|
|
||||||||
Animal: RNA Viruses |
Fundació irsiCaixa, Laboratori de Retrovirologia, Hospital Universitari Germans Trias i Pujol, 08916 Badalona, Spain1
Author for correspondence: Miguel-Angel Martínez. Fax +34 93 4653968. e-mail mamartz{at}ns.hugtip.scs.es
| Abstract |
|---|
|
|
|---|
| Introduction |
|---|
|
|
|---|
Here we report the genomic fluctuations in HIV-1 popula- tions from patients subjected to indinavir monotherapy. We analysed the virus sequence evolution of the protease and C2V3 env gene regions in four infected patients. Viral RNA from plasma samples obtained at the beginning of treatment and after 12 weeks of drug therapy was amplified by RTPCR. Products were cloned and 1015 clones from each sample were sequenced. A neighbour-joining phylogenetic analysis of the sequences from the patients who were transient responders showed that the env and protease sequences at the beginning of treatment clustered distinctly from sequences obtained after therapy. Such changes in quasispecies were not detected in patients in whom population bottlenecks were not observed, that is, in the non-responders. These results document that population bottlenecks during indinavir therapy can cause genetic modifications not only in the protease gene but also in other genomic regions, in particular in the env quasispecies.
| Methods |
|---|
|
|
|---|
Patients.
|
Recovery and amplification of plasma viral RNA.A 5 µl aliquot from the first PCR was amplified in a 100 µl reaction mixture containing 10 pmol of protease oligonucleotides 5'prot 2 (sense) (5' TCAGAGCAGACCAGAGCCAACAGCCCCCA 3', HXB2 positions 21352162) and 3'prot 2 (antisense) (5' GCAAATACTGGAGTATTGTATGGATTTTCAGG 3', 27702792) or C2V3 env oligonucleotides ARP 826 (sense) (5' CGCTAGGAATTCGGCCAGTAGTATCAACTCAA 3', 70137029) and ARP 828 (antisense) (5' GTACACAAGCTTTCTGGGTCCCCTCCTGAGGA 3', 73137334), 200 µM dNTPs, 1·5 mM MgCl2, PCR buffer (50 mM KCl, 10 mM TrisHCl, pH 8·3) and 0·5 U Taq DNA polymerase (Perkin-Elmer). Cycling parameters were one cycle of denaturation at 94 °C for 2 min and then 30 cycles of denaturation at 94 °C for 30 s, annealing at 55 °C for 30 s and extension at 72 °C for 1 min. This was followed by a 7 min incubation at 72 °C. All PCRs were run with negative controls and employed procedures to prevent sample contamination. The sensitivity of the above nested PCR was determined to be one copy, based on nested PCR of a dilution series of an HIV-1 control DNA (HIVZ6) accurately titrated for copy number (Perkin-Elmer). The amount of input cDNA for the first step of the nested PCR was determined by PCR amplification of serial dilutions of the plasma viral RNA. An input cDNA copy number of 20 times the end-point for positive PCR amplification was used to ensure that multiple HIV templates were present in each sample.
Cloning and sequencing.
To verify protease and C2V3 env gene amplification and to estimate product yield, 5% of the nested PCR mixture was run on a 1·5% agarose gel. PCR products were purified by using the Qiaquick spin PCR purification kit (Qiagen). Approximately 50 ng DNA was ligated with the TA cloning plasmid pGEM T (Promega). Competent Escherichia coli XL-1 cells were then transformed and screened for white colonies on ampicillinIPTGX-Gal agar plates. A small-scale plasmid preparation was carried out to recover bacterial DNA. Isolated plasmid DNA was screened for protease or C2V3 env genes by PCR with oligonucleotides 5'prot 2 and 3'prot 2 or ARP 826 and ARP 828, respectively. For each sample, DNA from about 10 colonies was sequenced with the ABI PRISM dRhodamine terminator cycle sequencing kit (Applied Biosystems). The products of the reactions were then analysed on an Applied Biosystems 310 sequencer. Sequencing oligonucleotides for the protease gene were 5'prot 2 and 3'prot 2, and ARP 826 and ARP 828 for the C2V3 env gene. Sequence editing was performed by using the Sequence Navigator program (Applied Biosystems).
