|
|
||||||||
Other Agents |
Institute for Experimental Pathology, University of Iceland, Keldur, IS-112 Reykjavík, Iceland1
Author for correspondence: Astridur Palsdottir.Fax +354 5673979. e-mail astripal{at}rhi.hi.is
| Abstract |
|---|
|
|
|---|
| Introduction |
|---|
|
|
|---|
Scrapie in sheep appears to be entirely an infectious disease with genetic susceptibility playing an important role (Dickinson et al., 1965
; Hunter et al., 1997a
). This susceptibility seems to be determined largely by genotypes of the PrP gene (Hunter et al., 1989
; Goldmann et al., 1990
). In sheep, polymorphisms of codons 136, 154 and 171 are the most important parameters (Belt et al., 1995
; Clouscard et al., 1995
; Hunter et al., 1996
). This polymorphism might influence the conversion of PrPC into PrPSc (Bossers et al., 1997
). The study of scrapie susceptibility is complicated by different PrP genotypes found in the different breeds and due to the possibility that several infectious scrapie strains may exist, each with a different affinity to host genotypes (Smits et al., 1997
).
There is only one breed of sheep in Iceland. It is an old breed which has been genetically isolated from other sheep breeds since its introduction by settlers from Scandinavia about 11 centuries ago. Scrapie of sheep was apparently brought to Iceland by an imported ram 120 years ago. The disease was confined to the northern part of the country for 70 years (Sigurdsson, 1954
; Pálsson, 1979
). In the late 1930s the country was divided by fences into 36 quarantine zones when a programme for eradication of the lentiviral disease of sheep, visna and maedi, was initiated. During the eradication all sheep in the endemic scrapie area were culled. Scrapie recurred following restocking with healthy sheep from outside the endemic area. In the early 1950s scrapie began to spread to other regions, but six quarantine zones have always remained scrapie-free. These six scrapie-free zones, located in three remote parts of the country, have according to records never been affected by this disease (Pálsson, 1979
; Sigurdarson, 1991
). In the last 20 years a scrapie eradication programme has been in force. The disease is notifiable and any scrapie case results in the culling of the entire flock, disinfection of the pens and a sheep-free period of 3 years, followed by restocking with sheep from the scrapie-free regions. Nevertheless, scrapie has recurred once, twice or three times on some farms, especially in the old endemic area (Sigurdarson, 1991
).
The aim of this study was to determine the PrP polymorphism in Icelandic sheep, especially in regard to scrapie incidence. For analysis of genotypes relating to risk, sheep affected with natural scrapie were compared to clinically healthy sheep from scrapie farms. Information on PrP genotype frequencies in the Icelandic sheep breed could possibly be used in breeding programmes as an additional strategy in the fight against this disease (Schreuder et al., 1997
; Dawson et al., 1998
). Of special interest was to compare PrP gene polymorphism in sheep from scrapie-free areas and healthy sheep from scrapie areas in regard to the question of whether scrapie can arise spontaneously in sheep with susceptible genotypes or if the disease is solely of infectious nature.
| Methods |
|---|
|
|
|---|
Sheep.The diagnosis of scrapie was based on clinical signs and confirmed by histological examination of three planes of section from medulla oblongata. In some cases immunohistochemical staining for PrP and/or Western blotting for PrPSc was also done.
DNA extraction and amplification.
High molecular mass DNA was isolated from blood or frozen (-20 °C) brain tissue (Sambrook et al., 1989
). DNA was later isolated from EDTA blood using Puregene kits (Gentra Systems) or from citrate blood using Chelex 100 (Walsh et al., 1991
). PCR amplifications of the PrP gene were performed in a 100 µl reaction volume containing 0·51 µg genomic DNA, 200 µM dNTPs, 1 µM of each primer, p8(+) (5' CAGGTTAACGATGGTGAAAAGCCACATAGG 3') and p143(-) (5' CTGGGATTCTCTCTGGTACTG 3') (Bossers et al., 1996
) and 2 U Dynazyme I DNA polymerase (Finnzymes). For Chelex DNA, 40 µl of solution was used in a 100 µl reaction. The amplification reactions were performed in a Techne thermal cycler II, one cycle of 1·5 min at 95 °C, 1·5 min at 58 °C and 1·5 min at 72 °C followed by 39 cycles of 1 min at 94 °C, 1·5 min at 58 °C and 1·5 min at 72 °C, ending with an extension incubation for 10 min at 72 °C.
