|
|
||||||||
Animal: DNA Viruses |
Institute for Molecular Biology and Genetics, Seoul National University, Building 105, Kwan-Ak-Gu, Seoul 151-742, Korea1
National Institute of Allergy and Infectious Diseases, Bethesda, MD 20892-0460, USA2
Author for correspondence: Sunyoung Kim. Fax +82 2 875 0907. e-mail sunyoung{at}plaza.snu.ac.kr
| Abstract |
|---|
|
|
|---|
| Introduction |
|---|
|
|
|---|
One of the most intensely studied IE genes of HCMV is IE2. This 86 kDa phosphonucleoprotein appears to regulate the switch in viral gene expression between the immediate-early and later stages of the HCMV life-cycle. IE2 is a promiscuous transactivator of many cellular and viral promoters, particularly when acting in conjunction with IE1, another IE gene of HCMV (Hermiston et al., 1987
; Malone et al., 1990
; Biegalke & Geballe, 1991
; Hagemeier et al., 1992a
, b
; Arlt et al., 1994
; Lukac et al., 1994
; Choi et al., 1995
; Schwartz et al., 1996
; Yoo et al., 1996
; Kim et al., 1999
). Some aspects of IE2-mediated transcriptional activation are thought to occur via TFIID through direct interaction of IE2 with the TATA box-binding protein (TBP) (Hagemeier et al., 1992b
; Jupp et al., 1993
). Other studies have revealed that IE2 also binds to additional cellular proteins including TFIIB, Sp1, CBP and Egr-1 (Caswell et al., 1993
; Lukac et al., 1994
; Schwarz et al., 1996
; Yoo et al., 1996
; Yurochko et al., 1997
). However, the precise mode by which IE2 activates transcription and the mechanism of synergistic cooperation between IE1 and IE2 are not yet fully understood.
Sp1 is a transcription factor that binds to specific GC-rich elements (Dynan & Tjian, 1983a
, b
). It is derived from a single gene product (Kadonaga et al., 1987
) and is heavily modified post-translationally. Sp1 is important in the regulation of cellular transcription and is utilized in the regulation of both herpesvirus and non-herpesvirus gene products (Everett et al., 1983
; Jones et al., 1986
; Wu et al., 1998
). It has been reported that Sp1 activity is upregulated by HCMV infection and that IE2 can interact physically with Sp1 and can cooperate functionally with Sp1 to increase promoter transactivation (Yurochko et al., 1997
; Wu et al., 1998
). Furthermore, an enhancement of Sp1 DNA-binding activity by IE2 is suggested as one model of Sp1IE2 synergy (Yurochko et al., 1997
; Wu et al., 1998
). However, this perspective does not address the possibility that IE2 may also act synergistically with Sp1 after it binds a promoter.
The binding of TBP or the multisubunit TFIID to the TATA element is the first of a series of steps required for assembly of a transcription-initiation complex on a promoter (Buratowski et al., 1989
; Koleske & Young, 1994
). For productive transcription to occur, it is believed that activators bound to upstream enhancers can influence the recruitment of TBP and TBP-associated factors (TAFs) to the TATA box, which in turn modulate the docking of the RNA polymerase (RNAP) II holoenzyme at the initiator site (Struhl, 1996
). Consistent with this model, DNA-bound activators have been found to associate with components of the general transcription machinery including TBP, TAFs, TFIIA and TFIIB (Stringer et al., 1990
; Lin et al., 1991
; Tjian & Maniatis, 1994
; Kobayashi et al., 1995
). IE2 differs from typical DNA-binding activators as, although it can bind to DNA through the cis repression signal element and its related sequences (Arlt et al., 1994
; Pizzorno & Hayward, 1990
), IE2 can also transactivate various promoters in the absence of DNA binding (Hagemeier et al., 1992a
; Lukac et al., 1994
). IE2 has been shown to interact directly with TBP (Hagemeier et al., 1992b
) and to stabilize the binding of TBP to the TATA box in vitro (Jupp et al., 1993
). Although this IE2TBP interaction is consistent with the promiscuous nature of IE2-mediated transactivation of various promoters, it is not yet clear whether stabilization of TBP binding is necessary and/or sufficient for the functional effects of IE2. Furthermore, the fact that IE2 can interact with promoter-bound TBP suggests that IE2 may function at steps subsequent to TBP recruitment.
