|
|
||||||||
Animal: DNA Viruses |
Centro de Biología Molecular Severo Ochoa (CSICUAM), Universidad Autónoma de Madrid, 28049 Madrid, Spain1
Author for correspondence: Angel Carrascosa. Fax +34 91 397 47 99. e-mail acarrascosa{at}cbm.uam.es
| Abstract |
|---|
|
|
|---|
| Main text |
|---|
|
|
|---|
The present study was undertaken to investigate the properties of the B438L ORF, which encodes a protein containing a cell attachment RGD (Arg-GlyAsp) motif (Yáñez et al., 1995
). The B438L ORF is located within the EcoRI B genomic fragment of the BA71V strain of ASFV and encodes a protein, designated pB438L, of 438 amino acids with a predicted molecular mass of 49·3 kDa. The hydropathy profile (Kyte & Doolittle, 1982
) did not show any evidence of putative transmembrane domains or sites for post-translational modification (data not shown), and no significant similarity was found between the amino acid sequence predicted for pB438L and other proteins in the databases in comparison analysis performed with the FASTA program (Pearson & Lipman, 1988
).
Transcription of the B438L ORF was studied by Northern blot and primer extension analyses. The RNA samples were prepared by the TRI-Reagent (Molecular Research Center) method (Chomczynski, 1993
) from mock-infected Vero cells, cells infected with ASFV (5 p.f.u. per cell, Vero cell-adapted BA71V strain) for 8 h in the presence of either 40 µg/ml cycloheximide (immediate-early RNA) or 100 µg/ml cytosine arabinoside (early RNA) and cells infected for 16 h in the absence of drugs (late RNA). Both the Northern blot and primer extension analyses were performed as described previously (Rodríguez et al., 1994
) by using a 32P-end-labelled oligonucleotide (5' CGCAGCTCCATTTTTGTTGCCGCAGTACCG 3') complementary to nucleotides 112141 of the coding strand of the B438L ORF. For Northern blots, 15 µg of each of the different RNAs was fractionated on formaldehydeagarose gels, transferred to nitrocellulose and hybridized to the 32P-labelled probe. For primer extension, after hybridization of the 5'-end-labelled primer to 20 µg of the different RNAs, the samples were extended with avian myeloblastosis virus reverse transcriptase for 2 h at 37 °C and then subjected to electrophoresis in 6% polyacrylamide sequencing gels. The results of the RNA hybridization (Fig. 1a
) revealed the existence of seven virus-induced late mRNA species, of 0·5, 1·0, 2·2, 2·5, 2·8, 4·2 and 5·5 kb, specifically recognized by the radioactive probe, while nothing was detected in the early mRNA samples. The results of the primer extension analysis revealed three primer-extended products in the late virus-induced RNA sample, with sizes of 147, 149 and 182 nucleotides (Fig. 1b
), which should correspond to late transcriptional initiation sites 6, 8 and 41 nucleotides, respectively, upstream of the initiation codon of the B438L ORF (Fig. 1c
). A motif composed of seven consecutive thymidylate residues (7T), identified as a signal for 3'-end formation of both early and late ASFV mRNAs (Almazán et al., 1992
, 1993
), was found 964 nucleotides downstream of the translation stop codon of the B438L ORF (Fig. 1c
). Termination at this 7T motif should yield a transcript of 2·3 kb, which corresponds to one of the fragments detected by Northern blot in the late RNA sample, while the other virus-induced mRNA species may correspond to transcripts of neighbouring ORFs (Fig. 1d
).
|
|
To extend these studies to other virus isolates, we infected cultures of swine macrophages (the natural host cell) with a variety of ASFV strains, including the non-virulent BA71V strain, two virulent field isolates (E70, Kirawira 69) and two partially attenuated virus samples obtained by four (L4) or 104 (L104) passages of the original virus in swine monocytes. Mock- or virus-infected cells, collected at late times of infection in the presence or absence of cytosine arabinoside, were analysed by Western blot with the pB438L-specific rabbit antiserum. As shown in Fig. 2(e)
, all of the ASFV strains tested were able to induce p49 in swine macrophages when the infection was made in the absence of inhibitors of viral DNA replication. These results substantiate the conclusion that B438L ORF is present in all of the ASFV strains tested and that its expression generates a protein (p49) similar to that synthesized by the BA71V virus strain in Vero cells.
