|
|
||||||||
Animal: RNA Viruses |
INSERM U332, Institut Cochin de Génétique Moléculaire, 22 rue Méchain, 75014 Paris, France1
Department of Medicine, University of Cambridge, Level 5, Addenbrookes Hospital, Cambridge CB2 2QQ, UK2
Author for correspondence: Andrew Lever. Fax +44 1223 336846. e-mail amll1{at}mole.bio.cam.ac.uk
| Abstract |
|---|
|
|
|---|
| Main text |
|---|
|
|
|---|
Retroviruses carry two copies of their genome which, on electron microscopy studies, appear to be linked at the 5' end (Bender et al., 1978
; Murti et al., 1981
). The conservation of the diploid genome, and of the dimer linkage site in retroviruses, suggests both are important, although it does not necessarily follow that they are functionally related. The dimer linkage has been postulated to contribute to the genomic RNA encapsidation signal (Katoh et al., 1993
; Torrent et al., 1994
; Harrison et al., 1998
; Bender et al., 1978
). In addition, by physically linking the two RNA molecules, it may enhance the capacity for recombination between the two virus strands (Bender et al., 1978
; Mikkelsen et al., 1996
, 1998
; Marquet et al., 1991
; Wu & Temin, 1990
). The molecular interactions involved in dimer linkage are, as yet, unknown. Purine tetrads have been invoked in structures analogous to telomeres, although this now seems less likely to be the major type of molecular interaction (Marquet et al., 1991
). The interaction is too stable in vitro to be explained by WatsonCrick base pairs alone. Recently, it has been noted that palindromic sequences are commonly associated with dimer linkage sites (Haddrick et al., 1996
; Laughrea & Jette, 1996
; Muriaux et al., 1996
; Paillart et al., 1996
). In a nuclear magnetic resonance study of the dimer linkage structure of human immunodeficiency virus type 1 (HIV-1), distorted loops were proposed to join by WatsonCrick pairing at an autocomplementary loop in the 5' leader upstream of the splice donor in what is known as the kissing hairpin interaction (Mujeeb et al., 1998
). Mutations of this region in HIV-1 have been performed by a number of groups. The conclusion from this work is that inhibiting dimerization can reduce virus encapsidation up to 5-fold and infectivity of the virions can be reduced up to 1000-fold compared to wild-type, although other data suggests that the defect is less severe (Berkhout & van Wamel, 1996
; Haddrick et al., 1996
; Harrison et al., 1998
; Laughrea & Jette, 1996
; Laughrea et al., 1997
; Muriaux et al., 1996
).
We have previously published an extensive deletion and mutagenic analysis of the 5' leader of HTLV-I in which we have identified a 32 base region, deletion of which leads to abrogation of dimerization of in vitro transcribed HTLV-I RNA (Greatorex et al., 1996
; Delamarre et al., 1997
). Dimeric HTLV-I RNA is extremely stable to 70 °C and above and remains dimeric, even in formaldehyde-containing gels. Thus, the RNA association is extremely stable. Although our previous mutagenesis identified a region necessary for dimerization, it was not clear whether the same region would be sufficient to form RNA dimers. We therefore proceeded with further 5' and 3' truncations of the HTLV-I leader sequence in the transcriptional unit previously described (Greatorex et al., 1996
) (Fig. 1a
). The end column (Dimer formation) indicates whether or not a dimer was formed. Shown in Fig. 1(b)
is dimer production of the truncated and full-length transcripts. Transcripts were unheated (-) and heated (+, 80 °C for 3 min) to produce monomer and then diluted in dimer buffer (250 mM cacodylic acid, 40 mM KCI and 5 mM MgCI) and run out on 2% (lanes 16) or 5% (lanes 710) Metaphor (Flowgen) agarose gels. Transcripts were labelled with [32P]UTP (ICN) incorporated during transcription. Lanes 1 and 2, 3 and 4, 5 and 6, 7 and 8, 9 and 10 are the full-length (531 bp) RNA transcript or pG11