Analysis of the sequence data.
Sequences were aligned by using CLUSTAL W (Thompson et al., 1994
). Phylogenetic reconstructions were generated by using the neighbour-joining method in the PHYLIP software (Felsenstein, 1988
, 1995
), with a maximum-likelihood distance matrix and a ratio of transition to transversion of 2·0 (programs DNADIST and NEIGHBOR). Bootstrap resampling (Felsenstein, 1985
) was applied to the neighbour-joining trees (programs SEQBOOT and CONSENSE) to assign approximate confidence limits to individual branches. The final graphical output was created with the program TreeView (Page, 1996
). The proportions of synonymous substitutions per potential synonymous site and nonsynonymous substitutions per potential nonsynonymous site were calculated with the program WET (Dopazo, 1995
). The distributions of DNA distances for each time-point and patient were subjected to nonparametric statistical treatment by using Wilcoxons signed rank test included in the SPSS version 7.5 software package (SPSS Inc.).
| Results |
|---|
|
|
|---|
Quasispecies changes in the protease gene after indinavir therapy
Fig. 2(a)
shows an alignment of the deduced amino acid sequences of the protease nucleotide sequences obtained for patients A to D at the beginning of the therapy and at 12 weeks of therapy. After the start of therapy, the four patients presented clones with substitutions at critical positions, residues 46 and 82, in the development of indinavir resistance (Boden & Markowitz, 1998
). Secondary substitutions in the development of indinavir resistance, residues 10, 32, 63, 71 and 90, were also detected in the four patients, but no two presented the same pattern of substitutions. Some of these secondary substitutions were observed before the introduction of the therapy, at residues 10 (patient C), 63 (A, B, C and D), 71 (B) and 90 (A). In contrast, no critical substitutions were observed before the treatment. No clear differences in the development of genetic resistance were detected between transient and non-responder patients. In addition, after 24 weeks of treatment (12 for patient B), the four patients presented phenotypic resistance to indinavir (Table 1
) (Ruiz et al., 1998
).
|
|
|
|
To construct evolutionary relationships among the protease sequences obtained before and after the introduction of therapy, a neighbour-joining phylogenetic analysis of all protease sequences was carried out (Fig. 3a
). Interestingly, two different topological patterns were observed in the phylogenetic reconstruction of sequences from the transient-responders and the non-responders. For the transient-responders, who had a drastic drop in plasma viraemia early after the introduction of the therapy (Fig. 1
), the protease sequences obtained after 12 weeks of therapy showed distinctive clustering with respect to the sequences obtained at the beginning of treatment (Fig. 3a
). This observation was supported by bootstrap proportions of greater than 50 of 100 bootstrap replicates, as shown in the neighbour-joining phylogenetic reconstruction. In contrast, the phylogenetic reconstruction for the non-responders showed an intermingling of protease sequences from the two time-points (Fig. 3a
). Interestingly, there was a correlation between the changes in quasispecies and the reduction in DNA sequence diversity after the introduction of therapy.
|
Similar to the results found within the protease gene, the rate of quasispecies evolution (inter-sample sequence distances) (Table 2
) in the responder patients (4·9±1·8) was higher than for the non-responders (1·5±0·8) (P<0·001). Likewise, a statistically significant intra-sample DNA sequence distance reduction after therapy was also observed in the transient-responder patients C (P<0·001) and D (P<0·001) (Table 4
). This time, a significant intra-sample DNA sequence distance reduction after therapy was also observed within the non-responder patients A (P=0·008) and B (P<0·001). When the synonymous and nonsynonymous nucleotide substitution patterns were computed for the env quasispecies (Table 4
), significant increases in the ds/dn ratio were observed after 12 weeks of indinavir therapy for patients A, C and D. This increase indicates that there was an absence of selective pressure for amino acid changes within this env coding region during this period.
|
Taken together, these results suggest a temporal relationship between the beginning of antiretroviral therapy, a drastic reduction in virus load and a drift in the HIV-1 quasispecies.
