J Gen Virol
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via CrossRef
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Galindo, I.
Right arrow Articles by Carrascosa, A. L.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Galindo, I.
Right arrow Articles by Carrascosa, A. L.
Agricola
Right arrow Articles by Galindo, I.
Right arrow Articles by Carrascosa, A. L.
Journal of General Virology (2000), 81, 59-65.
© 2000 Society for General Microbiology


Animal: DNA Viruses

Characterization of the African swine fever virus protein p49: a new late structural polypeptide

Inmaculada Galindo1, Eladio Viñuelab,1 and Angel L. Carrascosa1

Centro de Biología Molecular ‘Severo Ochoa’ (CSIC–UAM), Universidad Autónoma de Madrid, 28049 Madrid, Spain1

Author for correspondence: Angel Carrascosa. Fax +34 91 397 47 99. e-mail acarrascosa{at}cbm.uam.es


   Abstract
TOP
Abstract
Main text
References
 
The open reading frame B438L, located within the EcoRI B fragment of the African swine fever virus genome, is predicted to encode a protein of 438 amino acids with a molecular mass of 49·3 kDa. It presents a cell attachment RGD (Arg–Gly–Asp) motif but no other significant similarity to protein sequences in databases. Northern blot and primer extension analysis showed that B438L is transcribed only at late times during virus infection. The B438L gene product has been expressed in Escherichia coli, purified and used as an antigen for antibody production. The rabbit antiserum specific for pB438L recognized a protein of about 49 kDa in virus-infected cell extracts. This protein was synthesized late in infection by all the virus strains tested, was located in cytoplasmic virus factories and appeared as a structural component of purified virus particles.


   Main text
TOP
Abstract
Main text
References
 
African swine fever virus (ASFV), a large, enveloped, icosahedral DNA virus, is the causative agent of an economically important disease of swine (reviewed in Hess, 1981Down ; Viñuela, 1987Down ; Costa, 1990Down ; Salas et al., 1999Down ). The virus particle contains lipid envelopes (Breese & DeBoer, 1966Down ; Carrascosa et al., 1984Down ; Andrés et al., 1998Down ) and a single molecule of double-stranded DNA of ~170 kb that contains about 150 open reading frames (ORFs) (Yáñez et al., 1995Down ). Gel electrophoresis analysis of purified virions has resolved about 34 and 54 structural proteins in one-dimensional (Carrascosa et al., 1985Down ) and two-dimensional (Esteves et al., 1986Down ) gels, respectively, with molecular masses ranging from 10 to 150 kDa. The contributions of several authors have allowed the identification of 11 ASFV genes encoding 15 proteins present in the virus particle (reviewed in Yáñez et al., 1995Down ), six of them generated by two viral polyproteins that must be cleaved after translation (Simón-Mateo et al., 1993Down , 1997Down ). More than half of the virus structural polypeptides remain to be assigned to particular genes, and many of them will be related to enzymatic activities associated with the virus particle (Yáñez et al., 1995Down ).

The present study was undertaken to investigate the properties of the B438L ORF, which encodes a protein containing a cell attachment RGD (Arg-Gly–Asp) motif (Yáñez et al., 1995Down ). The B438L ORF is located within the EcoRI B genomic fragment of the BA71V strain of ASFV and encodes a protein, designated pB438L, of 438 amino acids with a predicted molecular mass of 49·3 kDa. The hydropathy profile (Kyte & Doolittle, 1982Down ) did not show any evidence of putative transmembrane domains or sites for post-translational modification (data not shown), and no significant similarity was found between the amino acid sequence predicted for pB438L and other proteins in the databases in comparison analysis performed with the FASTA program (Pearson & Lipman, 1988Down ).