The subcellular localization of p49 within ASFV-infected cells was studied by indirect immunofluorescence. Cultures of Vero cells, either mock infected or infected with ASFV at an m.o.i. of 1 p.f.u. per cell, were washed at 16 h p.i., fixed in methanol at -20 °C for 5 min and air dried. After washing in staining buffer (1% BSA in PBS), cells were incubated for 1 h at 37 °C with anti-pB438L rabbit antiserum diluted 1:100 in staining buffer, reacted with fluorescein-conjugated goat anti-rabbit serum and then incubated with 2 µg/ml bisbenzimide (Hoechst H33258) to stain the DNA. Samples were extensively washed after observation under a Zeiss Axiovert microscope. Immunofluorescence produced after staining with pB438L-specific antibodies was located in discrete perinuclear cytoplasmic areas (Fig. 3c
) that corresponded to virus factories, as indicated by their co-localization with DNA-containing cytoplasmic foci (Fig. 3d
). Viral DNA is replicated and accumulated at late times in the infection cycle in these areas, after a nucleus-dependent early phase of viral DNA synthesis (García-Beato et al., 1992
; Rojo et al., 1999
), and ASFV morphogenesis also takes place (Breese & De Boer, 1966
; Andrés et al., 1997
). To confirm the presence of p49 within ASFV factories, immunoelectron microscopy was performed. Vero cell cultures infected with ASFV at an m.o.i. of 10 p.f.u. per cell for 20 h were fixed with 4% formaldehyde and 0·1% glutaraldehyde in 0·2 M HEPES (pH 7·2) and processed by freeze substitution as described previously (Andrés et al., 1997
). Cryo-sections were washed, incubated for 1 h with anti-pB438L serum and immunodetected with protein Agold (15 nm) complexes (BioCell). As expected, most of the gold particles were detected in discrete cytoplasmic areas close to the nucleus, which contained electron-dense virus-like structures (Fig. 3e
,f
).
|
The characterization of virus proteins as structural components of the virion is important not only to identify elements involved in certain virus functions (typically the attachment, internalization or fusogenic activities can be accomplished only by polypeptides present in the virus particle) but to achieve a better understanding of the processes occurring during the virus infection cycle. In the case of ASFV, besides the 15 structural proteins already described (Yáñez et al., 1995
), recent reports present evidence of virus proteins or components of uninfected cell membranes that are localized by immunofluorescence and immunoelectron microscopy on membrane-like structures within the virus factory and on virus particles (Brookes et al., 1998
; Webb et al., 1999
). Further efforts are still needed to complete a catalogue of ASFV structural components. In this report, we have characterized an ASFV protein, p49, induced late in infection, as an integral polypeptide of the virion. The role of this protein during the infection cycle is far from clear. The presence of p49 in the virus particle in an unexposed position (protected from detergent treatment) should indicate that this protein is not involved in the early interaction of ASFV with host-cell membranes; accordingly, the rabbit serum specific for p49 was not able to reduce binding of ASFV or infectious virus yield on Vero cells or swine macrophages, in experiments in which monolayers were pre-incubated and maintained during virus production in the presence of the antiserum (data not shown). The study of the possible involvement of p49 in other steps (e.g. virus uncoating, morphogenesis, RGD-mediated apoptosis of infected cells) of virus infection will provide more information about the functions of the ASFV structural components during the virus cycle.
| Acknowledgments |
|---|
| Footnotes |
|---|
| References |
|---|
|
|
|---|
Almazán, F., Rodríguez, J. M., Angulo, A., Viñuela, E. & Rodríguez, J. F. (1993). Transcriptional mapping of a late gene coding for the p12 attachment protein of African swine fever virus. Journal of Virology 67, 553-556.
Andrés, G., Simón-Mateo, C. & Viñuela, E. (1997). Assembly of African swine fever virus: role of polyprotein pp220. Journal of Virology 71, 2331-2341.[Abstract]
Andrés, G., García-Escudero, R., Simón-Mateo, C. & Viñuela, E. (1998). African swine fever virus is enveloped by a two-membraned collapsed cisterna derived from the endoplasmic reticulum. Journal of Virology 72, 8988-9001.
Breese, S. S. & DeBoer, C. J. (1966). Electron microscope observations of ASFV in tissue culture cells. Virology 28, 420-428.[Medline]
Brookes, S. M., Sun, H., Dixon, L. K. & Parkhouse, R. M. E. (1998). Characterization of African swine fever virion proteins j5R and j13L: immuno-localization in virus particles and assembly sites. Journal of General Virology 79, 1179-1188.[Abstract]
Carrascosa, J. L., Carazo, J. M., Carrascosa, A. L., García, N., Santisteban, A. & Viñuela, E. (1984). General morphology and capsid fine structure of African swine fever virus particles. Virology 132, 160-172.[Medline]
Carrascosa, A. L., del Val, M., Santarén, J. F. & Viñuela, E. (1985). Purification and properties of African swine fever virus. Journal of Virology 54, 337-344.
Carrascosa, A. L., Sastre, I. & Viñuela, E. (1991). African swine fever virus attachment protein. Journal of Virology 65, 2283-2289.
Chomczynski, P. (1993). A reagent for the single-step simultaneous isolation of RNA, DNA and proteins from cell and tissue samples. Biotechniques 15, 532-537.[Medline]
Costa, J. (1990). In Molecular Biology of Iridoviruses, pp. 247270. Edited by G. Darai. Boston: Kluwer Academic.