In this study, we focused on the synergy between Sp1 and IE2 and the relationship between TBP and IE2, in order to understand the mechanism of IE2-mediated transactivation. To investigate the molecular mechanism of the Sp1IE2 synergy, we addressed several questions. (i) Can artificial recruitment of Sp1 bypass a requirement for IE2? (ii) Which domain of Sp1 is required for the augmentation of IE2-mediated transactivation? (iii) Is proteinprotein interaction between IE2 and Sp1 required for Sp1IE2 synergy? In addition, we analysed whether artificial recruitment of TBP could bypass the requirement for IE2. Our results demonstrated that IE2 can cooperate with Sp1 that is already bound to DNA and that a 117 amino acid glutamine-rich fragment of Sp1 was sufficient for the augmentation of IE2-driven transactivation. In addition, we showed that IE2 did not interact directly with the transactivation domain of Sp1, but with the C-terminal region that contains the zinc finger DNA-binding domain, suggesting that other proteins such as human (h) TAFII130 may mediate the Sp1IE2 interaction. Finally, our data also suggested that IE2 functions at a limiting event(s) after recruitment of TBP to the promoter.
| Methods |
|---|
|
|
|---|
Plasmids.
A series of human immunodeficiency virus type 1 (HIV-1) long terminal repeat (LTR) mutant plasmids (p938, p
B, p
Sp1 and p
TATA) were described previously (Kim et al., 1996
). Reporter plasmids containing GAL4-binding sites (GAL4BS) were described by Xiao et al. (1997)
. Plasmid pGAL-E1b-CAT contains the E1b TATA element (-34 to -22 of the adenovirus E1b promoter region) upstream of the CAT gene and five 17-mer GAL4BS upstream of position -34. Plasmid pGAL-HIV-CAT contains sequences from -43 to +80 of the HIV-1 promoter region with four 17-mer GAL4BS positioned upstream of -43 and CAT positioned downstream of +80. Plasmid pGAL-HIV-CAT/TG is identical to pGAL-HIV-CAT except that the TATAA element has been mutated to TGTAA.
An expression vector pGAL4-VP16, encoding the GAL4 DNA-binding domain (GAL4BD; amino acids 1147) fused to the N-terminal activation domain of VP16 (amino acids 413490), was reported previously (Chun & Jeang, 1996
). Most of the GAL4Sp1 expression plasmids were reported previously (Gill et al., 1994
; Emami et al., 1995
); all plasmids express a fusion protein containing the GAL4BD (amino acids 1147) and a portion of Sp1. pGAL4-Sp1 contains Sp1 amino acids 83778 and is the same as GAL4-Sp1WT of Gill et al. (1994)
. pGAL4-Sp1(A), pGAL4-Sp1(B) and pGAL4-Sp1(BC) contain Sp1 amino acids 83262, 263542 and 425542, respectively. pGAL4-Sp1(BN) contains Sp1 amino acids 263448 and was constructed by inserting a fragment from pGAL4-Sp1(B) into expression vector pBXG1 (Emami et al., 1995
). The GAL4Sp1(BN) fragment was amplified by PCR with the following primers complementary to the 5' end of the GAL4 fragment and to the 3' end of Sp1(BN) domain, respectively: 5' AAGCTTCCTGAAAGATGAAGCTA 3' and 5' GATTTCTAGATTACACTGTTGGTGTCCGGAT 3'. The amplified products were cleaved with HindIII and XbaI and inserted into the same sites in plasmid pBXG1, resulting in pGAL4-Sp1(BN). The expression vectors encoding the GAL4BD (amino acids 1147) fused to hTBP (amino acids 2339), hTBP
N (amino acids 94339) or hTBPM3 were reported previously (Xiao et al., 1997
).
For in vitro transcription and translation, a series of Sp1 deletion mutant expression vectors were constructed. For construction of pCR2.1-Sp1(83778), pCR2.1-Sp1(83621) and pCR2.1-Sp1(543778), Sp1 cDNAs encoding amino acids 83778, 83621 and 543778 were generated by PCR using pGAL4-Sp1 as template and the appropriate oligonucleotide primers. The sequences of the primers used were as follows: 5' primer for Sp1(83778) and Sp1(83621), 5' GAATTCATGACAGGTGAGCTTGACCTC; 5' primer for Sp1(543778), 5' GAATTCATGCTGCCGTTGGCTATAGCA; 3' primer for Sp1(83778) and Sp1(543778), 5' TCTAGATCAGAAGCCATTGCCACTGAT; and 3' primer for Sp1(83621), 5' TCTAGATCAGCAAATATGCTGTTTCTT. The amplified DNA fragments were cloned into the pCR2.1 vector (Invitrogen).