| Discussion |
|---|
|
|
|---|
We have shown that the HIV-1 population changes at the env locus during the emergence of resistance to indinavir were only observed in those patients (C and D) where the development of resistance occurred with a drastic reduction in virus load (Fig. 1
). Therefore, although patients A and B developed genetic and phenotypic resistance to indinavir, the absence of population bottlenecks in these two subjects resulted in the absence of a temporal association between the beginning of antiretroviral therapy and a shift in the virus quasispecies. Interestingly, at time zero, these four patients had no apparent differences in terms of CD4+ T cell count or virus load (Fig. 1
), the four subjects being in an advanced stage of HIV-1 disease. Furthermore, the four patients had similar drug levels during the study period (Ruiz et al., 1998
) and no apparent differences in the occurrence of genetic and phenotypic resistance were observed between the two patient groups (Fig. 2a
; Table 1
). In addition to the changes at the env locus during the emergence of resistance to indinavir, we also detected a decrease in the genetic heterogeneity in the two loci analysed, protease and env, in the transient-responder patients (C and D). We have previously described a similar result in patients with prolonged suppression of plasma viraemia who, after 24 months of combination therapy, showed a reduction in their PBMC env virus population diversity (Martínez et al., 1999
). Interestingly, in both studies this decrease in env genetic diversity was accompanied by an increase in the ds/dn ratio, probably reflecting purifying negative selection expected for populations that are not subjected to significant immunological selection (Lukashov et al., 1995
; Wolinsky et al., 1996
; Liu et al., 1997
).
Changes in the genetic composition of the plasma env virus population during the emergence of resistance to a protease inhibitor, similar to that found here for patients C and D, have recently been documented (Nijhuis et al., 1998
). The changes in env observed in this report were correlated with the amplification of a few drug-resistant viruses. An earlier study, using heteroduplex mobility assays instead of DNA sequence determination, also found changes, although this time transient, at the env locus of HIV-1 populations during the emergence of protease-inhibitor resistance (Delwart et al., 1998
). In both studies, these changes in the populations are explained by the existence of a small effective population size. Assuming a larger virus population size, the observed genetic bottleneck would not be expected because the selection and amplification of a large pre-treatment resistant population would not produce changes in a genetic locus not directly implicated in the emergence of resistance (Leigh-Brown, 1997
; Leigh-Brown & Richman, 1997
; Nijhuis et al., 1998
; Delwart et al., 1998
). However, the former reports failed to analyse the impact of emergence of resistance in the absence of a reduction in virus load. The absence of a reduction in virus load during the emergence of genetic resistance to indinavir, found for patients A and B in the current study, is difficult to explain in the light of the small HIV-1 population size mentioned above. Similar results to those documented here for patients A and B have been reported during AZT treatment (Leigh-Brown & Cleland, 1996
; Cleland et al., 1996
; Sanchez-Palomino et al., 1996
). In these studies, an impact on the evolution of the env gene was not observed during the emergence of resistance to the therapy.
Although many studies have been carried out on HIV-1 evolution, controversy remains as to whether the observed HIV-1 genetic diversification is influenced more by positive selection events (i.e. selection of env variants to evade the host immune system: Coffin, 1995
; Wolinsky et al., 1996
) or by genetic drift (i.e. antigenic or cytokine stimulation and amplification of CD4+ T cells: Cheynier et al., 1994
, 1998
; Plikat et al., 1997
). The data presented here, which show that the population bottleneck that originated during indinavir therapy can select changes randomly in genomic regions not implicated in the emergence of resistance, suggest that virus bottlenecks during intra-patient transmission might be also important in the stochastic intra-patient evolution of HIV-1. Significantly, genetic bottlenecks can contribute to heterogeneity and divergence among populations and to the fixation of mutations independently of their selective value (Sanchez-Palomino et al., 1993
; Domingo et al., 1996
; Yuste et al., 1999
). For instance, a temporal correspondence has been shown between the appearance of virus with lower cytopathogenicity and the emergence of drug resistance during saquinavir monotherapy (Ercoli et al., 1997
). Virus population bottlenecks might be important in HIV-1 pathogenesis because some differences in virus replication capability in drug-resistant mutants could cause substantial variation in transmissibility and persistence. Estimation of the virus replication capability is important, since it has been postulated that less-fit viruses might give rise to a clinical benefit (Coffin, 1995
). Indeed, long-term non-progressing HIV-1-infected patients appear to have less-fit, non-syncytium-inducing viruses than progressors (Blaak et al., 1998
). However, the high virus loads, close to those found at time zero, detected here for patients C and D, in which an effective population bottleneck was observed, show the ease with which the drug-resistant virus can develop compensatory substitutions to improve its fitness (Nijhuis et al., 1997
; Martínez-Picado et al., 1999
). Future investigations are needed to determine the long-term clinical impact of the bottlenecks originating during the treatment of HIV-1-infected patients.
