|
|
||||||||
Insect |
Departments of Biochemistry & Biophysics1 and Entomology2, Texas A&M University, College Station, TX 77843-2128, USA
Author for correspondence: Linda Guarino (at Department of Biochemistry & Biophysics). Fax +1 409 845 9274. e-mail lguarino{at}tamu.edu
| Abstract |
|---|
|
|
|---|
| Introduction |
|---|
|
|
|---|
To identify the viral genes required for baculovirus DNA replication, a transient complementation assay (Kool et al., 1994
; Lu & Miller, 1995
) was used. These experiments revealed that proteins encoded by six viral genes (dna pol, p143, lef-1, lef-2, lef-3 and ie1) are essential for replication of plasmids containing a viral origin of replication. In addition, products of the ie2, pe38, p35 and lef-7 genes stimulated the level of DNA replication. Thus far, the functions of only a few of these genes are known.
The ie1 gene encodes the major transactivator of delayed early gene expression (Guarino et al., 1986
; Guarino & Summers, 1987
; Ross & Guarino, 1997
), so it is essential for replication at least partly due to its role in transcription. In addition, it is possible that IE1 plays a direct role in viral DNA replication because it binds to the hr elements (Guarino & Dong, 1994
). lef-3 encodes a single-stranded DNA-binding protein (Hang et al., 1995
), and is also involved in the nuclear localization of P143 (Wu & Carstens, 1998
). The p143 gene was identified as part of a temperature-sensitive screen for DNA negative mutants (Lu & Carstens, 1991
). P143 is a candidate helicase based on amino acid sequence similarity, though enzymatic activity has yet to be demonstrated. The stimulatory proteins IE2 and PE38 probably function by increasing the expression of IE1 and other essential DNA replication proteins (Carson et al., 1991
; Lu & Carstens, 1993
). P35 suppresses apoptosis thus increasing the viability of transfected cells during the transient replication assays (Clem & Miller, 1993
). The functions of lef-1, lef-2 and lef-7 are unknown.
The AcMNPV dna pol gene was first identified by using an oligonucleotide probe corresponding to an amino acid sequence that is conserved among other viral DNA polymerases (Tomalski et al., 1988
). Additional transcriptional mapping of dna pol indicated that it was transcribed during the early phase of infection, which is consistent with its proposed function. The identification of the viral DNA polymerase gene confirmed earlier biochemical studies on DNA polymerase activity in infected cells. These data indicated that DNA polymerase activity is significantly enhanced during the course of viral infection. Furthermore, chromatographic separation of polymerases from control and infected cells identified a unique activity from the infected cells (Miller et al., 1979
; Wang & Kelly, 1983
). However, the AcMNPV DNA polymerase has not been purified to homogeneity nor have experiments been performed that conclusively link the biochemical activity to the virus gene.
As part of our continuing effort to elucidate the molecular mechanism of baculovirus DNA replication, we decided to purify AcMNPV DNA polymerase and analyse the purified enzyme by examining the kinetics of its replication of single-stranded DNA templates.
| Methods |
|---|
|
|
|---|
DNA polymerase purification.
Nuclear extract (20 ml) was loaded in two 10 ml batches onto a 5 ml heparin affinity column (Bio-Rad) connected to a Pharmacia FPLC system. The column was washed with 20 ml buffer A and eluted with a 20 ml linear gradient from 0·05 to 0·5 M KCl in buffer A. The flow rate was 1 ml/min and the fraction size was 1 ml. Fractions containing viral DNA polymerase activity were pooled, dialysed against buffer A containing 10% glycerol and applied to a 5 ml DEAE-Blue column (Bio-Rad) equilibrated in the same buffer. Proteins were eluted with a 25 ml linear salt gradient from 0·05 to 0·5 M KCl in buffer A. Peak fractions of DNA polymerase activity were pooled and dialysed against buffer A. Flowthrough fractions containing enzyme activity were also pooled and loaded on the same column and eluted as before. Peak DNA polymerase activity fractions were pooled, dialysed with buffer A and combined with the previous DEAE fractions before loading onto a Mono Q HR 5/5 anion-exchange column (Pharmacia) and eluted with a 20 ml linear salt gradient from 0·05 to 0·5 M KCl in buffer A. Fractions containing DNA polymerase activity were pooled, dialysed against buffer A and loaded onto a 1 ml single-stranded (ss)DNAagarose column (BRL). The column was eluted with an increasing salt gradient from 0·05 to 1 M KCl in buffer A. During purification, all fractions were assayed for DNA polymerase activity and peak fractions were analysed by SDSPAGE. Silver staining of SDSPAGE gels was performed according to standard procedure (Harlow & Lane, 1988
). Protein concentrations were determined by the Bradford (1976
) method using BSA as a standard.
