|
|
||||||||
Animal: RNA Viruses |
Departments of Molecular Microbiology and Immunology1 and Neurology2, USC School of Medicine, 2011 Zonal Avenue, Los Angeles, CA 90033-1054, USA
Author for correspondence: Stanley Tahara (at Department of Molecular Microbiology and Immunology). Fax +1 323 442 1721. e-mail stahara{at}hsc.usc.edu
| Abstract |
|---|
|
|
|---|
| Introduction |
|---|
|
|
|---|
Coronaviral mRNAs are synthesized via a discontinuous transcription process. MHV viral leader RNA is transcribed from the 3'-end of the (-)-sense genome RNA as an independent species 5090 nt in length (Brayton et al., 1982
; Spaan et al., 1993
; Lai, 1990
). Leader RNA is joined to subgenomic mRNA body sequences in a unique process either in cisor in trans at the initiation of transcription or shortly thereafter. Templates for virus transcription include the full-length genome as well as subgenomic replicons corresponding to viral genes. Several models have been proposed for this process; however, this is still an active area with no consensus (Shieh et al., 1987
; Sethna et al., 1989
; Sawicki & Sawicki, 1990
; Jeong & Makino, 1994
). Nonetheless, the result of virus transcription is production of a nested set of subgenomic mRNAs which have identical 5'-untranslated regions (UTRs) attached to body sequences with co-terminal 3'-ends.
The N protein is the major structural protein element of coronavirus virions and is encoded by gene 7 of the viral genome. Its mRNA is the most abundant viral mRNA species, which is consistent with high intracellular accumulation of the protein during infection (Lai & Cavanagh, 1997
). It is phosphorylated in vivo (Stohlman & Lai, 1979
) although nothing is known of the physiological consequence of such covalent modification. A primary function of N protein is formation of RNP complexes during assembly; in addition, it has been proposed to be multifunctional with additional roles in replication, transcription and translation (Tahara et al., 1994
, 1998
; Lai & Cavanagh, 1997
).
General nucleic acid-binding activity of the MHV N protein was first shown using an RNA blot overlay (NorthWestern) assay (Robbins et al., 1986
). Using a similar approach, it was found that the N protein had high affinity for the leader RNA in the presence of non-specific competitor RNA. These studies localized the specific RNA sequence for N protein association to the 3'-proximal region of leader RNA from bases 56 to 72 (Stohlman et al., 1988
), which includes the pentanucleotide repeat (UCUAA) critical for virus transcription (Lai & Cavanagh, 1997
). Viral RNA associated with N protein during infection was analysed by co-immunoprecipitation. The data showed that all viral mRNAs, genomic and free leader RNA are equivalent in their ability to associate with N protein; the co-precipitated RNAs, thus, have one or more copies of tightly associated N protein (Baric et al., 1988
). Binding of N protein to viral mRNAs and genomic RNA presumably occurs through an interaction with viral leader RNA sequences, since the leader sequence is a common component of these RNA species. N protein was recently shown to bind the viral encapsidation signal found in the 3'-proximal region of gene 1b (Molenkamp & Spaan, 1997
). The relationship of this activity of the N protein to its ability to bind leader RNA is not known.
Comparison of the N proteins of five MHV strains revealed that conserved amino acid residues are found in three distinct domains (numbering and net charge, in parentheses, refer to MHV-A59 N protein): domain I (1139, basic); domain II (163380, basic); and domain III (406455, acidic) (Parker & Masters, 1990
). Strain-specific sequence variations were found primarily in gaps between the three domains, suggesting that sequence conservation is needed to retain strain-independent N protein functions. Analysis of these conserved domains may yield insight into the many activities exhibited by this single viral protein. A general RNA-binding domain (RBD) of N protein was initially determined to reside within residues 136397 (Masters, 1992
). Subsequently, a specific RBD was determined by Nelson & Stohlman (1993)
to reside between residues 169308 of the A59 strain of MHV (MHV-A59) and confirmed via a molecular recombination approach. Analysis of chimeric N proteins derived from bovine coronavirus (BCoV) and MHV suggests that RNA-binding activity resided in residues 163380 (Peng et al., 1995
). The basic charge characteristic of this region is consistent with an RNA-binding function; however, it does not have homology to previously described RNA-binding motifs. Analysis of the RNA-binding properties of the N protein may provide insight into its functions as a potential trans-acting factor of viral mRNA translation and as a participant in other virus processes requiring RNAprotein interactions, e.g. transcription and encapsidation.