| Acknowledgments |
|---|
| Footnotes |
|---|
| References |
|---|
|
|
|---|
Boden, D. & Markowitz, M.(1998). Resistance to human immunodeficiency virus type 1 protease inhibitors. Antimicrobial Agents and Chemotherapy 42, 2775-2783.
Boom, R., Sol, C. J. A., Salimans, M. M. M., Jansen, C. L., Wertheim-van Dillen, P. M. E. & van der Noordaa, J.(1990). Rapid and simple method for purification of nucleic acids. Journal of Clinical Microbiology 28, 495-503.
Cabana, C., Clotet, B. & Martínez, M.-A. (1999). Emergence and genetic evolution of HIV-1 variants with mutations conferring resistance to multiple reverse transcriptase and protease inhibitors. Journal of Medical Virology 59, 480490.[Medline]
Chao, L.(1990). Fitness of RNA virus decreased by Mullers ratchet. Nature 348, 454-455.[Medline]
Cheynier, R., Henrichwark, S., Hadida, F., Pelletier, E., Oksenhendler, E., Autran, B. & Wain-Hobson, S.(1994). HIV and T cell expansion in splenic white pulps is accompanied by infiltration of HIV-specific cytotoxic T lymphocytes. Cell 78, 373-387.[Medline]
Cheynier, R., Gratton, S., Halloran, M., Stahmer, I., Letvin, N. L. & Wain-Hobson, S. (1998). Antigenic stimulation by BCG vaccine as an in vivo driving force for SIV replication and dissemination. Nature Medicine 4, 421-427.[Medline]
Clarke, D. K., Duarte, E. A., Moya, A., Elena, S. F., Domingo, E. & Holland, J. J. (1993). Genetic bottlenecks and population passages cause profound fitness differences in RNA viruses. Journal of Virology 67, 222-228.
Cleland, A., Watson, H. G., Robertson, P., Ludlam, C. A. & Leigh-Brown, A. (1996). Evolution of zidovudine resistance-associated genotypes in human immunodeficiency virus type 1-infected patients. Journal of Acquired Immune Deficiency Syndromes and Human Retrovirology 12, 6-18.[Medline]
Coffin, J. M. (1995). HIV population dynamics in vivo: implications for genetic variation, pathogenesis, and therapy. Science 267, 483-489.
Condra, J. H., Schleif, W. A., Blahy, O. M., Gabryelski, L. J., Graham, D. J., Quintero, J. C., Rhodes, A., Robbins, H. L., Roth, E., Shivaprakash, M., Titus, D., Yang, T., Teppler, H., Squires, K. E., Deutsch, P. J. & Emini, E. A. (1995). In vivo emergence of HIV-1 variants resistant to multiple protease inhibitors. Nature 374, 569-571.[Medline]
Condra, J. H., Holder, D. J., Schleif, W. A., Blahy, O. M., Danovich, R. M., Gabryelski, L. J., Graham, D. J., Laird, D., Quintero, J. C., Rhodes, A., Robbins, H. L., Roth, E., Shivaprakash, M., Yang, T., Chodakewitz, J. A., Deutsch, P. J., Leavitt, R. Y., Massari, F. E., Mellors, J. W., Squires, K. E., Steigbigel, R. T., Teppler, H. & Emini, E. A. (1996). Genetic correlates of in vivo viral resistance to indinavir, a human immunodeficiency virus type 1 protease inhibitor. Journal of Virology 70, 8270-8276.[Abstract]
Delwart, E. L., Pan, H., Neumann, A. & Markowitz, M. (1998). Rapid, transient changes at the env locus of plasma human immunodeficiency virus type 1 populations during the emergence of protease inhibitor resistance. Journal of Virology 72, 2416-2421.