Douillard, J. Y., Hoffman, T. & Herberman, R. B. (1980). Enzyme-linked immunosorbent assay for screening monoclonal antibody production: use of intact cells as antigen. Journal of Immunological Methods 39, 309-316.[Medline]
Esteves, A., Marques, M. I. & Costa, J. V. (1986). Two-dimensional analysis of African swine fever virus proteins and proteins induced in infected cells. Virology 152, 192-206.[Medline]
García-Beato, R., Salas, M. L., Viñuela, E. & Salas, J. (1992). Role of the host cell nucleus in the replication of African swine fever virus DNA. Virology 188, 637-649.[Medline]
Hess, W. R. (1981). African swine fever: a reassessment. Advances in Veterinary Science and Comparative Medicine 25, 39-69.[Medline]
Kyte, J. & Doolittle, R. F. (1982). A simple method for displaying the hydropathic character of a protein. Journal of Molecular Biology 157, 105-132.[Medline]
Laemmli, U. K. (1970). Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature 227, 680-685.[Medline]
Martínez-Pomares, L., Simón-Mateo, C., López-Otín, C. & Viñuela, E. (1997). Characterization of the African swine fever virus structural protein p14·5: a DNA binding protein. Virology 229, 201-211.[Medline]
Pearson, W. R. & Lipman, D. J. (1988). Improved tools for biological sequence comparison. Proceedings of the National Academy of Sciences, USA 85, 2444-2448.
Rodríguez, J. M., Yáñez, R. J., Pan, R., Rodríguez, J. F., Salas, M. L. & Viñuela, E. (1994). Multigene families in African swine fever virus: family 505. Journal of Virology 68, 2746-2751.
Rojo, G., García-Beato, R., Viñuela, E., Salas, M. L. & Salas, J. (1999). Replication of African swine fever virus DNA in infected cells. Virology 257, 524-536.[Medline]
Salas, J., Salas, M. L. & Viñuela, E. (1999). African swine fever virus: a missing link between poxviruses and iridoviruses? In Origin and Evolution of Viruses, pp. 467-480. Edited by E. Domingo, R. G. Webster & J. J. Holland. London: Academic Press.
Simón-Mateo, C., Andrés, G. & Viñuela, E. (1993). Polyprotein processing in African swine fever virus: a novel gene expression strategy for a DNA virus. EMBO Journal 12, 2977-2987.[Medline]
Simón-Mateo, C., Andrés, G., Almazán, F. & Viñuela, E. (1997). Proteolytic processing in African swine fever virus: evidence for a new structural polyprotein, pp62. Journal of Virology 71, 5799-5804.[Abstract]
Studier, F. W. (1991). Use of bacteriophage T7 lysozyme to improve an inducible T7 expression system. Journal of Molecular Biology 219, 37-44.[Medline]
Viñuela, E. (1987). Molecular biology of African swine fever virus. In African Swine Fever, pp. 31-49. Edited by Y. Becker. Boston: Martinus Nijhoff.
Webb, J. H., Mayer, R. J. & Dixon, L. K. (1999). A lipid modified ubiquitin is packaged into particles of several enveloped viruses. FEBS Letters 444, 136-139.[Medline]
Yáñez, R. J., Rodríguez, J. M., Nogal, M. L., Yuste, L., Enríquez, C., Rodríguez, J. F. & Viñuela, E. (1995). Analysis of the complete nucleotide sequence of African swine fever virus. Virology 208, 249-278.[Medline]
Received 30 July 1999;
accepted 5 October 1999.
This article has been cited by other articles:
![]() |
C. Epifano, J. Krijnse-Locker, M. L. Salas, J. Salas, and J. M. Rodriguez Generation of Filamentous Instead of Icosahedral Particles by Repression of African Swine Fever Virus Structural Protein pB438L J. Virol., December 1, 2006; 80(23): 11456 - 11466. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Leitão, C. Cartaxeiro, R. Coelho, B. Cruz, R. M. E. Parkhouse, F. C. Portugal, J. D. Vigário, and C. L. V. Martins The non-haemadsorbing African swine fever virus isolate ASFV/NH/P68 provides a model for defining the protective anti-virus immune response J. Gen. Virol., March 1, 2001; 82(3): 513 - 523. [Abstract] [Full Text] |
||||
![]() |
R. García-Escudero and E. Viñuela Structure of African Swine Fever Virus Late Promoters: Requirement of a TATA Sequence at the Initiation Region J. Virol., September 1, 2000; 74(17): 8176 - 8182. [Abstract] [Full Text] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| INT J SYST EVOL MICROBIOL | MICROBIOLOGY | J GEN VIROL |
| J MED MICROBIOL | ALL SGM JOURNALS | |