The data in this report demonstrate that the RBD of the N protein resides within a central 55 aa tract. In addition, the minimum RNA sequence serving as ligand for N protein has been identified based on specific, high affinity binding. This relationship of the N protein to its RNA ligand has important implications for virus processes which target this RNA sequence during infection.
| Methods |
|---|
|
|
|---|
Bacterial expression of JHMV N protein.
|
|
The N protein and several subdomains were also subcloned into pGEX-3X (Pharmacia Biotech). This vector differs from pGEX-GL1 in that a Factor Xa cleavage site separates the GST moiety from the carboxy-terminal fusion partner. Otherwise, the amino- or carboxy-terminal heterogeneities described above were maintained in this vector. The entire N protein was amplified from pTM1-JN using primers 3X-N5' and N3'. Domain A was amplified from pTM1-JN with primer 3X-N5' and A3'. Domain B was amplified from pTM1-JN using primers 3X-B'5' and B2.
Expression plasmids were transformed into BL21-DE3 (ompT,lon). For production of recombinant proteins, bacteria were induced with 0·5 mM IPTG, upon attaining an A600 of 0·2. Cells were grown for an additional 12 h at 37 °C prior to harvest. Bacterial pellets were resuspended in 9 ml ice-cold PBS (20 mM sodium phosphate pH 7·3, 150 mM NaCl containing 50 mM EDTA, aprotinin (100 kallikrein units/ml) and 2 mM PMSF, snap-frozen in dry ice/ethanol and rapidly thawed at 37 °C followed by sonication on ice with three 45 s bursts from a Branson sonicator. Lysates were adjusted to 1% Triton X-100 and incubated on ice for 20 min. Following centrifugation at 10000 g for 10 min, supernatants were stored at -20 °C for 4 h, thawed and centrifuged at 10000 g for 10 min to remove any cryoprecipitate. Clarified supernatants were mixed with 1 ml settled volume of glutathioneSepharose 4B (Pharmacia) and poured into a column constructed from a 10 ml disposable syringe. Column beds were washed with four, 10 ml aliquots of PBS containing 1% Triton X-100 and twice with 10 ml aliquots of TBS (50 mM TrisHCl pH 7·3, 150 mM NaCl). Fusion proteins were eluted with 10 mM reduced glutathione (GSH) in TBS. Alternatively, bound fusion proteins were cleaved with the appropriate protease and eluted. Protein concentrations were determined by the Bradford method using BSA as standard (Bradford, 1976
). Total expression of GSTN from 100 ml bacterial culture was typically 34 mg. Identities of expressed proteins were confirmed by comparison of actual vs expected sizes and immunoreactivity with N protein-specific MAbs (Stohlman et al., 1994
). After purification, fusion products were
90% pure (data not shown).
RNA probe preparation.
[
-32P]UTP (NEN; 3000 Ci/mmol) labelled RNA probes were synthesized by transcription of HindIII-linearized pBSL with T7 RNA polymerase, as previously described (Stohlman et al., 1988
). The run-off transcript is 153 nt in length and contains the first 114 nt of gene 6 mRNA of JHMV. Leader RNA was transcribed from ph
GL-1 (Tahara et al., 1994
) after linearization with NcoI. The resulting transcript was 92 nt in length and contained bases 172 of the 5'-leader sequence of gene 6 mRNA from JHMV.
For construction of the UCUAA repeat templates, oligoDNA molecules were synthesized with the sequences AGCTTAAGTTTAGATTGAGCT (1R) and AGCTTAAGTTTAGATTAGATTAGATTGAGCT (3R) cloned into SacI/HindIII-digested pGEM-3Zf(-). For preparation of RNA probes, the vector was linearized with HindIII and transcription was performed with T7 RNA polymerase. The resulting transcripts contained one copy (L1) or three copies (L3) of the pentamer motif and are 32 nt and 42 nt in length, respectively.