Genotype analysis
RFLP analysis.
Polymorphisms at codons 136 and 154 were detected by RFLP analysis as described by Hunter et al. (1993
) using the restriction enzyme BspHI (New England Biolabs). Amplified DNA was digested without further purification. In each reaction pUC19 plasmid DNA was included as an internal control for complete digestion. Polymorphism at codon 151 in the PrP gene was detected by digestion of the PCR product p8-p143 (10 µl) with 4 U of the restriction enzyme AvaII (Pharmacia Biotech). In the wild-type (151-R/R), two fragments (447 and 231 bp) are produced by digestion with AvaII. When arginine (CGT) at codon 151 is replaced with cysteine (TGT), the AvaII restriction site is lost. Digests of 151-R/C heterozygotes therefore show three fragments (678, 447 and 231 bp), while 151-C/C homozygotes are uncut (678 bp only).
DGGE analysis.
Density gradient gel electrophoresis (DGGE) was performed, firstly, to detect polymorphism at codon 171, and also to screen for other polymorphisms. By this method a mismatch of only one nucleotide can be detected as a formation of new heteroduplex bands located above the homoduplex bands. Ten µl of denatured PCR products covering codons 1226 of the PrP gene, produced by using primers p8 and p143, was used directly in denaturant gradient gels which were prepared and run according to Belt et al. (1995
). Samples of known allotypes in regard to codons 136, 154 and 171 (ARR, ARQ, ARH and AHQ) were added as controls in each gel.
Sequencing.
DNA sequencing was performed on both strands of the PCR products using an ALFexpress automated sequencer (Pharmacia Biotech). Before sequencing, the PCR products were treated with Exonuclease I and shrimp alkaline phosphatase (Amersham). Cycle sequencing (Amersham kit US 78500) was performed using either one of the fluorescent-labelled primers, p95(+) (5'F CAAGGTGGTAGCCACAGTCAG 3') or p182(-) (5'F ACAGTCATGCACAAAGTTG 3'). The primers p95 and p182 refer to bp 354374 and 597617 of the PrP sheep sequence, respectively, (Goldmann et al., 1990
).
Statistical analysis.
The results were analysed statistically using the
2 test for independence or the Fisher's exact test to compare frequencies of alleles and allelic variants between groups.
Descriptions of PrP genotypes.
In tables and text genotypes are described by the single letter amino acid code: A, alanine; C, cysteine; H, histidine; N, asparagine; Q, glutamine; R, arginine; T, threonine; V, valine. If not otherwise indicated the letters refer to amino acids at codons 136, 154 and 171, in that order.
| Results |
|---|
|
|
|---|
Table 1
shows genotype frequencies at codons 136, 154 and 171 of the sheep PrP gene. These results were derived from RFLP analysis using the restriction enzyme BspHI and DGGE.
|
Codon 154. The large majority of the sheep, between 88% and 95%, were carrying arginine (R) on both alleles at this location of the PrP gene. 154-Histidine (H)/R heterozygotes made up the rest, i.e. 11·1% and 4·9% of sheep from scrapie-free and scrapie regions, respectively. Statistical analysis showed a significant difference between the two groups in regard to allelic frequencies at this codon (
2=6·95, P<0·01) because of the higher incidence of 154-H in scrapie-free areas. Only one 154-H/H homozygote was found among the 932 sheep (from all groups) included in this study. An additional 154-H/H homozygote has been detected in the same flock from a scrapie-free region (unpublished results).