Domingo, E., Escarmís, C., Sevilla, N., Moya, A., Elena, S. F., Quer, J., Novella, I. S. & Holland, J. J. (1996). Basic concepts in RNA virus evolution. FASEB Journal 10, 859-864.[Abstract]
Domingo, E., Menendez-Arias, L., Quiñones-Mateu, M. E., Holguin, A., Gutiérrez-Rivas, M., Martínez, M. A., Quer, J., Novella, I. S. & Holland, J. J. (1997). Viral quasispecies and the problem of vaccine-escape and drug-resistant mutants. Progress in Drug Research 48, 99-128.
Dopazo, J. (1995). Windows Easy Tree software package (version 1.3). http://www.tdi.es/programas/WET-i.html.
Duarte, E. A., Clarke, D., Moya, A., Domingo, E. & Holland, J. J. (1992). Rapid fitness losses in mammalian RNA virus clones due to Mullers ratchet. Proceedings of the National Academy of Sciences, USA 89, 6015-6019.
Ercoli, L., Sarmati, L., Nicastri, E., Giannini, G., Galluzzo, C., Vella, S. & Andreoni, M. (1997). HIV phenotype switching during antiretroviral therapy: emergence of saquinavir-resistant strains with less cytopathogenicity. AIDS 11, 1211-1217.[Medline]
Escarmis, C., Dávila, M., Charpentier, N., Bracho, A., Moya, A. & Domingo, E. (1996). Genetic lesions associated with Mullers ratchet in an RNA virus. Journal of Molecular Biology 264, 255-267.[Medline]
Felsenstein, J. (1985). Confidence limits on phylogenies: an approach using the bootstrap. Evolution 39, 783-791.
Felsenstein, J. (1988). Phylogenies from molecular sequences: inference and reliability. Annual Review of Genetics 22, 521-565.[Medline]
Felsenstein, J. (1995). Phylogeny inference package (PHYLIP), version 3.57c. University of Washington, Seattle, WA, USA. http://evolution.genetics.washington.edu/phylip.html.
Gulick, R. M., Mellors, J. W., Havlir, D., Eron, J. J., Gonzalez, C., McMahon, D., Richman, D. D., Valentine, F. T., Jonas, L., Meibohm, A., Emini, E. A. & Chodakewitz, J. (1997). Treatment with indinavir, zidovudine, and lamivudine in adults with human immunodeficiency virus infection and prior antiretroviral therapy. New England Journal of Medicine 337, 734-739.
Hammer, S. M., Squires, K. E., Hughes, M. D., Grimes, J. M., Demeter, L. M., Currier, J. S., Eron, J. J.Jr, Feinberg, J. E., Balfour, H. H.Jr, Deyton, L. R., Chodakewitz, J. A. & Fischl, M. A. (1997). A controlled trial of two nucleoside analogues plus indinavir in persons with human immunodeficiency virus infection and CD4 cell counts of 200 per cubic millimeter or less. AIDS Clinical Trials Group 320 Study Team. New England Journal of Medicine 337, 725-733.
Havlir, D. V., Eastman, S., Gamst, A. & Richman, D. D. (1996). Nevirapine-resistant human immunodeficiency virus: kinetics of replication and estimated prevalence in untreated patients. Journal of Virology 70, 7894-7899.[Abstract]
Hirsch, M. S., Conway, B., DAquila, R. T., Johnson, V. A., Brun-Vezinet, F., Clotet, B., Demeter, L. M., Hammer, S. M., Jacobsen, D. M., Kuritzkes, D. R., Loveday, C., Mellors, J. W., Vella, S. & Richman, D. D. (1998). Antiretroviral drug resistance testing in adults with HIV infection: implications for clinical management. International AIDS SocietyUSA Panel. Journal of the American Medical Association 279, 1984-1991.