Ligand binding assay.
Solution binding assays were performed in 50 or 100 µl volumes containing 20 mM TrisHCl (pH 8·0), 50 mM KCl, 2 mM DTT, 25 mM NaCl, 2 mM MgCl2, 1 mM EDTA and 10 µg/ml total RNA extracted from DBT cells as previously described (Nelson & Stohlman, 1993
). Proteins were assayed at a concentration of 1040 nM; 32P-labelled RNA ligand concentrations varied from 0 to 50 nM. Binding was assayed at 22 °C for 10 min and was linear with increasing protein concentration up to 40 nM. Binding reactions in triplicate were terminated by filtering through pre-wetted nitrocellulose filters (25 mm; Schleicher and Schuell) followed by two washes with 1 ml TBS. Filters were dried and radioactivity was quantified using a Beckman LS-200 liquid scintillation spectrometer. Data were analysed using the EZ-Fit program (Frank Perrella, E. I. DuPont de Nemours). Data were fitted to a single substrate binding curve: b=[(Bmax*s)/(Kd+s)], where b is the experimentally observed amount of bound ligand, s is the ligand concentration, Kd is the dissociation constant of ligand binding and Bmax is the amount of bound ligand at saturating ligand concentration.
NorthWestern RNA blot analysis.
N protein, formic acid-cleaved fragments of N protein, GSTN protein fusion products and the corresponding cleaved products were separated by PAGE and transferred to nitrocellulose membranes as described previously (Nelson & Stohlman, 1993
). 32P-labelled transcripts were prepared from pBSL as described above. Competitor RNA, isolated from uninfected DBT cells, was added to the binding reaction at increasing concentrations to a maximum of 50 µg/ml (Nelson & Stohlman, 1993
). Bound RNA was detected by autoradiography with Kodak XAR X-ray film.
| Results |
|---|
|
|
|---|
|
-globin 5'-UTR (Fig. 4
|
|
|
|
| Discussion |
|---|
|
|
|---|
Independent confirmation of the importance of the central region (B) for virus viability was obtained by analysis of BCoV and MHV recombinant viruses (Peng et al., 1995
). Functional N proteins were inferred by recovery of viable MHV. Interestingly, no viable MHV were obtained containing the central domain of the BCoV N protein, suggesting that these amino acids are required for strain-specific replication. It was initially proposed that aa 194227 of the N protein (present in B1) bear homology to the SR superfamily of RNA-binding proteins (Parker & Masters, 1990
). This motif is important in proteinprotein interactions and is present in many splicing regulatory proteins (Fu, 1995
). Data suggest that the N protein central domain was crucial for interactions with other strain-specific viral proteins and as a site for phosphorylation (Peng et al., 1995
). However, the N protein SR-rich region has limited homology to other SR proteins; therefore, it may be a subset of the SR family of proteins or totally unrelated. In contrast, the results of the present paper demonstrate the central domain, containing the SR-rich region is important in RNAprotein interactions. The Kd values determined for domain B1 (N177231; see below) indicate high affinity, RNA-binding activity specific for the 3'-proximal end of the MHV leader sequence. A distinguishing feature of this RNA-binding region is a tandem, triple repeat of the sequence SRXX located within residues 201212 of N protein (Fig. 7
). This motif is found in all coronavirus N proteins (Britton et al., 1988
; Parker & Masters, 1990
; Homberger, 1995
), supporting the notion of a conserved function within this amino acid sequence. In support of its role in RNA binding, preliminary studies using MAb J.3.1 (Fleming et al., 1983
; Stohlman et al., 1994
), which recognizes an epitope contained within aa 171196 of the MHV N protein, inhibited RNA-binding activity, whereas an isotype-matched control MAb specific for the S protein had no such effect (data not shown). Inhibition by J.3.1 is consistent with the RNA-binding site of the N protein located within or adjacent to the MAb-binding epitope.