Transcription of the B438L ORF was studied by Northern blot and primer extension analyses. The RNA samples were prepared by the TRI-Reagent (Molecular Research Center) method (Chomczynski, 1993Down ) from mock-infected Vero cells, cells infected with ASFV (5 p.f.u. per cell, Vero cell-adapted BA71V strain) for 8 h in the presence of either 40 µg/ml cycloheximide (immediate-early RNA) or 100 µg/ml cytosine arabinoside (early RNA) and cells infected for 16 h in the absence of drugs (late RNA). Both the Northern blot and primer extension analyses were performed as described previously (Rodríguez et al., 1994Down ) by using a 32P-end-labelled oligonucleotide (5' CGCAGCTCCATTTTTGTTGCCGCAGTACCG 3') complementary to nucleotides 112–141 of the coding strand of the B438L ORF. For Northern blots, 15 µg of each of the different RNAs was fractionated on formaldehyde–agarose gels, transferred to nitrocellulose and hybridized to the 32P-labelled probe. For primer extension, after hybridization of the 5'-end-labelled primer to 20 µg of the different RNAs, the samples were extended with avian myeloblastosis virus reverse transcriptase for 2 h at 37 °C and then subjected to electrophoresis in 6% polyacrylamide sequencing gels. The results of the RNA hybridization (Fig. 1aDown) revealed the existence of seven virus-induced late mRNA species, of 0·5, 1·0, 2·2, 2·5, 2·8, 4·2 and 5·5 kb, specifically recognized by the radioactive probe, while nothing was detected in the early mRNA samples. The results of the primer extension analysis revealed three primer-extended products in the late virus-induced RNA sample, with sizes of 147, 149 and 182 nucleotides (Fig. 1bDown), which should correspond to late transcriptional initiation sites 6, 8 and 41 nucleotides, respectively, upstream of the initiation codon of the B438L ORF (Fig. 1cDown). A motif composed of seven consecutive thymidylate residues (7T), identified as a signal for 3'-end formation of both early and late ASFV mRNAs (Almazán et al., 1992Down , 1993Down ), was found 964 nucleotides downstream of the translation stop codon of the B438L ORF (Fig. 1cDown). Termination at this 7T motif should yield a transcript of 2·3 kb, which corresponds to one of the fragments detected by Northern blot in the late RNA sample, while the other virus-induced mRNA species may correspond to transcripts of neighbouring ORFs (Fig. 1dDown).



View larger version (58K):
[in this window]
[in a new window]
 
Fig. 1. Transcriptional analysis of the B438L ORF. (a)–(b) Autoradiograms of RNA hybridization (a) and primer extension (b) of mock-infected Vero cells (lanes M), ASFV-induced immediate-early (C), early (A) and late RNA (L). Samples in (b) were separated alongside an unrelated DNA sequencing reaction (DNA ladder) used as a size marker. The sizes of the relevant DNA fragments are indicated. (c) The precise locations ({circ}) of transcription initiation sites are shown. (d) Partial representation of the EcoRI B fragment of the ASFV genome. The positions of ORFs (heavy arrows) and the distribution of stretches of seven or more consecutive thymidylate residues (7T/7A) are indicated. The positions and sizes of transcripts are represented by thin arrows.

 
To facilitate the identification of pB438L, a specific polyclonal antiserum was raised against this protein. For this purpose, the B438L ORF was amplified by PCR, using as primers two oligonucleotides containing EcoRI and PstI restriction sites, cloned into the PstI/EcoRI-digested prokaryotic expression vector pRSET-A (Invitrogen) in frame with a multifunctional leader peptide containing a hexahistidyl sequence and used to transform cultures of E. coli BL21(DE3) pLysS (Studier, 1991Down ). One litre of a culture of cells bearing the recombinant plasmid pRSET-B438L was induced for expression for 3 h at 37 °C by the addition of 0·4 mM IPTG, lysed by sonication and analysed by SDS–PAGE. As shown in Fig. 2(a)Down, a protein band was detected in the IPTG-induced lysates (lane 2) emerging from the background of bacterial polypeptides (lane 1), with a size consistent with that calculated for the fusion protein (51·4 kDa). Protein pB438L was purified under denaturing conditions by using a Ni2+-affinity chromatography column (Qiagen) according to the manufacturer’s instructions. After elution, the pB438L-enriched sample (Fig. 2aDown, lane 3) was subjected to preparative SDS–PAGE in a 12% gel. The protein band was visualized by incubation in 0·2 M imidazole and 0·1% SDS for 7 min and in 0·2 M ZnSO4, sliced and used to immunize rabbits. Each animal received 150 µg protein per inoculation in Freund’s complete (first dose) or incomplete (second and third doses, days 21 and 36) adjuvant. Ten days after the last injection, serum was prepared from defibrinated blood and titrated by ELISA (Douillard et al., 1980Down ).