Codon 171. No polymorphism was found at this codon. Only the glutamine (Q) allele was found at codon 171 in a total of 932 sheep included in this study. Because of this apparent lack of polymorphism, a special effort was made to collect samples from as many different farms as possible.
This limited polymorphism in the prion gene of the Icelandic sheep breed described above makes up only three allelic variants, ARQ, VRQ and AHQ, in regard to the three codons 136, 154 and 171, resulting in six different genotypes (Table 2
).
|
2=5·10, P<0·05), but its incidence there was restricted to only one farm.
|
|
ACG), resulting in a replacement of methionine with threonine, has been reported before in the ovine PrP gene of Texel and Flemish breeds in Holland (Bossers et al., 1996
A new polymorphism at codon 138 was detected by DNA sequencing of samples showing two new heterozygote bands in the DGGE analysis (Fig. 1
, lane 5). A nucleic acid transition, G
A, results in a substitution of the amino acid serine (AGC) with asparagine (AAC). This allelic variant, AN138RQ, was found in approximately 10% of the sheep (Table 2
).
The second novel allelic variant we discovered at codon 151 was a nucleic acid transition (C
T), resulting in an amino acid substitution, with cysteine (TGT) replacing arginine (CGT). The polymorphism at this location was initially discovered because of conflicting results from the RFLP and DGGE analysis. Samples undigested by the restriction enzyme BspHI gave a DGGE band pattern identical to that of 154-H/R heterozygotes of the genotype ARQ/AHQ. The ARQ/AC151RQ genotype was therefore indistinguishable from ARQ/AHQ by DGGE analysis (Fig. 1
, compare lanes 3 and 10). After using DNA sequencing to determine the polymorphism at this codon, it became clear that the C151 allele could also be detected by RFLP analysis using the restriction enzyme AvaII, which recognizes the sequence G
GACC. The restriction site, on the PrP wild-type allele (ARQ/ARQ), spanning codons 149151, is lost when codon 151 changes from CGT to TGT. A few individuals carrying this allele were found in sheep from scrapie-free (3·5%) and scrapie regions (0·4 %) (Table 2
).
Association of PrP genotypes with natural scrapie
Codon 136. The frequency of the 136-V allele in 101 scrapie sheep was considerably higher than in the healthy sheep from scrapie flocks. The difference was highly significant (
2=71·14, P<0·0001) (Table 3
). While 12·9% of the scrapie sheep were homozygotes for valine at codon 136, only 1·9% of the control group carries this genotype. In a similar manner the frequency of 136-V/A heterozygotes increased from 15·0% in the control group, to 40·6% of the scrapie sheep. We can therefore conclude that the 136-V allele confers a definite risk of scrapie infection to the Icelandic sheep breed.
|
2=4·57, P<0·05). Therefore, the possibility exists that the 154-H allele offers some protection against scrapie infection in Icelandic sheep.
Codon 171. No polymorphism was found at this location in Icelandic sheep, as shown in Tables 1
and 3
.
Genotypes and allelic variants
We detected altogether 14 genotypes in scrapie sheep and healthy sheep from scrapie flocks, five of which were shared by both groups (Table 4
). Comparison between the groups of the frequency as well as statistical analysis of the six allelic variants was done with the following results (Table 4
).
ARQ. The percentage of scrapie sheep that are homozygous for the 136-A allele was very high. Still this allele seems to offer some protection against scrapie as the A/A homozygotes constituted 83·2% of the control sheep but only 46·5% of the scrapie sheep (Table 3
). When comparing the frequency of ARQ between scrapie-affected and healthy sheep, a statistically significant difference was found (
2=21·15, P<0·0001), suggesting an effect of lower risk by this allelic variant (Table 4
). In six cases where the scrapie-affected sheep was an ARQ homozygote, ARQ/VRQ individuals were found among the healthy sheep in the affected flock.
