E7 ORF of HPV16 correlates with epithelial differentiation and is largely confined to low-grade genital neoplasia. International Journal of Cancer 65, 6-12.
Higgins, G. D., Uzelin, D. M., Phillips, G. E., McEvoy, P., Marin, R. & Burrell, C. J. (1992). Transcription patterns of human papillomavirus type 16 in genital intraepithelial neoplasia: evidence for promoter usage within the E7 open reading frame during epithelial differentiation. Journal of General Virology 73, 2047-2057.
Johnsen, C. K., Stanley, M. & Norrild, B. (1995). Analysis of human papillomavirus type 16 E5 oncogene expression in vitro and from bicistronic messenger RNAs. Intervirology 38, 339-345.[Medline]
Lupetti, R., Mortarini, R., Panceri, P., Sensi, M. & Anichini, A. (1996). Interaction with fibronectin regulates cytokine gene expression in human melanoma cells. International Journal of Cancer 66, 110-116.
McBride, A. A., Romanczuk, H. & Howley, P. M. (1991). The papillomavirus E2 regulatory proteins. Journal of Biological Chemistry 266, 18411-18414.
Phelps, W. C. & Howley, P. M. (1987). Transcriptional trans-activation by the human papillomavirus type 16 E2 gene product. Journal of Virology 61, 1630-1638.
Rohlfs, M., Winkenbach, S., Meyer, S., Rupp, T. & Durst, M. (1991). Viral transcription in human keratinocyte cell lines immortalized by human papillomavirus type-16. Virology 183, 331-342.[Medline]
Romanczuk, H., Thierry, F. & Howley, P. M. (1990). Mutational analysis of cis elements involved in E2 modulation of human papillomavirus type 16 P97 and type 18 P105 promoters. Journal of Virology 64, 2849-2859.
Shally, M., Alloul, N., Jackman, A., Muller, M., Gissmann, L. & Sherman, L. (1996). The E6 variant proteins E6IE6IV of human papillomavirus 16: expression in cell free systems and bacteria and study of their interaction with p53. Virus Research 42, 81-96.[Medline]
Sherman, L. & Alloul, N. (1992). Human papillomavirus type 16 expresses a variety of alternatively spliced mRNAs putatively encoding the E2 protein. Virology 191, 953-959.[Medline]
Sherman, L. & Schlegel, R. (1996). Serum- and calcium-induced differentiation of human keratinocytes is inhibited by the E6 oncoprotein of human papillomavirus type 16. Journal of Virology 70, 3269-3279.
Sherman, L., Alloul, N., Golan, I., Durst, M. & Baram, A. (1992). Expression and splicing patterns of human papillomavirus type-16 mRNAs in pre-cancerous lesions and carcinomas of the cervix, in human keratinocytes immortalized by HPV 16, and in cell lines established from cervical cancers. International Journal of Cancer 50, 356-364.
Sherman, L., Jackman, A., Itzhaki, H., Conrad Stoppler, M., Koval, D. & Schlegel, R. (1997). Inhibition of serum- and calcium-induced differentiation of human keratinocytes by HPV16 E6 oncoprotein: role of p53 inactivation. Virology 237, 296-306.[Medline]
Shirasawa, H., Tomita, Y., Kubota, K., Kasai, T., Sekiya, S., Takamizawa, H. & Simizu, B. (1988). Transcriptional differences of the human papillomavirus type 16 genome between precancerous lesions and invasive carcinomas. Journal of Virology 62, 1022-1027.
Shirasawa, H., Jin, M. H., Shimizu, K., Akutsu, N., Shino, Y. & Simizu, B. (1994). Transcription-modulatory activity of full-length E6 and E6*I proteins of human papillomavirus type 16. Virology 203, 36-42.[Medline]
Smotkin, D. & Wettstein, F. O. (1986). Transcription of human papillomavirus type 16 early genes in a cervical cancer and a cancer-derived cell line and identification of the E7 protein. Proceedings of the National Academy of Sciences, USA 83, 4680-4684.
Smotkin, D., Prokoph, H. & Wettstein, F. O. (1989). Oncogenic and nononcogenic human genital papillomaviruses generate the E7 mRNA by different mechanisms. Journal of Virology 63, 1441-1447.
Steger, G. & Corbach, S. (1997). Dose-dependent regulation of the early promoter of human papillomavirus type 18 by the viral E2 protein. Journal of Virology 71, 50-58.
Stubenrauch, F. & Pfister, H. (1994). Low-affinity E2-binding site mediates downmodulation of E2 transactivation of the human papillomavirus type 8 late promoter. Journal of Virology 68, 6959-6966.
Stubenrauch, F., Leigh, I. M. & Pfister, H. (1996). E2 represses the late gene promoter of human papillomavirus type 8 at high concentrations by interfering with cellular factors. Journal of Virology 70, 119-126.
Tan, S. H., Gloss, B. & Bernard, H. U. (1992). During negative regulation of the human papillomavirus-16 E6 promoter, the viral E2 protein can displace Sp1 from a proximal promoter element. Nucleic Acids Research 20, 251-256.
Tan, S. H., Leong, L. E., Walker, P. A. & Bernard, H. U. (1994). The human papillomavirus type 16 E2 transcription factor binds with low cooperativity to two flanking sites and represses the E6 promoter through displacement of Sp1 and TFIID. Journal of Virology 68, 6411-6420.
Thierry, F. (1996). HPV proteins in the control of HPV transcription. In Papillomavirus Reviews: Current Research on Papillomaviruses, pp. 21-28. Edited by A. Lacey. Leeds: Leeds University Press.
Ushikai, M., Lace, M. J., Yamakawa, Y., Kono, M., Anson, J., Ishiji, T., Parkkinen, S., Wicker, P. N., Valentine, M.-E., Davidson, I., Turek, L. P. & Haugen, T. I. (1994). trans activation by the full-length E2 proteins of human papillomavirus type 16 and bovine papillomavirus type 1 in vitro and in vivo: cooperation with activation domains of cellular transcription factors. Journal of Virology 68, 6655-6666.
Zhao, Y., Wein, A. J. & Levin, R. M. (1995). Assessment of stress gene mRNAs (HSP-27, 60 and 70) in obstructed rabbit urinary bladder using a semi-quantitative RT-PCR method. Molecular and Cellular Biochemistry 148, 1-7.[Medline]
zur Hausen, H. (1996). Papillomavirus infections a major cause of human cancers. Biochimica et Biophysica Acta 1288, F55-F78.[Medline]
Received 9 March 1999;
accepted 30 April 1999.
This article has been cited by other articles:
![]() |
M. Schmitt, V. Dalstein, T. Waterboer, C. Clavel, L. Gissmann, and M. Pawlita Diagnosing Cervical Cancer and High-Grade Precursors by HPV16 Transcription Patterns Cancer Res., January 1, 2010; 70(1): 249 - 256. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| INT J SYST EVOL MICROBIOL | MICROBIOLOGY | J GEN VIROL |
| J MED MICROBIOL | ALL SGM JOURNALS | |