View larger version (58K):
[in this window]
[in a new window]
 
Fig. 2. (a) Induction and purification of protein pB438L. SDS–PAGE analyses of cell extracts from cultures of E. coli transformed with plasmid pRSET-B438L, collected before (lane 1) and after (lane 2) induction with IPTG. Protein pB438L was purified by affinity chromatography (lane 3). (b) Expression of p49 in ASFV-infected Vero cells. Extracts of Vero cells (50 µg) either mock infected (lane M) or infected with ASFV (BA71V strain) and collected at different times after infection, were separated by SDS–PAGE and analysed by Western blot with anti-pB438L rabbit serum. (c)–(d) Detection of p49 in ASFV particles. Purified ASFV samples (lanes T) were treated with OG and then centrifuged to separate the solubilized components (lanes SN) from the subviral particles (lanes SD). Virus proteins were immunodetected by Western blot with serum specific for pB438L (c) or for p35 (d). Molecular masses in kDa are indicated. (e) Expression of p49 in Vero cells and swine macrophages infected with different strains of ASFV. Cell cultures were infected with ASFV [BA71V, E70, Kirawira 69 (KIR69), L4 or L104] in either the presence (+) or absence (-) of cytosine arabinoside (40 µg/ml) and collected at late times of infection. Cell extracts were separated by SDS–PAGE and analysed by Western blot with anti-pB438L rabbit antiserum. The corresponding mock-infected cell extracts (lanes M) and the position of p49 (arrowhead) are indicated.

 
The expression of pB438L during ASFV infection was analysed by Western blot. Cultures of Vero cells, either mock-infected or infected with ASFV at an m.o.i. of 5 p.f.u. per cell, were collected in sample buffer (Laemmli, 1970Down ) at different times after infection and electrophoresed (50 µg) in a 7–20% polyacrylamide gel before transferring to nitrocellulose paper, as described elsewhere (Martínez-Pomares et al., 1997Down ). The membrane was incubated with anti-pB438L rabbit antiserum (diluted 1:500) and developed by the ECL detection system (Amersham). As shown in Fig. 2(b)Up, a virus-induced protein with a molecular mass of about 49 kDa (named p49) was strongly and specifically recognized by the immune serum, with synthesis beginning at 12 h post-infection (p.i.) and accumulating throughout the virus infection cycle. The detection of p49 during the late phase of the infection and after the onset of viral DNA replication (8–10 h p.i.) correlated with the Northern blot and primer extension analysis. In order to confirm the characterization of p49 as an ASFV late protein, Vero cell cultures were infected with the BA71V strain of ASFV, in the presence or absence of cytosine arabinoside, and the corresponding extracts were analysed at late times of infection (18 h p.i.) by Western blot (Fig. 2eUp). The pB438L-specific rabbit antiserum detected the induction of this protein only in the sample infected with virus in the absence of inhibitor.

To extend these studies to other virus isolates, we infected cultures of swine macrophages (the natural host cell) with a variety of ASFV strains, including the non-virulent BA71V strain, two virulent field isolates (E70, Kirawira 69) and two partially attenuated virus samples obtained by four (L4) or 104 (L104) passages of the original virus in swine monocytes. Mock- or virus-infected cells, collected at late times of infection in the presence or absence of cytosine arabinoside, were analysed by Western blot with the pB438L-specific rabbit antiserum. As shown in Fig. 2(e)Up, all of the ASFV strains tested were able to induce p49 in swine macrophages when the infection was made in the absence of inhibitors of viral DNA replication. These results substantiate the conclusion that B438L ORF is present in all of the ASFV strains tested and that its expression generates a protein (p49) similar to that synthesized by the BA71V virus strain in Vero cells.