DNA transfection.
Promoter activities were assessed by transiently transfecting BHK21 and human foreskin fibroblast (HFF) cells with promoterCAT constructs and assaying for CAT activity. Procedures for DEAEdextran transient transfection, CAT assay and quantification have been described previously (Choi et al., 1995
). The total amount of DNA per transfection was always adjusted to the same amount within each experiment by using appropriate control plasmids.
IE2Sp1 binding assay.
To generate in vitro-translated proteins, expression vector DNA (1 µg) was incubated with a TNT-coupled reticulolysate system (Promega) in the presence of [35S]methionine as described previously (Choi et al., 1995
). MBP-fusion protein expression and purification were carried out as described previously (Choi et al., 1995
).
For protein-binding assays, 500 ng MBP-fusion protein, on beads, was rocked for 3 h at 4 °C with 5 µl in vitro-translated test protein in a final volume of 250 µl in buffer A (100 mM TrisHCl, pH 7·4, 140 mM NaCl, 0·5% Nonidet P-40,1 mM DTT, 0·1 mM PMSF). The beads were then washed five times in 1 ml buffer A, pelleted at 500 g for 30 s and boiled in 4x SDSPAGE sample buffer. Gels were fixed and incubated with a fluorograph for 30 min prior to drying and autoradiography.
| Results |
|---|
|
|
|---|
B, Sp1 and the TATA box. p
B has point mutations in the
B sites, as reported by Nabel & Baltimore (1987)
Sp1 and p
TATA, as reported previously (Kim et al., 1996
B sites had little effect on both basal and IE2-mediated gene expression from the LTR. Mutations in the TATA box slightly lowered CAT activity, but overall the magnitude of activation did not change. In contrast, removal of the three Sp1 sites lowered significantly the ability of the LTR to respond to IE2. These results suggested that Sp1-binding sites could play an important role in IE2-mediated transactivation of the HIV-1 LTR.
|
First, we examined the ability of IE2 to cooperate with Sp1. BHK21 cells were transfected with pGAL-E1b-CAT and pGAL4-Sp1 in the presence or absence of an IE2-expressing plasmid. At 48 h post-transfection, CAT activities were quantified in the linear range of the enzyme assay. As shown in Fig. 2
, GAL4Sp1 activated pGAL-E1b-CAT expression in the absence of IE2. However, the addition of IE2 resulted in a further activation that was 8-fold greater than that seen with GAL4Sp1 alone. As a control, a similar experiment was performed with GAL4VP16. VP16 greatly increased the CAT activity from pGAL-E1b-CAT, but IE2 had no effect on such activation. The synergy between IE2 and Sp1 was specific for IE2, since IE1 had little effect on Sp1-mediated transactivation under the same conditions. We obtained similar results by using HFF cells, which are known to be permissive for HCMV infection (data not shown). These results suggested that IE2 could cooperate with DNA-bound Sp1 and that the synergy between Sp1 and IE2 might not only be due to enhancement of Sp1 DNA-binding by IE2.
|
BHK21 cells were transfected with pGAL-E1b-CAT together with plasmids that expressed the GAL4 DNA-binding domain fused to the A, B, BN or BC subdomains of Sp1 in the presence or absence of IE2-expressing plasmids. The analysis of CAT activity showed that the A, B and BC fragments of Sp1 could all augment IE2-mediated transactivation to a similar extent as the full-length Sp1 (Fig. 3
), but GAL4Sp1(BN) enhanced IE2-mediated transactivation only weakly. It has been shown previously that BN alone does not interact with Drosophila (d) TAFII110 (Gill et al., 1994
). This suggests that a direct interaction between Sp1 and hTAFII130, the human homologue of dTAFII110, may underlie the augmentation of IE2-mediated transactivation.
|
|
TBP recruitment to the promoter is an early defining step of initiation-complex formation (Stargell & Struhl, 1996
; Struhl, 1996
; Ptashne & Gann, 1997
). To characterize more precisely the function(s) of IE2 in transcription, we asked whether artificial recruitment of TBP could bypass the requirement for IE2. We approached this question by using a GAL4BDhTBP hybrid protein that, when assayed for its ability to enhance transcription from the pGAL-E1b-CAT plasmid, addresses whether recruitment of TBP is a rate-limiting step accelerated by IE2. Because GAL4 binds DNA even when packaged into nucleosomes, in principle, GAL4hTBP would be recruited efficiently to the GAL4BS in plasmid pGAL-E1b-CAT. Accordingly, if the function of IE2 is only to recruit TBP to the promoter, then artificial tethering of TBP via the GAL4BDGAL4BS interaction should bypass the requirement for IE2. Indeed, this type of tethering approach has been used to document TBP recruitment as a major rate-limiting step in transcription from many yeast promoters (Chatterjee & Struhl, 1995
; Xiao et al., 1995
).