Protein fragmentation and mass analysis.
Purified DNA polymerase was digested with trypsin and mass analysis was conducted at the Protein/Peptide Micro Analytical Laboratory (California Institute of Technology). Mass spectrometry was performed on a Perseptive Biosystems Elite MALDI TOF. Tryptic peptide masses were used by MOWSE to search a peptide mass database constructed from a theoretical trypsin digest of all proteins in the OWL database (Pappin et al., 1993
). Search parameters used were a molecular mass filter of 25%, a 3 Da peptide mass tolerance and a partial cleavage score factor of 0·4.
DNA templates.
Singly-primed single-stranded DNA templates were produced by hybridization of 25 pmol of synthetic oligonucleotide primer with 2·5 pmol of the appropriate phage DNA (M13mp19 or
X174) in a reaction volume of 50 µl containing 50 mM TrisHCl (pH 7·5), 5 mM MgCl2 and 100 mM NaCl. The hybridization mixtures were incubated at 90 °C for 5 min before cooling slowly to room temperature for 1 h. Excess primer was removed by spin chromatography through Sephadex G-50. The oligonucleotide used for the M13 template was universal M13 (-40) sequencing primer, 5' GTTTTCCCAGTCACGAC 3', while the
X174 primer was 5' GGCGCATAACGATACCACTGACC 3', which is complementary to nucleotides 2067 to 2045 of
X174 DNA.
Measurements of DNA polymerase activity.
During purification, DNA polymerase activity was assayed using activated calf thymus DNA as primertemplate. Typically, 50 µl reaction mixtures contained 20 mM Trisacetate (pH 7·3), 75 mM potassium acetate, 5 mM magnesium acetate, 1 mM DTT, 0·1 mM each dGTP, dATP and dTTP, 0·01 mM dCTP, 1·0 µCi/ml [
-32P]dCTP (3000 Ci/mmol), 100 µg/ml BSA and 0·2 mg/ml activated calf thymus DNA (Sigma) as substrate. Each fraction was titrated to identify the linear range of activity. The reaction mixtures were incubated at 37 °C for 15 min and spotted onto glass-fibre filters, which were then washed extensively with 5% trichloroacetic acid (TCA) and 1 M HCl, rinsed with ethanol and dried. Filter-bound radioactivity was determined by Cerenkov counting. The specific activity of the input dCTP was also calculated by Cerenkov counting an aliquot of each reaction. One unit of enzyme activity was defined as the amount of enzyme required to incorporate 1 nmol [
-32P]dNTP into acid-insoluble material/min at 37 °C.
For DNA synthesis on singly-primed M13 single-stranded circular template, reaction mixtures (50 µl) contained 20 to 50 fmol substrate DNA, 20 mM Trisacetate (pH 7·3), 75 mM potassium acetate, 5 mM magnesium acetate, 1 mM DTT, 0·5 mM ATP, 60 µM each dGTP, dATP and dTTP, 20 µM [
-32P]dCTP (300 Ci/mmol), 50 µg/ml BSA and 10 to 200 fmol purified DNA polymerase. The reactions were incubated at 37 °C and terminated by the addition of an equal volume of stop buffer (1% SDS40 mM EDTA60 µg sonicated calf thymus DNA/ml). The reaction products were precipitated with ethanol, resuspended in 20 µl 0·1 M NaOH5% glycerol1 mM EDTA0·025% bromocresol green sample buffer and separated on a 1% alkaline agarose gel as described (Sambrook et al., 1989
). For autoradiography, dried gels were exposed to X-ray film overnight at -80 °C.
Measurements of 3'5' exonuclease activity.