Ho, D. D., Neumann, A. U., Perelson, A. S., Chen, W., Leonard, J. M. & Markowitz, M. (1995). Rapid turnover of plasma virions and CD4 lymphocytes in HIV-1 infection. Nature 373, 123-126.[Medline]
Lech, W. J., Wang, G., Yang, Y. L., Chee, Y., Dorman, K., McCrae, D., Lazzeroni, L. C., Erickson, J. W., Sinsheimer, J. S. & Kaplan, A. H. (1996). In vivo sequence diversity of the protease of human immunodeficiency virus type 1: presence of protease inhibitor-resistant variants in untreated subjects. Journal of Virology 70, 2038-2043.[Abstract]
Leigh-Brown, A. (1997). Analysis of HIV-1 env gene sequences reveals evidence for a low effective number in the viral population Proceedings of the National Academy of Sciences, USA 94, 1862-1865.
Leigh-Brown, A. & Cleland, A. (1996). Independent evolution of the env and pol genes of HIV-1 during zidovudine therapy. AIDS 10, 1067-1073.[Medline]
Leigh-Brown, A. & Richman, D. D. (1997). HIV-1: gambling on the evolution of drug resistance? Nature Medicine 3, 268-271.[Medline]
Liu, S. L., Schacker, T., Musey, L., Shriner, D., McElrath, M. J., Corey, L. & Mullins, J. I. (1997). Divergent patterns of progression to AIDS after infection from the same source: human immunodeficiency virus type 1 evolution and antiviral responses. Journal of Virology 71, 4284-4295.[Abstract]
Lukashov, V. V., Kuiken, C. L. & Goudsmit, J. (1995). Intrahost human immunodeficiency virus type 1 evolution is related to length of the immunocompetent period. Journal of Virology 69, 6911-6916.[Abstract]
Mansky, L. M. & Temin, H. M. (1995). Lower in vivo mutation rate of human immunodeficiency virus type 1 than that predicted from the fidelity of purified reverse transcriptase. Journal of Virology 69, 5087-5094.[Abstract]
Martínez, M. A., Cabana, M., Ibáñez, A., Clotet, B., Arnó, A. & Ruiz, L. (1999). Human immunodeficiency virus type 1 genetic evolution in patients with prolonged suppression of plasma viremia. Virology 256, 180-187.[Medline]
Martínez-Picado, J., Savara, A. V., Sutton, L. & DAquila, R. T. (1999). Replicative fitness of protease inhibitor-resistant mutants of human immunodeficiency virus type 1. Journal of Virology 73, 3744-3752.
Myers, G., Foley, B., Mellors, J. W., Korber, B., Jeang, K. T. & Wain-Hobson, S. (1996). Human retroviruses and AIDS database 1996. Los Alamos, NM: Theoretical Biology, Los Alamos National Laboratory.
Nájera, I., Holguin, A., Quiñones-Mateu, M. E., Muñoz-Fernandez, M. A., Nájera, R., López-Galindez, C. & Domingo, E. (1995). Pol gene quasispecies of human immunodeficiency virus: mutations associated with drug resistance in virus from patients undergoing no drug therapy.Journal of Virology 69, 23-31.[Abstract]
Nijhuis, M., Schurman, R., Jong, D. D., Schipper, P., Danner, S. & Boucher, C. (1997). Selection of HIV-1 variants with increase fitness during ritonavir therapy. In Program and Abstracts of the 1st International Workshop on HIV Drug Resistances and Treatment Strategies. St Petersburg, USA. June 1997.
Nijhuis, M., Boucher, C. A., Schipper, P., Leitner, T., Schuurman, R. & Albert, J. (1998). Stochastic processes strongly influence HIV-1 evolution during suboptimal protease-inhibitor therapy. Proceedings of the National Academy of Sciences, USA 95, 14441-14446.