BHK21 cells were transfected with plasmids pGAL-E1b-CAT and pGAL4-hTBP in the presence or absence of an IE2-expressing plasmid. At 48 h after transfection, CAT activities were quantified in the linear range of the enzyme assay. As shown in Fig. 5
, GAL4hTBP activated pGAL-E1b-CAT expression in the absence of IE2. Addition of IE2 resulted in a 5-fold greater activation than was seen with either GAL4hTBP or IE2 alone. Synergy with TBP was specific for IE2, since IE1 had little effect on TBP-mediated transactivation under the same conditions. We obtained similar results with another reporter construct, pGAL-HIV-CAT, which contains four synthetic GAL4BS and the HIV-1 TATATAR sequences from -43 to +80 (data not shown). We also obtained similar results by using HFF cells, which are known to be permissive for HCMV infection (data not shown). The slight increase in minimal E1b promoter activity in the presence of IE2 alone is due presumably to the constitutive docking of some native hTBP at the pGAL-E1b-CAT TATA element. Overall, these results are consistent with a simple interpretation that IE2 can act at one or more steps after TBP recruitment.
|
N expression plasmid, which is the same as pGAL4-hTBP except that the N-terminal amino acids 193 were deleted. It was reported previously that the TBP N-terminal region acts as an auxiliary activation domain that reinforces the activity of other promoter-bound factors (Seipel et al., 1993
N would yield equivalent findings when assayed in place of GAL4hTBP. We observed that deletion of the activation domain of hTBP had no effect on the IE2hTBP synergy (Fig. 5
Second, we compared GALhTBP with a mutant derivative, GAL4hTBPM3, for their ability to activate transcription from a TGTA element in the HIV-1 promoter. Previous studies have shown that an A-to-G substitution at the second position of TATA greatly reduces its affinity for TBP and that promoters with TGTA elements are transcriptionally inactive in both yeast and human cells (Strubin & Struhl, 1992
; Tansey et al., 1994
). It has been demonstrated that a TGTA promoter can be trans-complemented with an altered-specificity TBP mutant, TBPM3 (Strubin & Struhl, 1992
). We therefore used this property to analyse TBPIE2 synergy, by using pGAL-HIV-CAT/TG, which was identical to pGAL-HIV-CAT except that the HIV-1 TATAA was changed to TGTAA. We reasoned that if TBP in GAL4hTBP functions by direct binding to the TATA element, one would expect the A-to-G change to affect transcription dramatically from a TGTA promoter mediated through wild-type GAL4hTBP but not through GAL4hTBPM3. Indeed, the A-to-G substitution dramatically reduced synergistic activation by wild-type GAL4hTBP and IE2, but had a minimal affect on synergy between mutant GAL4hTBPM3 and IE2 (Fig. 6
). Since endogenous hTBP cannot dock at TGTA, if GAL4hTBPM3 supplied an activation domain function for purposes of recruiting endogenous hTBP, one would not expect to see an increase in IE2-dependent activity from the TGTA promoter. The fact that activation was observed is fully consistent with a model of IE2 action at a step after recruitment of mutant GAL4hTBPM3 at TGTA or wild-type GAL4hTBP at TATA.
|
TATA used in the experiment shown in Fig. 1
pGAL-HIV-CAT/TG was co-transfected into BHK21 cells together with pGAL4-Sp1, pGAL4-Sp1BN or pGAL4-Sp1BC in the presence or absence of an IE2-expressing plasmid. The analysis of CAT activity showed that, in the presence of full-length Sp1 or the truncated Sp1 containing only the BC transactivation domain, IE2 could greatly activate gene expression from the promoter containing the mutated TATA box (Fig. 7
). IE2 had little effect on that promoter in the presence of Sp1 containing only the BN subdomain. These results suggested that the presence of the activation domain of Sp1 alone could allow IE2 to bypass the requirement for the TATA box in its transactivation of the promoter.
|
| Discussion |
|---|
|
|
|---|
Artificial recruitment of Sp1 to the promoter through its attachment to a heterologous DNA-binding domain can trigger gene transcription. Addition of IE2 can augment such Sp1-mediated transactivation, suggesting that IE2 can cooperate with DNA-bound Sp1. Analysis of a series of Sp1 deletion mutants revealed that the BC subdomain of Sp1 is sufficient for the augmentation of IE2-mediated transactivation, while the BN subdomain had little effect. It has been reported previously that the BC domain can interact with hTAFII130, while the BN subdomain of Sp1 failed to interact with hTAFII130 (Saluja et al., 1998
). Therefore, it is possible that the interaction between Sp1 and hTAFII130 may be important for IE2Sp1 synergy.