3'5' exonuclease activity was assayed in a 50 µl reaction containing 20 mM Trisacetate (pH 7·3), 75 mM potassium acetate, 5 mM magnesium acetate, 1 mM DTT, 100 µg/ml BSA and 5000 to 10000 c.p.m. of 3'-end labelled DNA template. The template was prepared by digestion of 1 µg pUC18 DNA with XmaI, and radiolabelling at the 3' end with the Klenow fragment of E. coli DNA polymerase I in the presence of [
-32P]dCTP (3000ci/mmol) as described (Sambrook et al., 1989
). The reactions were initiated by addition of 5 or 10 µl aliquots of column fractions and incubated at 37 °C for 30 min. The reaction mixtures were precipitated with 1 ml ice-cold 5% TCA, and then filtered onto a glass-fibre filter. The acid-insoluble radioactivity collected on the filter and was then washed with 5 ml 5% TCA. The acid-soluble material washed through the filter and was collected directly into a scintillation vial. The total amount of radioactivity (soluble plus insoluble) was determined by Cerenkov counting. One unit of enzyme activity was defined as the amount of enzyme required to release 1 pmol [
-32P]dCTP into acid-soluble material in 30 min at 37 °C.
| Results |
|---|
|
|
|---|
|
The final step in our purification was affinity chromatography on ssDNAagarose. The DNA polymerase activity of fractions eluting from ssDNAagarose was quantified using activated calf thymus DNA as primertemplate (Fig. 2B
). Fractions across the peak of activity were assayed by SDSPAGE and stained with Coomassie blue. A single polypeptide with an apparent molecular mass of 110000 Da was found to increase and decrease concomitant with the peak of enzymatic activity (Fig. 2A
). Fraction 4 was contaminated with a lower molecular mass protein, but fractions 5 and 6 were apparently homogeneous with respect to the 110000 Da band.
|
|
|
Effects of different metabolic drugs on DNA polymerase activity
In order to gain more insight into the molecular mechanisms of the viral DNA polymerase, we also investigated the effects of several metabolic drugs on the activity of the purified protein. Aphidicolin is a mycotoxin that was previously shown to inhibit the activity of baculovirus DNA polymerase (Miller et al., 1979
; Wang & Kelly, 1983
). In agreement with these results, our experiment using purified viral DNA polymerase also showed that aphidicolin can effectively inhibit its activity (Fig. 3
). An inhibitor constant (Ki) of 0·6 µM for aphidicolin was determined from a Dixon plot of the inhibition data. Cytosine-ß-d-arabinofuranoside 5'-triphosphate (AraCTP) also had a marked inhibitory effect, with a Ki of 4·2 µM. In addition, 5'-bromo-2'-deoxyuridine 5'-triphosphate (BdUTP) and phosphonoacetic acid (PAA) also inhibited the purified viral DNA polymerase activity. The Ki values of these inhibitors were 118 µM for BdUTP and 76 µM for PAA.
|
-32P]dCTP and aliquots were removed at the indicated times after addition of dCTP. Full-length radiolabelled M13 DNA was detected after 3 min of incubation and most of the DNA chains were replicated by 5 min after addition of dCTP. This indicates a rate of polymerization of 2440 nt/s. After 10 min, a radiolabelled band equivalent to twice the size of full-length M13 DNA was detected. This band is frequently observed in these types of assays and is due to self-priming of broken circles (Challberg & Englund, 1987
|
| Discussion |
|---|
|
|
|---|
Several lines of evidence suggest that the purified DNA polymerase is virus encoded. One, its apparent molecular mass is in close agreement with the predicted molecular mass of the protein putatively encoded by the previously identified AcMNPV dna pol (Tomalski et al., 1988
). Two, uninfected-cell nuclear extracts had much lower DNA polymerase activity and cellular DNA polymerases have molecular masses and subunit compositions different from the single polypeptide identified here (Kornberg & Baker, 1992
). Furthermore, mass spectrophotometric analysis of tryptic peptides generated from the purified protein was consistent with the identification of the dna pol gene product. Five of the masses measured were matched to predicted tryptic fragments of the protein putatively encoded by the AcMNPV dna pol gene. The presence of unassigned fragments is not unusual as many proteins generate tryptic fragments that cannot be matched to the predicted proteins; these could be due to naturally occurring post-translational modifications or chemical modifications that can occur during purification. It is possible that the protein sequence of the E2 isolate of AcMNPV that we used is somewhat different than the L1 isolate sequenced by Tomalski et al. (1988
) or the C6 isolate sequenced by Ayres et al. (1994
).
Our purification results indicate that AcMNPV-infected insect cells are a good source material for purification of viral DNA polymerase since it was expressed at high levels and localized to the nuclei during infection. Compared to the previously published DNA polymerase purification data for Trichoplusia ni nucleopolyhedrovirus (TnNPV) and BmNPV (Miller et al., 1979
; Wang & Kelly, 1983
), the relative purification as well as the final product yield were significantly improved in this report.