VRQ. As the 136-V allele always occurred on the VRQ allelic variant it is not possible to separate the effect of having 136-V from the risk of having the 154-R allele. A highly significant difference (P<0·0001) was found when the frequency of VRQ in scrapie-affected sheep was compared to the control sheep (Table 4
). The VRQ allelic variant can therefore be classified as a high-risk PrP genotype in Icelandic sheep.
AHQ. The AHQ allelic variant was not found in the scrapie sheep. Statistical analysis showed a significant difference between the scrapie-affected and control animals (
2=4·57, P<0·05). The AHQ allelic variant can therefore be classified as a low-risk PrP genotype, at least in Icelandic sheep.
AT137RQ. Individuals carrying AT137RQ were seen at low frequency (0·8%) in healthy sheep from scrapie flocks but were not found among the scrapie sheep, but the frequency of this variant in the control group is so low (0·4%) that nothing can be concluded about association with scrapie susceptibility.
AN138RQ. The incidence of the N138 allele was 3% in the scrapie-affected sheep (6% of individuals) and 4·8% in the control (9·7% of individuals). This difference was not statistically significant (P>0·05) (Table 4
).
AC151RQ. C151 was not found in scrapie sheep, whereas 5·6% of healthy sheep from scrapie-affected flocks were carrying this allele (Table 4
). Comparable numbers from the breed survey were 0·4% and 3·5% (Table 2
). The difference in frequency between the control groups is derived from an unusually high incidence of C151 in one scrapie-affected flock (26%, data not shown), probably caused by inbreeding. For example, two new genotypes, in which C151 is included (AC151RQ/AC151RQ and AN138RQ/AC151RQ), were only found in this particular flock. The frequency of this allelic variant was found to be significantly different in the two groups compared in Table 4
(P<0·05), but because of the high incidence of C151 in this one particular scrapie flock, these results can not be used to draw any conclusions about Icelandic sheep in general.
| Discussion |
|---|
|
|
|---|
Only the glutamine allele was found at codon 171. The absence of a codon 171 polymorphism in the PrP gene in the Icelandic sheep is striking and could be due to a founder effect dating back to the time of settlement, about 870 AD, or the result of genetic bottlenecks since. It is also possible that 171-R (or H) is so rare in Iceland that present sampling missed it even though we have now sampled almost 0·2% of the total sheep population of Iceland, making a special effort to get samples from all regions. This is the only sheep breed known to lack polymorphism at codon 171. All other breeds of sheep studied so far have shown a polymorphism at this codon, with arginine being a common allele and histidine being a rare variant, except in the Texel and the Lacaune breeds (Belt et al., 1995
; Clouscard et al., 1995
).
The use of DGGE enabled us to detect two new alleles within the prion gene, i.e. asparagine and cysteine at codons 138 and 151, respectively, which were confirmed by DNA sequencing. It is interesting to note that the only codon 151-C homozygote found looked like the AHQ homozygote on the DGGE gel but could be detected using the AvaII restriction analysis. The amino acid substitution arginine to cysteine is expected to be in the middle of the first
-helix of the PrPC protein by comparison with the mouse PrP protein (Riek et al., 1996
), and the unpaired cysteine could lead to an unstable protein. However, preliminary studies of the codon 151-C homozygote by Western blotting indicate that the PrPC levels are normal (unpublished results). Both amino acid substitutions were found on a PrP ARQ background, which seems to be the ancestral genotype in sheep. A cluster of polymorphic amino acids in the ovine PrP gene, spanning the amino acids 136171, is beginning to emerge.
A total of 16 genotypes were found in Icelandic sheep, of which nine occur at frequencies less than 1%. All sheep studied were found to have the same length of PCR products, indicating that all sheep had the same number of octarepeats in the PrP gene. Neither the 112-T (threonine) allele found in the Ile de France breed (Laplanche et al., 1993a
) nor the 141-F (phenylalanine) allele found in the Cheviot breed (Hunter et al., 1996
) were found.