|
The high affinity of the N protein for its RNA motif implies that genomic intergenic sequences, if not masked by RNA secondary structure or occupied by other proteins with significantly higher affinity, should also be available as N protein ligands. This suggests that multiple copies of N protein may bind to viral RNAs along their length at each intergenic sequence as protein levels rapidly accumulate during infection. The N protein has RNA-binding activity as a monomer; however, this does not preclude binding to larger N protein complexes. Robbins et al. (1986)
reported that trimers of N protein present in virions exhibit nucleic acid-binding activity, suggesting that N protein self-association may be important for initiating RNP formation leading to encapsidation. Initial events in packaging may require: (1) binding of N protein to intergenic sequences in genome RNA; (2) collapse of this RNP into a more compact form via proteinprotein interactions between N protomers; and (3) direction of this RNP assemblage to the ER for encapsidation via interaction with the M protein (Sturman et al., 1980
). Thus, the encapsidation signal, located at the 3'-proximal end of gene 1b in genomic RNA (Makino et al., 1990
; van der Most et al., 1991
; Fosmire et al., 1992
) would distinguish genome-sized RNPs from subgenomic-sized RNPs. The N protein binds the encapsidation signal (Molenkamp & Spaan, 1997
); however, it is not known if the RBD we described for the N protein also recognizes this viral RNA feature or if binding is at an adjacent RNA domain.
The MHV N protein is required primarily for virion assembly. However, it has also been implicated in both RNA-dependent RNA transcription and translation (Lai & Cavanagh, 1997
). MAb specific for the carboxy terminus of MHV N protein co-precipitates the following: leader RNA, all viral mRNAs and the 31 kb RNA genome from lysates of MHV-infected cells (Baric et al., 1988
; Stohlman et al., 1994
). These results suggested high avidity of N protein for a ligand common to each of these RNA species, i.e. the viral leader RNA. Analysis of RNA binding clearly establishes both high affinity and specificity of N protein for sequences within viral leader RNA and intergenic sequences of genomic RNA and subgenomic mRNA.
| Acknowledgments |
|---|
| References |
|---|
|
|
|---|
Bradford, M. (1976). A rapid and sensitive method for the quantitation of microgram quantities of proteins utilizing the principle of dye binding. Analytical Biochemistry 72, 248-254.[Medline]
Brayton, P. R., Lai, M. M.-C., Patton, C. D. & Stohlman, S. A. (1982). Characterization of two RNA polymerase activities induced by mouse hepatitis virus.Journal of Virology 42, 847-853.
Britton, P., Cármenes, R. S., Page, K. W., Garwes, D. J. & Parra, F. (1988). Sequence of the nucleoprotein gene from a virulent British field isolate of transmissible gastroenteritis virus and its expression in Saccharomyces cerevisiae. Molecular Microbiology 2, 89-99.[Medline]
Elroy-Stein, O. & Moss, B. (1990). Cytoplasmic expression system based on constitutive synthesis of bacteriophage T7 RNA polymerase in mammalian cells. Proceedings of the National Academy of Sciences, USA 87, 6743-6747.
Fleming, J. O., Stohlman, S. A., Harmon, R. C., Lai, M. M.-C., Frelinger, J. A. & Weiner, L. P. (1983). Antigenic relationships of murine coronaviruses: analysis using monoclonal antibodies to JHM (MHV-4) virus. Virology 131, 296-307.[Medline]
Fosmire, J. A., Hwang, K. & Makino, S. (1992). Identification and characterization of a coronavirus packaging signal. Journal of Virology 66, 3522-3530.
Fu, X.-D. (1995). The superfamily of arginine/serine-rich splicing factors. RNA 1, 663-680.[Medline]
Furuya, T. & Lai, M. M.-C. (1993). Three different cellular proteins bind to complementary sites on the 5'-end-positive and 3'-end-negative strands of mouse hepatitis virus RNA. Journal of Virology 67, 7215-7222.
Homberger, F. R. (1995). Sequence analysis of the nucleoprotein genes of three enterotropic strains of murine coronavirus. Archives of Virology 140, 571-579.[Medline]
Jeong, Y. S. & Makino, S. (1994). Evidence for coronavirus discontinuous transcription. Journal of Virology 68, 2615-2623.