The interaction between IE2 and Sp1 appears to be mediated by the C terminus of Sp1, which contains the zinc finger DNA-binding domain. It has been suggested previously that zinc fingers, in addition to binding DNA and RNA, may mediate proteinprotein interactions. For instance, the zinc fingers of YY1 have been shown to be involved in physical interactions with Sp1, p300 and bZIP-containing proteins such as CREB (Lee et al., 1993
, 1995
; Zhou et al., 1995
). IE2 has also been shown to interact with the zinc fingers of Egr-1 (Yoo et al., 1996
). The observation that IE2 can interact directly with the DNA-binding domain of Sp1 may underlie the enhancement of Sp1 DNA-binding activity by IE2 (Wu et al., 1998
). It has been reported that HIV-1 Tat interacts directly with Sp1 and that Tat cooperates with DNA-bound Sp1 (Jeang et al., 1993
; Xiao et al., 1997
). The interaction between these two proteins appears to modulate Sp1 phosphorylation in a double-stranded DNA-dependent protein kinase-dependent manner (Chun et al., 1998
). Because IE2 has features similar to Tat in regard to its relationship with Sp1, it will be interesting to test whether IE2 can regulate the function of Sp1 by modulating the phosphorylation of this protein.
IE2 has been shown to interact with TBP (Hagemeier et al., 1992b
) and to stabilize the binding of TBP to the TATA box (Jupp et al., 1993
). However, it is not yet clear whether IE2 can function at steps after TBP recruitment. To test whether IE2 can act at steps subsequent to TBP recruitment, we posed a simple question: would artificial recruitment of hTBP to the promoter bypass a transcriptional requirement for IE2? We found that GAL4BD-based recruitment of TBP alone could increase expression from a minimal promoter, but that the addition of IE2 to this ensemble increased transcription markedly from the promoter. These findings suggest that the IE2 enhancement of promoter function occurs at steps after TBP recruitment. Deletion of the N-terminal activation domain of TBP had little effect on IE2TBP cooperation, suggesting that IE2-activated transcription probably occurs through an IE2-dependent step after TBP recruitment rather than as a consequence of interactions between the activation domain of TBP and IE2. When considered in the context of a two-step model of transcriptional activation (Stargell & Struhl, 1996
), the upstream DNA-bound factors such as Sp1 serve primarily to recruit TBP, whereas the IE2 protein appears to act at later steps.
It has been reported that the TATA box is essential for IE2-mediated transactivation (Hagemeier et al., 1992b
). Our finding that an A-to-G substitution in the HIV-1 TATA box dramatically reduced synergistic activation by hTBP and IE2 is consistent with the previous report (Hagemeier et al., 1992b
). However, in the presence of the activation domain of Sp1, IE2 can greatly activate gene expression from the promoter containing the mutated TATA sequence. The glutamine-rich activation domain of Sp1 has been shown to stimulate Inr-containing core promoters preferentially (Emami et al., 1995
). During IE2 activation, the activation domain of Sp1 appears to be able to recruit TBP independently of the TATA box. Indeed, it was reported that Sp1, possibly through an Sp1TAF interaction, recruits TFIID to an Inr element directly in the absence of a TATA box (Kaufmann & Smale, 1994
).
Events occurring at the promoter after TBP engagement are numerous and complex (Buratowski et al., 1989
; Zawel & Reinberg, 1993
). In this area, one could propose that IE2 functions directly or indirectly to recruit either additional general transcription factors or the RNAP II holoenzyme. Indeed, consistent with such a hypothesis is the fact that IE2 has been shown to interact with transcription factors such as TFIIB and hTAFII130 (Caswell et al., 1993
; Lukac et al., 1997
). The observations that IE2 is capable of binding both TFIIB and TBP and that the binding regions overlap but are not identical imply that IE2 may be capable of interacting with both factors simultaneously (Caswell et al., 1993
). This suggests a model by which IE2 might act through general transcription factors, that is by increasing the rate of assembly of the pre-initiation complex.