As can be seen from Table 3
the 136-V allele can be classified as a high-risk for scrapie infection in Icelandic sheep. In this respect the Icelandic sheep resemble breeds with valine at codon 136, i.e. Cheviots, Swaledales and the Shetlands, where the VRQ homozygotes are extremely susceptible to scrapie (Hunter et al., 1993
, 1994
, 1996
). Sheep of these breeds are less likely to get scrapie if they are heterozygous for codon 154-H or codon 171-R (Hunter et al., 1996
).
One VRQ homozygote (60 months old) was found in a total of 171 genotyped sheep in the scrapie-free regions (at a frequency of 0·6%). An experimental breeding programme for increasing scrapie resistance by selecting for low-risk PrP genotyped animals has recently been started in Iceland. Genotyping of 442 sheep from scrapie-free regions using the BspHI analysis only identified six (1·4%) individuals, three ewes and three rams, homozygous for 136-V and 154-R. They were between 12 and 84 months old, with a mean of 48 months (unpublished results). This means that in the scrapie-free zones, with approximately 47000 sheep and an average frequency of 1%, there are estimated to be 470 VRQ homozygotes. In the last two decades the scrapie-free zones have traditionally been used to restock scrapie-infected farms after total culling of sheep. The scrapie-free areas in Iceland are equivalent to New Zealand and Australia, where scrapie has been averted due to strict quarantine measures (Hunter et al., 1997a
). Scrapie-susceptible sheep do indeed exist in these scrapie-free countries (Hunter et al., 1997a
; Hunter & Cairns, 1998
). Our results lend further support to the view that scrapie is solely an infectious disease, where incidence is controlled by the availability of the infectious agent and genetically susceptible sheep.
The AHQ allelic variant was not found in scrapie sheep. All scrapie sheep studied so far were homozygous for the codon 154-R allele compared to 94·4% of the control group, i.e. healthy sheep in scrapie flocks. This difference in allele frequency is statistically significant. The same applies when sheep from scrapie-free farms located in scrapie regions are compared to sheep from the scrapie-free regions in the breed survey, where a slightly lower incidence of the 154-R allele is found in the latter (97·5% and 93·9%, respectively). In Cheviot sheep and the Texel breed the AHQ allelic variant seems to be associated with resistance to scrapie (Hunter et al., 1996
; Belt et al., 1995
). In other studies it is absent in scrapie sheep (Laplanche et al., 1993a
; Ikeda et al., 1995
), but in each case the numbers were too low to be significant. On the other hand, in Romanov, Suffolk and the Finn Dorset sheep the codon 154-H allele is present in both scrapie sheep and healthy animals (Elsen et al., 1999
; Hunter et al., 1997b
; Dawson et al., 1998
).
The high percentage of Icelandic sheep homozygous for the ARQ allelic variant (65%) is reflected in the high number of scrapie sheep (42%). In other breeds, scrapie incidence in the ARQ/ARQ homozygotes is very variable. In 136-V-encoding breeds, such as the Poll Dorset and the Romanov breeds, 136-A homozygotes are susceptible if they are also homozygous for 171-Q (Hunter et al., 1997c
). Similarly, 136-A homozygotes are most susceptible in the Suffolk and in some French breeds, where the 136-V allele is extremely rare and the codon 171 polymorphism is more important (Hunter et al., 1997b
; Laplanche et al., 1993b
; Westaway et al., 1994
).
The 138-N allele seems to be neutral with regard to scrapie susceptibility, while the association of the 151-C allele to scrapie susceptibility is still unknown due to the low frequency of this variant. An analysis of one particular scrapie flock showed an unusually high incidence of this allele (26%). In this flock the 151-C allele was neither found in sheep with definite scrapie nor in the 23% of sheep with questionable scrapie lesions according to histological and immunohistochemical examination (unpublished results). Thus, the 151-C allele may have a protective effect with regard to scrapie susceptibility.
| Acknowledgments |
|---|
| References |
|---|
|
|
|---|
Bendheim, P. E., Brown, H. R., Rudelli, R. D., Scala, L. J., Goller, N. L., Wen, G. Y., Kascsak, R. J., Cashman, N. R. & Bolton, D. C. (1992). Nearly ubiquitous tissue distribution of the scrapie agent precursor protein. Neurology 42, 149-156.