The presence of 3'5' exonuclease activity is a common feature of viral DNA polymerases as it is required for proofreading. Therefore, we tested whether this activity was associated with the baculovirus DNA polymerase. Our data suggest that 3'5' exonuclease activity is tightly associated with AcMNPV DNA polymerase activity since the activities copurified through all column purification steps and the ratio of exonuclease activity to polymerase activity remained relatively constant during purification (Table 1
). The enzymatic data are consistent with the presence of three highly conserved segments (Exo I, II and III) near the N terminus; this region of homology is proposed to be a general 3'5' exonuclease active site conserved among many prokaryotic, eukaryotic and viral DNA polymerases (Bernad et al., 1989
). Our data confirm a previous report on the related baculovirus BmNPV (Mikhailov et al., 1986
). However, our results more convincingly show that 3'5' exonuclease activity and DNA polymerase are integrally associated because the BmNPV experiments were performed with partially purified polymerase preparations. Similar assays with a 5'-labelled probe suggest that 5'3' exonuclease activity is not an integral component of the AcMNPV polymerase. This is consistent with the lack of a conserved 5'3' exonuclease motif (Lopez et al., 1989
) in the predicted amino acid sequence of AcMNPV DNA polymerase.
To further characterize the purified viral DNA polymerase, we tested the effect of different metabolic drugs on its activity. Aphidicolin is a tetracyclic diterpenoid antibiotic and has been shown to be a potent inhibitor of eukaryotic DNA polymerase
and
(Spadari et al., 1982
) and the DNA polymerases encoded by several large DNA viruses such as herpes and vaccinia (Pedrali-Noy & Spadari, 1980
; Spadari et al., 1982
). We showed that aphidicolin is an efficient inhibitor of purified AcMNPV DNA polymerase, in agreement with the previous report (Wang & Kelly, 1983
) of inhibition by aphidicolin of TnNPV DNA polymerase. We also decided to test the effect of AraCTP on DNA polymerase activity because of inconsistencies in the literature. Previous reports (Kelly, 1981
; Kelly & Lescott, 1976
) showed that AraC blocked viral DNA replication and late viral gene expression in virus-infected cells. However, Rice & Miller (1986)
reported that AraC was an inefficient inhibitor of viral DNA synthesis in AcMNPV-infected cells. We found that AraCTP was a potent inhibitor of the purified AcMNPV DNA polymerase, suggesting that the results of Rice & Miller may be due to problems with uptake of the drug into cells or with synthesis of the triphosphate rather than a lack of incorporation of AraCTP into DNA. The inhibitory effect of AraCTP is generally believed to be due to the incorporation of the arabinosides into DNA, where they distort the primertemplate and block further DNA synthesis by chain termination (Kornberg & Baker, 1992
). Another metabolic drug we showed to have an inhibitory effect on viral DNA polymerase is BdUTP, which contains bromine in the 5-position. Incorporation of BdUTP into DNA as a nucleoside analogue is known to cause replication errors and alter the recognition of specific replication signals. In addition, we showed that PAA could also inhibit the purified AcMNPV DNA polymerase. PAA is an inorganic pyrophosphate analogue that selectively inhibits the DNA polymerase encoded by herpes simplex and vaccinia viruses, and was not previously shown to affect baculovirus DNA polymerase.
To better define the molecular mechanisms of viral DNA replication, we performed replication assays on singly-primed single-stranded templates. We found that AcMNPV DNA polymerase could effectively copy long single-stranded DNA templates such as singly-primed M13 and
X174 DNA. The rate of polymerization was 40 nt/s, and there was little evidence of pausing at regions known to contain hairpins. The lack of pausing indicates that the AcMNPV DNA polymerase could replicate through regions of secondary structure in the apparent absence of single-stranded DNA-binding proteins (SSB). Although we cannot be certain that our purified DNA polymerase preparation contained no minor contaminants, it is highly unlikely that enough SSB could be present to unwind all of the hairpins in M13 DNA because SSBs need to be added in a high enough molar ratio to coat the DNA template. The viral SSB is LEF-3 which binds 9 or 10 nucleotides of single-stranded DNA (Hang et al., 1995
). Therefore, more than 725 mol LEF-3 per mol of DNA polymerase would be required to coat the DNA and unwind regions of secondary structure. This amount of protein could not be present in our preparations and remain undetected by either silver stain or Coomassie stain. Host SSBs or the viral DNA-binding protein (Mikhailov et al., 1998
) could also be present as minor contaminants, but it is also highly unlikely that they could significantly affect the character of the DNA template at submolar concentrations.