| Acknowledgments |
|---|
| References |
|---|
|
|
|---|
Biegalke, B. J. & Geballe, A. P. (1991). Sequence requirements for activation of the HIV-1 LTR by human cytomegalovirus. Virology 183, 381-385.[Medline]
Blau, J., Xiao, H., McCracken, S., OHare, P., Greenblatt, J. & Bentley, D. (1996). Three functional classes of transcriptional activation domain. Molecular and Cellular Biology 16, 2044-2055.[Abstract]
Buratowski, S., Hahn, S., Guarente, L. & Sharp, P. A. (1989). Five intermediate complexes in transcription initiation by RNA polymerase II. Cell 56, 549-561.[Medline]
Caswell, R., Hagemeier, C., Chiou, C.-J., Hayward, G., Kouzarides, T. & Sinclair, J. (1993). The human cytomegalovirus 86K immediate early (IE) 2 protein requires the basic region of the TATA-box binding protein (TBP) for binding, and interacts with TBP and transcription factor TFIIB via regions of IE2 required for transcriptional regulation. Journal of General Virology 74, 2691-2698.
Chatterjee, S. & Struhl, K. (1995). Connecting a promoter-bound protein to TBP bypasses the need for a transcriptional activation domain. Nature 374, 820-822.[Medline]
Chen, J. L., Attardi, L. D., Verrijzer, C. P., Yokomori, K. & Tjian, R. (1994). Assembly of recombinant TFIID reveals differential coactivator requirements for distinct transcriptional activators. Cell 79, 93-105.[Medline]
Choi, K. S., Kim, S.-J. & Kim, S. (1995). The retinoblastoma gene product negatively regulates transcriptional activation mediated by the human cytomegalovirus IE2 protein. Virology 208, 450-456.[Medline]
Chun, R. F. & Jeang, K. T. (1996). Requirements for RNA polymerase II carboxyl-terminal domain for activated transcription of human retroviruses human T-cell lymphotropic virus I and HIV-1. Journal of Biological Chemistry 271, 27888-27894.
Chun, R. F., Semmes, O. J., Neuveut, C. & Jeang, K. T. (1998). Modulation of Sp1 phosphorylation by human immunodeficiency virus type 1 Tat. Journal of Virology 72, 2615-2629.
Courey, A. J. & Tjian, R. (1988). Analysis of Sp1 in vivo reveals multiple transcriptional domains, including a novel glutamine-rich activation motif. Cell 55, 887-898.[Medline]
Dynan, W. S. & Tjian, R. (1983a). Isolation of transcription factors that discriminate between different promoters recognized by RNA polymerase II. Cell 32, 669-680.[Medline]
Dynan, W. S. & Tjian, R. (1983b). The promoter-specific transcription factor Sp1 binds to upstream sequences in the SV40 early promoter. Cell 35, 79-87.[Medline]
Emami, K. H., Navarre, W. W. & Smale, S. T. (1995). Core promoter specificities of the Sp1 and VP16 transcriptional activation domains. Molecular and Cellular Biology 15, 5906-5916.[Abstract]
Emili, A., Greenblatt, J. & Ingles, C. J. (1994). Species-specific interaction of the glutamine-rich activation domains of Sp1 with the TATA box-binding protein. Molecular and Cellular Biology 14, 1582-1593.
Everett, R. D., Baty, D. & Chambon, P. (1983). The repeated GC-rich motifs upstream from the TATA box are important elements of the SV40 early promoter. Nucleic Acids Research 11, 2447-2464.
Gill, G., Pascal, E., Tseng, Z. H. & Tjian, R. (1994). A glutamine-rich hydrophobic patch in transcription factor Sp1 contacts the dTAFII110 component of the Drosophila TFIID complex and mediates transcriptional activation. Proceedings of the National Academy of Sciences, USA 91, 192-196.
Hagemeier, C., Walker, S., Caswell, R., Kouzarides, T. & Sinclair, J. (1992a). The human cytomegalovirus 80-kilodalton but not the 72-kilodalton immediate-early protein transactivates heterologous promoters in a TATA box-dependent mechanism and interacts directly with TFIID. Journal of Virology 66, 4452-4456.
Hagemeier, C., Walker, S. M., Sissons, P. J. G. & Sinclair, J. H. (1992b). The 72K IE1 and 80K IE2 proteins of human cytomegalovirus independently trans-activate the c-fos, c-myc and hsp70 promoters via basal promoter elements. Journal of General Virology 73, 2385-2393.