Bossers, A., Schreuder, B. E. C., Muileman, I. H., Belt, P. B. G. M. & Smits, M. A. (1996). PrP genotype contributes to determining survival times of sheep with natural scrapie. Journal of General Virology 77, 2669-2673.
Bossers, A., Belt, P. B. G. M., Reymond, G. J., Caughey, B., DeVries, R. & Smits, M. A. (1997). Scrapie susceptibility-linked polymorphisms modulate the in vitro conversion of sheep prion protein to protease-resistant forms. Proceedings of the National Academy of Sciences, USA 94, 4931-4936.
Clouscard, C., Beaudry, P., Elsen, J. M., Milan, D., Dussaucy, M., Bounneau, C., Schelcher, F., Chatelain, J., Launay, J. M. & Laplanche, J. L. (1995). Different allelic effects of the codons 136 and 171 of the prion protein gene in sheep with natural scrapie. Journal of General Virology 76, 2097-2101.
Dawson, M., Hoinville, L. J., Hoise, B. & Hunter, N. (1998). Guidance on the use of PrP genotyping as an aid to the control of clinical scrapie. Veterinary Record 142, 623-625.[Medline]
Dickinson, A. G., Young, G. B., Stamp, J. T. & Renwick, C. C. (1965). An analysis of natural scrapie in Suffolk sheep. Heredity 20, 485-503.[Medline]
Elsen, J.-M., Amigues, Y., Schelcher, F., Ducrocq, V., Andreoletti, O., Eychenne, F., Tien Khang, J. V., Poivey, J.-P., Lantier, F. & Laplanche, J.-L. (1999). Genetic susceptibility and transmission factors in scrapie: detailed analysis of an epidemic in a closed flock of Romanov. Archives of Virology 144, 431-445.[Medline]
Goldmann, W., Hunter, N., Foster, J. D., Salbaum, J. M., Beureyther, K. & Hope, J. (1990). Two alleles of a neural protein gene linked to scrapie in sheep. Proceedings of the National Academy of Sciences, USA 87, 2476-2480.
Horiuchi, M., Yamazaki, N., Ikeda, T., Ishiguro, N. & Shinagawa, M. (1995). A cellular form of prion protein (PrPC) exists in many non-neuronal tissues of sheep. Journal of General Virology 76, 2583-2587.
Hunter, N. & Cairns, D. (1998). Scrapie-free Merino and Poll Dorset sheep from Australia and New Zealand have normal frequencies of scrapie-susceptible PrP genotypes. Journal of General Virology 79, 2079-2082.[Abstract]
Hunter, N., Foster, J. D., Dickinson, A. G. & Hope, J. (1989). Linkage of the gene for the scrapie-associated fibril protein (PrP) to the Sip gene in Cheviot sheep. Veterinary Record 124, 364-366.[Abstract]
Hunter, N., Goldmann, W., Benson, G., Foster, J. D. & Hope, J. (1993). Swaledale sheep affected by natural scrapie differ significantly in PrP genotype frequencies from healthy sheep and those selected for reduced incidence of scrapie. Journal of General Virology 74, 1025-1031.
Hunter, N., Goldmann, W., Smith, G. & Hope, J. (1994). The association of codon 136 PrP gene variant with the occurrence of natural scrapie. Archives of Virology 137, 171-177.[Medline]
Hunter, N., Foster, J. D., Goldmann, W., Stear, M. J. & Bostock, C. (1996). Natural scrapie in a closed flock of Cheviot sheep occurs only in specific PrP genotypes. Archives of Virology 141, 809-824.[Medline]
Hunter, N., Cairns, D., Foster, J. D., Smith, G., Goldmann, W. & Donnelly, K. (1997a). Is scrapie solely a genetic disease? Nature 386, 137.[Medline]
Hunter, N., Moore, L., Hosie, B. D., Dingwall, W. S. & Greig, A. (1997b). Association between natural scrapie and PrP genotype in a flock of Suffolk sheep in Scotland. Veterinary Record 140, 59-63.