| Acknowledgments |
|---|
| References |
|---|
|
|
|---|
Bernad, A., Blanco, L., Lazaro, J. M., Martin, G. & Salas, M. (1989). A conserved 3'5' exonuclease active site in prokaryotic and eukaryotic DNA polymerases. Cell 59, 219-228.[Medline]
Bradford, M. M. (1976). A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Analytical Biochemistry 72, 248-254.[Medline]
Brush, G. S., Kelly, T. J. & Stillman, B. (1995). Identification of eukaryotic DNA replication proteins using the simian virus 40 in vitro replication system. Methods in Enzymology 262, 507-522.[Medline]
Carson, D. D., Summers, M. D. & Guarino, L. A. (1991). Molecular analysis of a baculovirus regulatory gene. Virology 182, 279-286.[Medline]
Challberg, M. D. & Englund, P. T. (1979). Effect of template secondary structure on vaccinia DNA polymerase. Journal of Biological Chemistry 254, 7820-7826.
Chui, G. S. J. & Linn, S. (1995). Purification of mammalian DNA polymerases: DNA polymerase
. Methods in Enzymology 262, 93-98.[Medline]
Clem, R. J. & Miller, L. K. (1993). Apoptosis reduces both the in vitro replication and the in vivo infectivity of a baculovirus. Journal of Virology 67, 3730-3738.
Cochran, M. A. & Faulkner, P. (1983). Location of homologous DNA sequences interspersed at five regions in the baculovirus AcNPV genome. Journal of Virology 45, 961-970.
Guarino, L. A. & Summers, M. D. (1986). Functional mapping of a trans-activating gene required for expression of a baculovirus delayed-early gene. Journal of Virology 57, 563-571.
Guarino, L. A. & Summers, M. D. (1987). Nucleotide sequence and temporal expression of a baculovirus regulatory gene. Journal of Virology 61, 2091-2099.
Guarino, L. A. & Dong, W. (1994). Functional dissection of the Autographa californica nuclear polyhedrosis virus enhancer element hr5. Virology 200, 328-335.[Medline]
Guarino, L. A., Gonzalez, M. A. & Summers, M. D. (1986). Complete sequence and enhancer function of the homologous DNA region of Autographa californica nuclear polyhedrosis virus. Journal of Virology 60, 224-229.
Hang, X., Dong, W. & Guarino, L. A. (1995). The lef-3 gene of Autographa californica nuclear polyhedrosis virus encodes a single-stranded DNA-binding protein. Journal of Virology 69, 3924-3928.[Abstract]
Harlow, E. & Lane, D. (1988). Antibodies: A Laboratory Manual. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory.
Kelly, D. C. (1981). Baculovirus replication: stimulation of thymidine kinase and DNA polymerase activities in Spodoptera frugiperda cells infected with Trichoplusia ni nuclear polyhedrosis virus. Journal of General Virology 52, 313-319.
Kelly, D. C. & Lescott, T. (1976). The effects of inhibitors of nucleic acid and protein synthesis on the replication of Autographa californica nuclear polyhedrosis virus in cultured Spodoptera frugiperda cells. Intervirology 7, 360-365.[Medline]
Kool, M., Voeten, J. T. M., Goldbach, R. W., Tramper, J. & Vlak, J. M. (1993). Identification of seven putative origins of Autographa californica multiple nucleocapsid nuclear polyhedrosis virus DNA replication. Journal of General Virology 74, 2661-2668.
Kool, M., Ahrens, C. H., Goldbach, R. W., Rohrmann, G. F. & Vlak, J. M. (1994). Identification of genes involved in DNA replication of the Autographa californica baculovirus. Proceedings of the National Academy of Sciences, USA 91, 11212-11216.
Kornberg, A. & Baker, T. (1992). DNA Replication, 2nd edn. New York: W. H. Freeman.
Lopez, P., Martinez, S., Diaz, A., Espinosa, M. & Lacks, S. A. (1989). Characterization of the polA gene of Streptococcus pneumoniae and comparison of the DNA polymerase I it encodes to homologous enzymes from Escherichia coli and phage T7. Journal of Biological Chemistry 264, 4255-4263.