Hermiston, T. W., Malone, C. L., Witte, P. R. & Stinski, M. F. (1987). Identification and characterization of the human cytomegalovirus immediate-early region 2 gene that stimulates gene expression from an inducible promoter. Journal of Virology 61, 3214-3221.
Jeang, K. T., Chun, R., Lin, N. H., Gatignol, A., Glabe, C. G. & Fan, H. (1993). In vitro and in vivo binding of human immunodeficiency virus type 1 Tat protein and Sp1 transcription factor. Journal of Virology 67, 6224-6233.
Jones, K. A., Kadonaga, J. T., Luciw, P. A. & Tjian, R. (1986). Activation of the AIDS retrovirus promoter by the cellular transcription factor, Sp1. Science 232, 755-759.
Jupp, R., Hoffmann, S., Stenberg, R. M., Nelson, J. A. & Ghazal, P. (1993). Human cytomegalovirus IE86 protein interacts with promoter-bound TATA-binding protein via a specific region distinct from the autorepression domain. Journal of Virology 67, 7539-7546.
Kadonaga, J. T., Carner, K. R., Masiarz, F. R. & Tjian, R. (1987). Isolation of cDNA encoding transcription factor Sp1 and functional analysis of the DNA binding domain. Cell 51, 1079-1090.[Medline]
Kaufmann, J. & Smale, S. T. (1994). Direct recognition of initiator elements by a component of the transcription factor IID complex. Genes & Development 8, 821-829.
Kim, S., Yu, S. S. & Kim, V. N. (1996). Essential role of NF-
B in transactivation of the human immunodeficiency virus long terminal repeat by the human cytomegalovirus IE1 protein. Journal of General Virology 77, 83-91.
Kim, J.-M., Hong, Y., Kim, S., Cho, M. H., Yoshida, M., Jeang, K. T., Burns, W. & Kim, S. (1999). Sequences downstream of the RNA initiation site of the HTLV type I long terminal repeat are sufficient for trans-activation by human cytomegalovirus immediate-early proteins. AIDS Research and Human Retroviruses 15, 545-550.[Medline]
Kobayashi, N., Boyer, T. G. & Berk, A. J. (1995). A class of activation domains interacts directly with TFIIA and stimulates TFIIATFIIDpromoter complex assembly. Molecular and Cellular Biology 15, 6465-6473.[Abstract]
Koleske, A. J. & Young, R. A. (1994). An RNA polymerase II holoenzyme responsive to activators. Nature 368, 466-469.[Medline]
Lee, J. S., Galvin, K. M. & Shi, Y. (1993). Evidence for physical interaction between the zinc-finger transcription factors YY1 and Sp1. Proceedings of the National Academy of Sciences, USA 90, 6145-6149.
Lee, J. S., Galvin, K. M., See, R. H., Eckner, R., Livingston, D., Moran, E. & Shi, Y. (1995). Relief of YY1 transcriptional repression by adenovirus E1A is mediated by E1A-associated protein p300. Genes & Development 9, 1188-1198.
Lin, Y.-S., Ha, I., Maldonado, E., Reinberg, D. & Green, M. R. (1991). Binding of general transcription factor TFIIB to an acidic activating region. Nature 353, 569-571.[Medline]
Lukac, D. M., Manuppello, J. R. & Alwine, J. C. (1994). Transcriptional activation by the human cytomegalovirus immediate-early proteins: requirements for simple promoter structures and interactions with multiple components of the transcription complex. Journal of Virology 68, 5184-5193.
Lukac, D. M., Harel, N. Y., Tanese, N. & Alwine, J. C. (1997). TAF-like functions of human cytomegalovirus immediate-early proteins. Journal of Virology 71, 7227-7239.[Abstract]
Malone, C. L., Vesole, D. H. & Stinski, M. F. (1990). Transactivation of a human cytomegalovirus early promoter by gene products from the immediate-early gene IE2 and augmentation by IE1: mutational analysis of the viral proteins. Journal of Virology 64, 1498-1506.
Mocarski, E. S.Jr (1996). Cytomegaloviruses and their replication. In Fields Virology, pp. 2447-2492. Edited by B. N. Fields, D. M. Knipe & P. M. Howley. Philadelphia: LippincottRaven.
Nabel, G. & Baltimore, D. (1987). An inducible transcription factor activates expression of human immunodeficiency virus in T cells. Nature 326, 711-713.[Medline]
Pizzorno, M. C. & Hayward, G. S. (1990). The IE2 gene products of human cytomegalovirus specifically down-regulate expression from the major immediate-early promoter through a target sequence located near the cap site. Journal of Virology 64, 6154-6165.