Joo, M. & Makino, S. (1992). Mutagenic analysis of the coronavirus intergenic consensus sequence. Journal of Virology 66, 6330-6337.
Lai, M. M.-C. (1990). Coronaviruses: organization, replication and expression of genome. Annual Review of Microbiology 44, 303-333.[Medline]
Lai, M. M.-C. & Cavanagh, D. (1997). The molecular biology of coronaviruses. Advances in Virus Research 48, 1-100.
Li, H. P., Zhang, X., Duncan, R., Comai, L. & Lai, M. M.-C. (1997). Heterogeneous nuclear ribonucleoprotein A1 binds to the transcription-regulatory region of mouse hepatitis virus RNA. Proceedings of the National Academy of Sciences, USA 94, 9544-9549.
Makino, S., Yokomori, K. & Lai, M. M.-C. (1990). Analysis of efficiently packaged defective interfering RNAs of murine coronavirus: localization of a possible RNA-packaging signal. Journal of Virology 64, 6045-6053.
Masters, P. S. (1992). Localization of an RNA-binding domain in the nucleocapsid protein of the coronavirus mouse hepatitis virus. Archives of Virology 125, 141-160.[Medline]
Molenkamp, R. & Spaan, W. J. (1997). Identification of a specific interaction between the coronavirus mouse hepatitis virus A59 nucleocapsid protein and packaging signal. Virology 239, 78-86.[Medline]
Motokawa, K., Hohdatsu, T., Hashimoto, H. & Koyama, H. (1996). Comparison of the amino acid sequence and phylogenetic analysis of the peplomer, integral membrane and nucleocapsid proteins of feline, canine and porcine coronaviruses.Microbiology and Immunology 40, 425-433.[Medline]
Nelson, G. W. (1996). RNA binding characteristics of the MHV nucleocapsid protein. PhD thesis, University of Southern California.
Nelson, G. W. & Stohlman, S. A. (1993). Localization of the RNA-binding domain of mouse hepatitis virus nucleocapsid protein.Journal of General Virology 74, 1975-1979.
Parker, M. M. & Masters, P. S. (1990). Sequence comparison of the N genes of five strains of the coronavirus mouse hepatitis virus suggests a three domain structure for the nucleocapsid protein.Virology 179, 463-468.[Medline]
Peng, D., Koetzner, C. A., McMahon, T., Zhu, Y. & Masters, P. S. (1995). Construction of murine coronavirus mutants containing interspecies chimeric nucleocapsid proteins. Journal of Virology 69, 5475-5484.[Abstract]
Risco, C., Anton, I. M., Enjuanes, L. & Carrascosa, J. L. (1996). The transmissible gastroenteritis coronavirus contains a spherical core shell consisting of M and N proteins. Journal of Virology 70, 4773-4777.[Abstract]
Robbins, S. G., Frana, M. F., McGowan, J. J., Boyle, J. F. & Holmes, K. V. (1986). RNA-binding proteins of coronavirus MHV: detection of monomeric and multimeric N protein with an RNA overlay-protein blot assay. Virology 150, 402-410.[Medline]
Sawicki, S. G. & Sawicki, D. L. (1990). Coronavirus transcription: subgenomic mouse hepatitis virus replicative intermediates function in RNA synthesis. Journal of Virology 64, 1050-1056.
Segel, I. H. (1976). Biochemical Calculations2nd edn. New York: John Wiley.
Sethna, P. B., Hung, S. L. & Brian, D. A. (1989). Coronavirus subgenomic minus-strand RNAs and the potential for mRNA replicons. Proceedings of the National Academy of Sciences, USA 86, 5626-5630.
Shieh, C.-K., Soe, L. H., Makino, S., Chang, M.-F., Stohlman, S. A. & Lai, M. (1987). The 5'-end sequence of the murine coronavirus genome: implications for multiple fusion sites in leader-primed transcription. Virology 156, 321-330.[Medline]
Spaan, W., Delius, H., Skinner, M., Armstrong, J., Rottier, P., Smeekens, S., van der Zeijst, B. A. & Siddell, S. G. (1983). Coronavirus mRNA synthesis involves fusion of non-contiguous sequences. EMBO Journal 2, 1839-1844.[Medline]
Stohlman, S. A. & Lai, M. M.-C. (1979). Phosphoproteins of murine hepatitis viruses. Journal of Virology 32, 672-675.