Lu, A. & Carstens, E. B. (1991). Nucleotide sequence of a gene essential for viral DNA replication in the baculovirus Autographa californica nuclear polyhedrosis virus. Virology 181, 336-347.[Medline]
Lu, A. & Carstens, E. B. (1993). Immediate early baculovirus genes transactivate the p143 gene promoter of Autographa californica nuclear polyhedrosis virus. Virology 195, 710-718.[Medline]
Lu, A. & Miller, L. K. (1995). The roles of eighteen baculovirus late gene expression factor genes in transcription and DNA replication. Journal of Virology 69, 975-982.[Abstract]
Mikhailov, V. S., Marlyev, K. A., Ataeva, J. O., Kullyev, P. K. & Atrazhev, A. M. (1986). Characterization of 3'5' exonuclease with DNA polymerase of silkworm nuclear polyhedrosis virus. Nucleic Acids Research. 14, 38413857.
Mikhailov, V. S., Mikhailova, A. L., Iwanaga, M., Gomi, S. & Maeda, S. (1998). Bombyx mori nucleopolyhedrosis virus encodes a DNA-binding protein capable of destabilizing duplex DNA. Journal of Virology 72, 3107-3116.
Miller, L. K., Jewell, J. E. & Brown, P. (1979). Baculovirus induction of a DNA polymerase. Journal of Virology 40, 305-308.
Pappin, D. J., Hojrup, P. & Bleasby, J. J. (1993). Rapid identification of proteins by peptide-mass fingerprinting. Current Biology 3, 327-332.[Medline]
Pearson, M., Bjornson, R., Pearson, G. & Rohrmann, G. (1992). The Autographa californica baculovirus genome. Evidence for multiple replication origins. Science 257, 1382-1384.
Pedrali-Noy, G. & Spadari, S. (1980). Mechanism of inhibition of herpes simplex virus and vaccinia virus DNA polymerases by aphidicolin, a highly specific inhibitor of DNA replication in eucaryotes. Journal of Virology 36, 457-464.
Rice, W. C. & Miller, L. K. (1986). Baculovirus transcription in the presence of inhibitors and in nonpermissive Drosophila cells. Virus Research 6, 155-172.[Medline]
Ross, L. & Guarino, L. A. (1997). Cylcoheximide inhibition of baculovirus early gene expression. Virology 232, 105-113.[Medline]
Sambrook, J., Fritsch, E. F. & Maniatis, T. (1989). Molecular Cloning: A Laboratory Manual, 2nd edn. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory.
Spadari, S., Sala, F. & Pedrali-Noy, G. (1982). Aphidicolin: a specific inhibitor of nuclear DNA replication in eukaryotes. Trends in Biological Science 7, 29-32.
Summers, M. D. & Smith, G. E. (1987). A Manual of Methods for Baculovirus Vectors and Insect Cell Cultures Procedures. Texas Agricultural Experiment Station Bulletin no. 1555.
Tomalski, M. D., Wu, J. & Miller, L. K. (1988). The location, sequence, transcription and regulation of a baculovirus DNA polymerase gene. Virology 167, 591-600.[Medline]
Wang, X. & Kelly, D. C. (1983). Baculovirus replication: purification and identification of the Trichoplusia ni nuclear polyhedrosis virus-induced DNA polymerase. Journal of General Virology 64, 2229-2236.
Wang, T. S. F., Copeland, W. C., Rogge, L. & Dong, Q. (1995). Purification of mammalian DNA polymerases: DNA polymerase
. Methods in Enzymology 262, 84-92.[Medline]
Wu, Y. T. & Carstens, E. B. (1998). A baculovirus single-stranded DNA binding protein, LEF-3, mediates the nuclear localization of the putative helicase P143. Virology 247, 32-40.[Medline]
Received 31 March 1999;
accepted 14 May 1999.
This article has been cited by other articles:
![]() |
E. A. Crouch and A. L. Passarelli Genetic Requirements for Homologous Recombination in Autographa californica Nucleopolyhedrovirus J. Virol., August 12, 2002; 76(18): 9323 - 9334. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Huang and D. B. Levin Expression, purification and characterization of the Spodoptera littoralis nucleopolyhedrovirus (SpliNPV) DNA polymerase and interaction with the SpliNPV non-hr origin of DNA replication J. Gen. Virol., July 1, 2001; 82(7): 1767 - 1776. [Abstract] [Full Text] [PDF] |
||||
![]() |
V. V. McDougal and L. A. Guarino The Autographa californica Nuclear Polyhedrosis Virus p143 Gene Encodes a DNA Helicase J. Virol., June 1, 2000; 74(11): 5273 - 5279. [Abstract] [Full Text] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| INT J SYST EVOL MICROBIOL | MICROBIOLOGY | J GEN VIROL |
| J MED MICROBIOL | ALL SGM JOURNALS | |