The subcellular localization of p49 within ASFV-infected cells was studied by indirect immunofluorescence. Cultures of Vero cells, either mock infected or infected with ASFV at an m.o.i. of 1 p.f.u. per cell, were washed at 16 h p.i., fixed in methanol at -20 °C for 5 min and air dried. After washing in staining buffer (1% BSA in PBS), cells were incubated for 1 h at 37 °C with anti-pB438L rabbit antiserum diluted 1:100 in staining buffer, reacted with fluorescein-conjugated goat anti-rabbit serum and then incubated with 2 µg/ml bisbenzimide (Hoechst H33258) to stain the DNA. Samples were extensively washed after observation under a Zeiss Axiovert microscope. Immunofluorescence produced after staining with pB438L-specific antibodies was located in discrete perinuclear cytoplasmic areas (Fig. 3cDown) that corresponded to virus factories, as indicated by their co-localization with DNA-containing cytoplasmic foci (Fig. 3dDown). Viral DNA is replicated and accumulated at late times in the infection cycle in these areas, after a nucleus-dependent early phase of viral DNA synthesis (García-Beato et al., 1992Down ; Rojo et al., 1999Down ), and ASFV morphogenesis also takes place (Breese & De Boer, 1966Down ; Andrés et al., 1997Down ). To confirm the presence of p49 within ASFV factories, immunoelectron microscopy was performed. Vero cell cultures infected with ASFV at an m.o.i. of 10 p.f.u. per cell for 20 h were fixed with 4% formaldehyde and 0·1% glutaraldehyde in 0·2 M HEPES (pH 7·2) and processed by freeze substitution as described previously (Andrés et al., 1997Down ). Cryo-sections were washed, incubated for 1 h with anti-pB438L serum and immunodetected with protein A–gold (15 nm) complexes (BioCell). As expected, most of the gold particles were detected in discrete cytoplasmic areas close to the nucleus, which contained electron-dense virus-like structures (Fig. 3eDown,fDown).



View larger version (121K):
[in this window]
[in a new window]
 
Fig. 3. Localization of p49 in ASFV-infected cells. (a)–(d) Immunofluorescence analysis. Vero cells either mock infected (a, b) or ASFV infected (c, d) were fixed and processed for immunofluorescence with rabbit anti-pB438L serum (a, c) and bisbenzimide H33258 (b, d). Virus factories are indicated by arrows. (e)–(f) Immunoelectron microscopy of ASFV-infected cells. Vero cells infected with ASFV for 20 h were harvested, fixed, cryo-sectioned and immunolabelled with rabbit anti-pB438L and protein A–gold complexes. Bars represent 500 (e) or 200 (f) nm.

 
The presence of p49 in virus factories indicates that the protein might be integrated into ASFV virions. To determine whether p49 was a structural component of the ASFV virion, samples of virus purified on Percoll gradients (Carrascosa et al., 1985Down ) were electrophoresed on 7–20% acrylamide gels and transferred to nitrocellulose. The detection of a protein band of about 49 kDa by the anti-pB438L serum (Fig. 2cUp, lane T) suggested that p49 could be an integral component of the virus particle. However, this result could also reflect the presence of a minor contaminant in purified virus preparations, highlighted by the high specificity of the antiserum raised against the protein. To rule out this possibility, samples of purified ASFV were treated with the non-ionic detergent octyl glucoside (OG) at a concentration of 0·5% for 1 h at 4 °C, to release the external components of the virus particle (Carrascosa et al., 1991Down ). A contaminant should remain outside the virion and would be found among the solubilized external components of the virus, in the supernatant of the centrifugation performed after the detergent treatment. Fig. 2(c)Up shows that the antiserum against pB438L was able to detect p49 only in the fraction of subviral particles generated after OG treatment (lane SD) and not in the supernatant (lane SN). As a positive control, the external virus protein p35 was detected both in the untreated sample and in the supernatant (Fig. 2dUp, lanes T and SN), but not in the sediment (lane SD), when the nitrocellulose membrane was incubated with a rabbit antiserum specific for p35 (Simón-Mateo et al., 1997Down ). The detection of an intense p49-specific signal in highly purified subviral particles, together with the observation of this protein in virus factories, either by immunofluorescence or immunoelectron microscopy, strongly supports the conclusion that p49 is an integral component of the ASFV particle.

The characterization of virus proteins as structural components of the virion is important not only to identify elements involved in certain virus functions (typically the attachment, internalization or fusogenic activities can be accomplished only by polypeptides present in the virus particle) but to achieve a better understanding of the processes occurring during the virus infection cycle. In the case of ASFV, besides the 15 structural proteins already described (Yáñez et al., 1995Down ), recent reports present evidence of virus proteins or components of uninfected cell membranes that are localized by immunofluorescence and immunoelectron microscopy on membrane-like structures within the virus factory and on virus particles (Brookes et al., 1998Down ; Webb et al., 1999Down ). Further efforts are still needed to complete a catalogue of ASFV structural components. In this report, we have characterized an ASFV protein, p49, induced late in infection, as an integral polypeptide of the virion. The role of this protein during the infection cycle is far from clear. The presence of p49 in the virus particle in an unexposed position (protected from detergent treatment) should indicate that this protein is not involved in the early interaction of ASFV with host-cell membranes; accordingly, the rabbit serum specific for p49 was not able to reduce binding of ASFV or infectious virus yield on Vero cells or swine macrophages, in experiments in which monolayers were pre-incubated and maintained during virus production in the presence of the antiserum (data not shown). The study of the possible involvement of p49 in other steps (e.g. virus uncoating, morphogenesis, RGD-mediated apoptosis of infected cells) of virus infection will provide more information about the functions of the ASFV structural components during the virus cycle.