Ptashne, M. & Gann, A. (1997). Transcriptional activation by recruitment. Nature 386, 569-577.[Medline]
Saluja, D., Vassallo, M. F. & Tanese, N. (1998). Distinct subdomains of human TAFII130 are required for interactions with glutamine-rich transcriptional activators. Molecular and Cellular Biology 18, 5734-5743.
Schwartz, R., Helmich, B. & Spector, D. H. (1996). CREB and CREB-binding proteins play an important role in the IE2 86-kilodalton protein-mediated transactivation of the human cytomegalovirus 2·2-kilobase RNA promoter. Journal of Virology 70, 6955-6966.
Seipel, K., Georgiev, O., Gerber, H. P. & Schaffner, W. (1993). C-terminal domain (CTD) of RNA polymerase II and N-terminal segment of the human TATA binding protein (TBP) can mediate remote and proximal transcriptional activation, respectively. Nucleic Acids Research 21, 5609-5615.
Stargell, L. A. & Struhl, K. (1996). Mechanisms of transcriptional activation in vivo: two steps forward. Trends in Genetics 12, 311-315.[Medline]
Stringer, K. F., Ingles, C. J. & Greenblatt, J. (1990). Direct and selective binding of an acidic transcriptional activation domain to the TATA-box factor TFIID. Nature 345, 783-786.[Medline]
Strubin, M. & Struhl, K. (1992). Yeast and human TFIID with altered DNA-binding specificity for TATA elements. Cell 68, 721-730.[Medline]
Struhl, K. (1996). Chromatin structure and RNA polymerase II connection: implications for transcription. Cell 84, 179-182.[Medline]
Tansey, W. P., Ruppert, S., Tjian, R. & Herr, W. (1994). Multiple regions of TBP participate in the response to transcriptional activators in vivo. Genes & Development 8, 2756-2769.
Tjian, R. & Maniatis, T. (1994). Transcriptional activation: a complex puzzle with few easy pieces. Cell 77, 5-8.[Medline]
Wu, J., ONeill, J. & Barbosa, M. S. (1998). Transcription factor Sp1 mediates cell-specific trans-activation of the human cytomegalovirus DNA polymerase gene promoter by immediate-early protein IE86 in glioblastoma U373MG cells. Journal of Virology 72, 236-244.
Xiao, H., Friesen, J. D. & Lis, J. T. (1995). Recruiting TATA-binding protein to a promoter: transcriptional activation without an upstream activator. Molecular and Cellular Biology 15, 5757-5761.[Abstract]
Xiao, H., Lis, J. T. & Jeang, K. T. (1997). Promoter activity of Tat at steps subsequent to TATA-binding protein recruitment. Molecular and Cellular Biology 17, 6898-6905.[Abstract]
Yoo, Y. D., Chiou, C.-J., Choi, K. S., Yi, Y., Michelson, S., Kim, S., Hayward, G. S. & Kim, S.-J. (1996). The IE2 regulatory protein of human cytomegalovirus induces expression of the human transforming growth factor
1 gene through an Egr-1 binding site. Journal of Virology 70, 7062-7070.
Yurochko, A. D., Mayo, M. W., Poma, E. E., Baldwin, A. S.Jr & Huang, E.-S. (1997). Induction of the transcription factor Sp1 during human cytomegalovirus infection mediates upregulation of the p65 and p105/p50 NF-
B promoters. Journal of Virology 71, 4638-4648.[Abstract]
Zawel, L. & Reinberg, D. (1993). Initiation of transcription by RNA polymerase II: a multi-step process. Progress in Nucleic Acid Research and Molecular Biology 44, 67-108.[Medline]
Zhou, Q., Gedrich, R. W. & Engel, D. A. (1995). Transcriptional repression of the c-fos gene by YY1 is mediated by a direct interaction with ATF/CREB. Journal of Virology 69, 4323-4330.[Abstract]
Received 26 July 1999;
accepted 9 September 1999.
This article has been cited by other articles:
![]() |
L.-M. Huang, M.-F. Chao, M.-Y. Chen, H.-m. Shih, Y.-P. Chiang, C.-Y. Chuang, and C.-Y. Lee Reciprocal Regulatory Interaction between Human Herpesvirus 8 and Human Immunodeficiency Virus Type 1 J. Biol. Chem., April 13, 2001; 276(16): 13427 - 13432. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||