Stohlman, S. A., Baric, R. S., Nelson, G. N., Soe, L. H., Welter, L. M. & Deans, R. J. (1988). Specific interaction between coronavirus leader RNA and nucleocapsid protein. Journal of Virology 62, 4288-4295.
Stohlman, S. A., Bergmann, C., Cua, D., Wege, H. & van der Veen, R. (1994). Location of antibody epitopes within the mouse hepatitis virus nucleocapsid protein. Virology 202, 146-153.[Medline]
Sturman, L. S., Holmes, K. V. & Behnke, J. (1980). Isolation of coronavirus envelope glycoproteins and interaction with the viral nucleocapsid. Journal of Virology 33, 449-462.
Tahara, S. M., Dietlin, T. A., Bergmann, C. C., Nelson, G. W., Kyuwa, S., Anthony, R. P. & Stohlman, S. A. (1994). Coronavirus translational regulation: leader affects mRNA efficiency. Virology 202, 621-630.[Medline]
Tahara, S. M., Dietlin, T. A., Nelson, G. W., Stohlman, S. A. & Manno, D. J. (1998). Translation effector properties of mouse hepatitis virus nucleocapsid protein. Advances in Experimental Medicine and Biology 440, 313-318.[Medline]
van der Most, R. G., Bredenbeek, P. J. & Spaan, W. J. M. (1991). A domain at the 3'-end of the polymerase gene is essential for encapsidation of coronavirus defective interfering RNAs. Journal of Virology 65, 3219-3226.
van Marle, G., Luytjes, W., van der Most, R. G., van der Straaten, T. & Spaan, W. J. M. (1995). Regulation of coronavirus mRNA transcription. Journal of Virology 69, 7851-7856.[Abstract]
Vlasak, R., Luytjes, W., Leider, J., Spaan, W. & Palese, P. (1988). The E3 protein of bovine coronavirus is a receptor-destroying enzyme with acetylesterase activity. Journal of Virology 62, 4686-4690.
Zhang, X. & Lai, M. M.-C. (1995). Interactions between the cytoplasmic proteins and the intergenic (promoter) sequence of mouse hepatitis virus RNA: correlation with the amounts of subgenomic mRNA transcribed. Journal of Virology 69, 1637-1644.[Abstract]
Zhang, X., Liao, C.-L. & Lai, M. M.-C. (1994). Coronavirus leader RNA regulates and initiates subgenomic mRNA transcription both in trans and in cis.Journal of Virology 68, 4738-4746.
Received 26 April 1999;
accepted 7 September 1999.
This article has been cited by other articles:
![]() |
N. Beerens and E. J. Snijder An RNA Pseudoknot in the 3' End of the Arterivirus Genome Has a Critical Role in Regulating Viral RNA Synthesis J. Virol., September 1, 2007; 81(17): 9426 - 9436. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Jayaram, H. Fan, B. R. Bowman, A. Ooi, J. Jayaram, E. W. Collisson, J. Lescar, and B. V. V. Prasad X-ray structures of the N- and C-terminal domains of a coronavirus nucleocapsid protein: implications for nucleocapsid formation. J. Virol., July 1, 2006; 80(13): 6612 - 6620. [Abstract] [Full Text] [PDF] |
||||
![]() |
I-M. Yu, M. L. Oldham, J. Zhang, and J. Chen Crystal Structure of the Severe Acute Respiratory Syndrome (SARS) Coronavirus Nucleocapsid Protein Dimerization Domain Reveals Evolutionary Linkage between Corona- and Arteriviridae J. Biol. Chem., June 23, 2006; 281(25): 17134 - 17139. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. O. Pasternak, W. J. M. Spaan, and E. J. Snijder Nidovirus transcription: how to make sense...? J. Gen. Virol., June 1, 2006; 87(6): 1403 - 1421. [Abstract] [Full Text] [PDF] |
||||
![]() |