   Acknowledgments
 
The authors thank M. J. Bustos for skilful technical assistance. This work was supported by grants from Ministerio de Educación y Cultura (Programa Sectorial de Promoción General del Conocimiento and Programa Nacional de Investigación y Desarrollo Agrario; PB96-0902-CO2-01 and AGF98-1352-CE) and from the European Community (FAIR5-PL97-3441) and by an institutional grant from the Fundación Ramón Areces.


   Footnotes
 
b This paper is dedicated to the memory of Eladio Viñuela. Back


   References
TOP
Abstract
Main text
References
 
Almazán, F., Rodríguez, J. M., Andrés, G., Pérez, R., Viñuela, E. & Rodríguez, J. F. (1992). Transcriptional analysis of multigene family 110 of African swine fever virus. Journal of Virology 66, 6655-6667.[Abstract/Free Full Text]

Almazán, F., Rodríguez, J. M., Angulo, A., Viñuela, E. & Rodríguez, J. F. (1993). Transcriptional mapping of a late gene coding for the p12 attachment protein of African swine fever virus. Journal of Virology 67, 553-556.[Abstract/Free Full Text]

Andrés, G., Simón-Mateo, C. & Viñuela, E. (1997). Assembly of African swine fever virus: role of polyprotein pp220. Journal of Virology 71, 2331-2341.[Abstract/Free Full Text]

Andrés, G., García-Escudero, R., Simón-Mateo, C. & Viñuela, E. (1998). African swine fever virus is enveloped by a two-membraned collapsed cisterna derived from the endoplasmic reticulum. Journal of Virology 72, 8988-9001.[Abstract/Free Full Text]

Breese, S. S. & DeBoer, C. J. (1966). Electron microscope observations of ASFV in tissue culture cells. Virology 28, 420-428.[Medline]

Brookes, S. M., Sun, H., Dixon, L. K. & Parkhouse, R. M. E. (1998). Characterization of African swine fever virion proteins j5R and j13L: immuno-localization in virus particles and assembly sites. Journal of General Virology 79, 1179-1188.[Abstract]

Carrascosa, J. L., Carazo, J. M., Carrascosa, A. L., García, N., Santisteban, A. & Viñuela, E. (1984). General morphology and capsid fine structure of African swine fever virus particles. Virology 132, 160-172.[Medline]

Carrascosa, A. L., del Val, M., Santarén, J. F. & Viñuela, E. (1985). Purification and properties of African swine fever virus. Journal of Virology 54, 337-344.[Abstract/Free Full Text]

Carrascosa, A. L., Sastre, I. & Viñuela, E. (1991). African swine fever virus attachment protein. Journal of Virology 65, 2283-2289.[Abstract/Free Full Text]

Chomczynski, P. (1993). A reagent for the single-step simultaneous isolation of RNA, DNA and proteins from cell and tissue samples. Biotechniques 15, 532-537.[Medline]

Costa, J. (1990). In Molecular Biology of Iridoviruses, pp. 247–270. Edited by G. Darai. Boston: Kluwer Academic.

Douillard, J. Y., Hoffman, T. & Herberman, R. B. (1980). Enzyme-linked immunosorbent assay for screening monoclonal antibody production: use of intact cells as antigen. Journal of Immunological Methods 39, 309-316.[Medline]

Esteves, A., Marques, M. I. & Costa, J. V. (1986). Two-dimensional analysis of African swine fever virus proteins and proteins induced in infected cells. Virology 152, 192-206.[Medline]

García-Beato, R., Salas, M. L., Viñuela, E. & Salas, J. (1992). Role of the host cell nucleus in the replication of African swine fever virus DNA. Virology 188, 637-649.[Medline]

Hess, W. R. (1981). African swine fever: a reassessment. Advances in Veterinary Science and Comparative Medicine 25, 39-69.[Medline]