561, pG11
735, pG11
735-
817 and pG11
735-
772 transcripts, heated and unheated respectively. We were able to demonstrate that an in vitro transcript of only 37 bases encompassing the 32 bp DM2 deletion formed a predominantly dimeric molecule (Fig. 1b
, lane 10). To ensure this was not an artefact of the transcriptional process and to attempt finer mapping, RNA was chemically synthesized using an ABI 394 DNA/RNA synthesizer that corresponded to a 22 bp region capable by MFOLD analysis of forming secondary structure (CUAUAGCACUAUCCAGGAGAGA) contained within the 37 bp sequence (Fig. 1c
). RNA was diluted (1 µg/µl) in dimer buffer as before, and run out on 5% Metaphor agarose (Fig. 1c
, lane 1). The chemically synthesized RNA was dimeric under the same conditions as those used for in vitro transcription. The RNA dimer formed by this oligomer was extremely stable, failing to dissociate even when heated at 80 °C for 3min. KEN5, a control RNA, was a hairpin representing the U1 SNRNA stemloop II (CUACCAUUGCACUCCGGAUGU, a kind gift from C. Oubridge) diluted 1 µg/µl and used as a size marker which does not dimerize (Fig. 1c
, lane 2).
|
DM2. The EcoRVPstI fragment was then subcloned back into pCS-HTLV-neo, a provirus clone in which the env gene has been replaced by the neomycin resistance gene under the control of the SV40 promoter. The resulting construct was named pCS-
DM2-neo.
We examined whether deletion of the 32 bp dimerization sequence had an effect on HTLV-I protein expression and virus particle production. To do so, COS-1 cells were transiently transfected with either wild-type pCS-HTLV-neo or the pCS-
DM2-neo, and HTLV proteins were sought in the transfected cell lysates and supernatants. Lysates and virus pellet samples were collected, fractionated by SDSPAGE and immunoblotted to detect Gag proteins. Immunoblotting was carried out using sera from HTLV-I-infected individuals as primary antibodies and 125I-labelled protein A as the visualization step. C91PL HTLV-I-infected cells were used as a positive control, and transfection with a Tax-only expressing plasmid (Fig. 2
, lane 2) used to standardize protein loading. The amounts of Gag proteins produced by pCS-
DM2-neo were similar to those produced by the wild-type construct (Fig. 2a
, b
). Fig. 2(a)
shows the cell lysates. In the first lane is a positive control, C91PL HTLV-I-infected cells. The second lane contains cell lysate from a mock control and the third and fourth lanes contain lysates from wild-type and the provirus with the dimerization site removed respectively. The Gag protein precursor, a 55 kDa protein from HTLV-I, underwent normal intracellular maturation and was normally cleaved into mature Gag proteins, as shown by the normal amounts of capsid (CA-p24) and matrix (MA-p19) proteins obtained. Analysis of the proteins in the cell supernatant showed that the deletion had no effect on virus particle production (Fig. 2b
, lanes as in a).
|
|
| Acknowledgments |
|---|
| References |
|---|
|
|
|---|
Berkhout, B. & van Wamel, J. L. B. (1996). Role of the DIS hairpin in replication of human immunodeficiency virus type 1. Journal of Virology 70, 6723-6732.
Delamarre, L., Rosenberg, A., Pique, C., Pham, D. & Dokhélar, M.-C. (1997). A novel human T-leukemia virus type 1 cell-to-cell transmission assay permits definition of SU glycoprotein amino acids important for infectivity. Journal of Virology 71, 259-266.[Abstract]
Greatorex, J. S., Laisse, V., Dokhelar, M.-C. & Lever, A. M. L. (1996). Sequences involved in the dimerisation of human T-cell leukaemia virus type-1 RNA. Nucleic Acids Research 24, 2919-2923.