H.-Y. Wu, A. Ozdarendeli, and D. A. Brian Bovine Coronavirus 5'-Proximal Genomic Acceptor Hotspot for Discontinuous Transcription Is 65 Nucleotides Wide J. Virol., March 1, 2006; 80(5): 2183 - 2193. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Raman and D. A. Brian Stem-Loop IV in the 5' Untranslated Region Is a cis-Acting Element in Bovine Coronavirus Defective Interfering RNA Replication J. Virol., October 1, 2005; 79(19): 12434 - 12446. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. Calvo, D. Escors, J. A. Lopez, J. M. Gonzalez, A. Alvarez, E. Arza, and L. Enjuanes Phosphorylation and subcellular localization of transmissible gastroenteritis virus nucleocapsid protein in infected cells J. Gen. Virol., August 1, 2005; 86(8): 2255 - 2267. [Abstract] [Full Text] [PDF] |
||||
![]() |
W. Severson, X. Xu, M. Kuhn, N. Senutovitch, M. Thokala, F. Ferron, S. Longhi, B. Canard, and C. B. Jonsson Essential Amino Acids of the Hantaan Virus N Protein in Its Interaction with RNA J. Virol., August 1, 2005; 79(15): 10032 - 10039. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Liang, Y. Wan, L.-w. Qiu, J. Zhou, B. Ni, B. Guo, Q. Zou, L. Zou, W. Zhou, Z. Jia, et al. Comprehensive Antibody Epitope Mapping of the Nucleocapsid Protein of Severe Acute Respiratory Syndrome (SARS) Coronavirus: Insight into the Humoral Immunity of SARS Clin. Chem., August 1, 2005; 51(8): 1382 - 1396. [Abstract] [Full Text] [PDF] |
||||
![]() |
I-M. Yu, C. L. T. Gustafson, J. Diao, J. W. Burgner II, Z. Li, J. Zhang, and J. Chen Recombinant Severe Acute Respiratory Syndrome (SARS) Coronavirus Nucleocapsid Protein Forms a Dimer through Its C-terminal Domain J. Biol. Chem., June 17, 2005; 280(24): 23280 - 23286. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. Schelle, N. Karl, B. Ludewig, S. G. Siddell, and V. Thiel Selective Replication of Coronavirus Genomes That Express Nucleocapsid Protein J. Virol., June 1, 2005; 79(11): 6620 - 6630. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Chen, A. Gill, B. K. Dove, S. R. Emmett, C. F. Kemp, M. A. Ritchie, M. Dee, and J. A. Hiscox Mass Spectroscopic Characterization of the Coronavirus Infectious Bronchitis Virus Nucleoprotein and Elucidation of the Role of Phosphorylation in RNA Binding by Using Surface Plasmon Resonance J. Virol., January 15, 2005; 79(2): 1164 - 1179. [Abstract] [Full Text] [PDF] |
||||
![]() |
Z. Chen, D. Pei, L. Jiang, Y. Song, J. Wang, H. Wang, D. Zhou, J. Zhai, Z. Du, B. Li, et al. Antigenicity Analysis of Different Regions of the Severe Acute Respiratory Syndrome Coronavirus Nucleocapsid Protein Clin. Chem., June 1, 2004; 50(6): 988 - 995. [Abstract] [Full Text] [PDF] |
||||
![]() |
O. Krokhin, Y. Li, A. Andonov, H. Feldmann, R. Flick, S. Jones, U. Stroeher, N. Bastien, K. V. N. Dasuri, K. Cheng, et al. Mass Spectrometric Characterization of Proteins from the SARS Virus: A Preliminary Report Mol. Cell. Proteomics, May 1, 2003; 2(5): 346 - 356. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Wurm, H. Chen, T. Hodgson, P. Britton, G. Brooks, and J. A. Hiscox Localization to the Nucleolus Is a Common Feature of Coronavirus Nucleoproteins, and the Protein May Disrupt Host Cell Division J. Virol., October 1, 2001; 75(19): 9345 - 9356. [Abstract] [Full Text] [PDF] |
||||
![]() |
V. Thiel, J. Herold, B. Schelle, |