Kyte, J. & Doolittle, R. F. (1982). A simple method for displaying the hydropathic character of a protein. Journal of Molecular Biology 157, 105-132.[Medline]

Laemmli, U. K. (1970). Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature 227, 680-685.[Medline]

Martínez-Pomares, L., Simón-Mateo, C., López-Otín, C. & Viñuela, E. (1997). Characterization of the African swine fever virus structural protein p14·5: a DNA binding protein. Virology 229, 201-211.[Medline]

Pearson, W. R. & Lipman, D. J. (1988). Improved tools for biological sequence comparison. Proceedings of the National Academy of Sciences, USA 85, 2444-2448.[Abstract/Free Full Text]

Rodríguez, J. M., Yáñez, R. J., Pan, R., Rodríguez, J. F., Salas, M. L. & Viñuela, E. (1994). Multigene families in African swine fever virus: family 505. Journal of Virology 68, 2746-2751.[Abstract/Free Full Text]

Rojo, G., García-Beato, R., Viñuela, E., Salas, M. L. & Salas, J. (1999). Replication of African swine fever virus DNA in infected cells. Virology 257, 524-536.[Medline]

Salas, J., Salas, M. L. & Viñuela, E. (1999). African swine fever virus: a missing link between poxviruses and iridoviruses? In Origin and Evolution of Viruses, pp. 467-480. Edited by E. Domingo, R. G. Webster & J. J. Holland. London: Academic Press.

Simón-Mateo, C., Andrés, G. & Viñuela, E. (1993). Polyprotein processing in African swine fever virus: a novel gene expression strategy for a DNA virus. EMBO Journal 12, 2977-2987.[Medline]

Simón-Mateo, C., Andrés, G., Almazán, F. & Viñuela, E. (1997). Proteolytic processing in African swine fever virus: evidence for a new structural polyprotein, pp62. Journal of Virology 71, 5799-5804.[Abstract/Free Full Text]

Studier, F. W. (1991). Use of bacteriophage T7 lysozyme to improve an inducible T7 expression system. Journal of Molecular Biology 219, 37-44.[Medline]

Viñuela, E. (1987). Molecular biology of African swine fever virus. In African Swine Fever, pp. 31-49. Edited by Y. Becker. Boston: Martinus Nijhoff.

Webb, J. H., Mayer, R. J. & Dixon, L. K. (1999). A lipid modified ubiquitin is packaged into particles of several enveloped viruses. FEBS Letters 444, 136-139.[Medline]

Yáñez, R. J., Rodríguez, J. M., Nogal, M. L., Yuste, L., Enríquez, C., Rodríguez, J. F. & Viñuela, E. (1995). Analysis of the complete nucleotide sequence of African swine fever virus. Virology 208, 249-278.[Medline]

Received 30 July 1999; accepted 5 October 1999.


This article has been cited by other articles:


Home page
J. Virol.Home page
C. Epifano, J. Krijnse-Locker, M. L. Salas, J. Salas, and J. M. Rodriguez
Generation of Filamentous Instead of Icosahedral Particles by Repression of African Swine Fever Virus Structural Protein pB438L
J. Virol., December 1, 2006; 80(23): 11456 - 11466.
[Abstract] [Full Text] [PDF]


Home page
J. Gen. Virol.Home page
A. Leitão, C. Cartaxeiro, R. Coelho, B. Cruz, R. M. E. Parkhouse, F. C. Portugal, J. D. Vigário, and C. L. V. Martins
The non-haemadsorbing African swine fever virus isolate ASFV/NH/P68 provides a model for defining the protective anti-virus immune response
J. Gen. Virol., March 1, 2001; 82(3): 513 - 523.
[Abstract] [Full Text]


Home page
J. Virol.Home page
R. Garcia-Escudero and E. Vinuela
Structure of African Swine Fever Virus Late Promoters: Requirement of a TATA Sequence at the Initiation Region
J. Virol., September 1, 2000; 74(17): 8176 - 8182.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via CrossRef
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Galindo, I.
Right arrow Articles by Carrascosa, A. L.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Galindo, I.
Right arrow Articles by Carrascosa, A. L.
Agricola
Right arrow Articles by Galindo, I.
Right arrow Articles by Carrascosa, A. L.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
INT J SYST EVOL MICROBIOL MICROBIOLOGY J GEN VIROL
J MED MICROBIOL ALL SGM JOURNALS