Hunter, N., Goldmann, W., Foster, J. D., Cairns, D. & Smith, G. (1997c). Natural scrapie and PrP genotype: case-control studies in British sheep. Veterinary Record 141, 137-140.
Ikeda, T., Horiuchi, M., Ishiguro, N., Muramatsu, Y., Kai-Uwe, G. D. & Shinagawa, M. (1995). Amino acid polymorphisms of PrP with reference to onset of scrapie in Suffolk and Corriedale sheep in Japan. Journal of General Virology 76, 2577-2581.
Laplanche, J. L., Chatelain, J., Westaway, D., Thomas, S., Dussaucy, M., Brugere-Picoux, J. & Launay, J. M. (1993a). PrP polymorphism associated with natural scrapie discovered by denaturing gradient gel electrophoresis. Genomics 15, 30-37.[Medline]
Laplanche, J. L., Chatelain, J., Beaudry, P., Dussaucy, M., Bounneau, C. & Launay, J. M. (1993b). French autochthonous scrapied sheep without the 136Val PrP polymorphism. Mammalian Genome 4, 463-464.
Pálsson, P. A. (1979). Rida (scrapie) in Iceland and its epidemiology. In Slow Transmissible Diseases of the Nervous System, pp. 357-366. Edited by S. B. Prusiner & W. J. Hadlow. New York: Academic Press.
Prusiner, S. B. (1991). Molecular biology of prion diseases. Science 252, 1515-1522.
Prusiner, S. B. (1998). Prions. Proceedings of the National Academy of Sciences, USA 95, 13363-13383.
Riek, R., Hornemann, S., Wider, G., Billeter, M., Glockshuber, R. & Wüthrich, K. (1996). NMR structure of the mouse prion protein domain PrP(121231). Nature 382, 180-182.[Medline]
Sambrook, J., Fritsch, E. F. & Maniatis, T. (1989). Molecular Cloning: A Laboratory Manual, 2nd edn. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory.
Schreuder, B. E. C., van Keulen, L. J. M., Smits, M. A. & Langveld, J. P. M. (1997). Control of scrapie eventually possible? Veterinary Quarterly 19, 105-113.[Medline]
Sigurdarson, S. (1991). Epidemiology of scrapie in Iceland and experience with control measures. In Sub-Acute Spongiform Encephalopathies, pp. 233-242. Edited by R. Bradley, M. Savey & B. Marchant. Dordrecht: Kluwer Academic.
Sigurdsson, B. (1954). Rida, a chronic encephalitis of sheep. British Veterinary Journal 110, 341-354.
Smits, M. A., Bossers, A. & Schreuder, B. E. C. (1997). Prion protein and scrapie susceptibility. Veterinary Quarterly 19, 101-105.[Medline]
Walsh, P. S., Metzger, D. A. & Higuchi, R. (1991). Chelex 100 as a medium for simple extraction of DNA for PCR-based typing from forensic material. Biotechniques 10, 506-513.[Medline]
Westaway, D., Zuliani, V., Cooper, C. M., Da Costa, M., Neuman, S., Jenny, A. L., Detwiler, L. & Prusiner, S. B. (1994). Homozygosity for the prion protein alleles encoding glutamine-171 renders sheep susceptible to natural scrapie. Genes and Development 8, 959-969.
Received 14 April 1999;
accepted 2 June 1999.
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| INT J SYST EVOL MICROBIOL | MICROBIOLOGY | J GEN VIROL |
| J MED MICROBIOL | ALL SGM JOURNALS | |