Haddrick, M., Lear, A. L., Cann, A. J. & Heaphy, S. (1996). Evidence that a kissing loop structure facilitates genomic RNA dimerisation in HIV-1. Journal of Molecular Biology 259, 58-68.[Medline]
Harrison, G. P., Miele, G., Hunter, E. & Lever, A. M. L. (1998). Functional analysis of the core packaging signal in a permissive cell line. Journal of Virology 72, 5886-5896.
Katoh, I., Yasunaga, T. & Yoshinaka, Y. (1993). Bovine leukaemia virus RNA sequences involved in dimerization and specific gag protein binding: close relation to the packaging sites of avian, murine, and human retroviruses. Journal of Virology 67, 1830-1839.
Laughrea, M. & Jette, L. (1996). Kissing-loop model of HIV-1 genome dimerization: HIV-1 RNAs can assume alternative dimeric forms, and all sequences upstream or downstream of hairpin 248271 are dispensable for dimer formation. Biochemistry 35, 1589-1598.[Medline]
Laughrea, M., Jette, L., Mak, J., Kleiman, L., Liang, C. & Wainberg, M. A. (1997). Mutations in the kissing-loop hairpin of human immunodeficiency virus type 1 reduce viral infectivity as well as genomic RNA packaging and dimerization. Journal of Virology 71, 3397-3406.[Abstract]
Marquet, R., Baudin, F., Gabus, C., Darlix, J. L., Mougel, M., Ehresmann, C. & Ehresmann, B. (1991). Dimerization of human immunodeficiency virus (type 1) RNA: stimulation by cations and possible mechanism. Nucleic Acids Research 19, 2349-2357.
Mikkelsen, J. G., Lund, A. H., Kristensen, K. D., Duch, M., Sorensen, M. S., Jorgensen, P. & Pedersen, F. S. (1996). A preferred region for recombinational patch repair in the 5' untranslated region of primer binding site-impaired murine leukemia virus vectors. Journal of Virology 70, 1439-1447.[Abstract]
Mikkelsen, J. G., Lund, A. H., Duch, M. & Pedersen, F. S. (1998). Recombination in the 5' leader of murine leukemia virus is accurate and influenced by sequence identity with a strong bias towards the kissing-loop dimerization region. Journal of Virology 72, 6967-6978.
Mujeeb, A., Clever, J. L., Billeci, T. M., James, T. L. & Parslow, T. G. (1998). Structure of the dimer initiation complex of HIV-1 genomic RNA. Nature Structural Biology 5, 432-436.[Medline]
Muriaux, D., Fosse, P. & Paoletti, J. (1996). A kissing complex together with a stable dimer is involved in the HIV-1Lai RNA dimerization process in vitro. Biochemistry 35, 5075-5082.[Medline]
Murti, K. G., Bondurant, M. & Tereba, A. (1981). Secondary structural features in the 70S RNAs of Moloney murine leukemia and Rous sarcoma viruses as observed by electron microscopy. Journal of Virology 37, 411-419.
Paillart, J. C., Skripkin, E., Ehresmann, B., Ehresmann, C. & Marquet, R. (1996). A looploop kissing complex is the essential part of the dimer linkage of genomic HIV-1 RNA. Proceedings of the National Academy of Sciences, USA 93, 5572-5577.
Torrent, C., Gabus, C. & Darlix, J.-L. (1994). A small and efficient dimerization/packaging signal of rat VL30 RNA and its use in murine leukemia virusVL30-derived vectors for gene transfer. Journal of Virology 68, 661-667.
Wu, W.-S. & Temin, H. M. (1990). Genetic consequences of packaging two RNA molecules in one retroviral particle: pseudodiploidy and high rate of genetic recombination. Proceedings of the National Academy of Sciences, USA 87, 1556-1560.
Received 24 June 1999;
accepted 22 September 1999.
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| INT J SYST EVOL MICROBIOL | MICROBIOLOGY | J GEN VIROL |
| J MED MICROBIOL | ALL SGM JOURNALS | |