Novella, I. S., Elena, S. F., Moya, A., Domingo, E. & Holland, J. J. (1995). Size of genetic bottlenecks leading to virus fitness loss is determined by mean initial population fitness. Journal of Virology 69, 2869-2872.[Abstract]
Page, R. D. M. (1996). TreeView: an application to display phylogenetic trees on personal computers. Computer Applications in the Biosciences 12, 357-358.
Plikat, U., Nieselt-Struwe, K. & Meyerhans, A. (1997). Genetic drift can dominate short-term human immunodeficiency virus type 1 nef quasispecies evolution in vivo. Journal of Virology 71, 4233-4240.[Abstract]
Richman, D. D. (1996). Antiretroviral drug resistance: mechanisms, pathogenesis, clinical significance. Advances in Experimental Medicine and Biology 394, 383-395.[Medline]
Ruiz, L., Nijhuis, M., Boucher, C., Puig, T., Bonjoch, A., Martínez-Picado, J., Marfil, S., de Jong, D., Burger, D., Arnó, A., Balagué, M. & Clotet, B. (1998). Efficacy of adding indinavir to previous reverse transcriptase nucleoside analogues in relation to genotypic and phenotypic resistance development in advanced HIV-1-infected patients. Journal of Acquired Immune Deficiency Syndromes and Human Retrovirology 19, 19-28.[Medline]
Sanchez-Palomino, S., Rojas, J. M., Martínez, M. A., Fenyö, E. M., Nájera, R., Domingo, E. & Lopez-Galíndez, C. (1993). Dilute passage promotes expression of genetic and phenotypic variants of human immunodeficiency virus type 1 in cell culture. Journal of Virology 67, 2938-2943.
Sanchez-Palomino, S., Olivares, I., Yuste, E., Richman, D. D. & Lopez-Galíndez, C. (1996). Random important alterations in HIV-1 viral quasispecies after antiviral treatment. Antiviral Therapy 4, 225-236.
Shafer, R. W., Winters, M. A., Palmer, S. & Merigan, T. C. (1998). Multiple concurrent reverse transcriptase and protease mutations and multidrug resistance of HIV-1 isolates from heavily treated patients. Annals of Internal Medicine 128, 906-911.
Thompson, J. D., Higgins, D. G. & Gibson, T. J. (1994). CLUSTAL W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice. Nucleic Acids Research 22, 4673-4680.
Wei, X., Ghosh, S. K., Taylor, M. E., Johnson, V. A., Emini, E. A., Deutsch, P., Lifson, J. D., Bonhoeffer, S., Nowak, M. A., Hahn, B. H., Saag, M. S. & Shaw, G. M. (1995). Viral dynamics in human immunodeficiency virus type 1 infection. Nature 373, 117-122.[Medline]
Wolinsky, S. M., Korber, B. T. M., Neumann, A. U., Daniels, M., Kunstman, K. J., Whetsell, A. J., Furtado, M. R., Cao, Y., Ho, D. D., Safrit, J. T. & Koup, R. A. (1996). Adaptative evolution of human immunodeficiency virus-type 1 during the natural course of infection. Science 272, 537-542.[Abstract]
Yuste, E., Sanchez-Palomino, S., Casado, C., Domingo, E. & López-Galíndez, C. (1999). Drastic fitness loss in human immunodeficiency virus type 1 upon serial bottleneck events.Journal of Virology 73, 2745-2751.
Received 1 June 1999;
accepted 7 September 1999.
This article has been cited by other articles:
![]() |
T. Nora, C. Charpentier, O. Tenaillon, C. Hoede, F. Clavel, and A. J. Hance Contribution of Recombination to the Evolution of Human Immunodeficiency Viruses Expressing Resistance to Antiretroviral Treatment J. Virol., July 15, 2007; 81(14): 7620 - 7628. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. Fernandez, B. Clotet, and M. A. Martinez Fitness Landscape of Human Immunodeficiency Virus Type 1 Protease Quasispecies J. Virol., March 1, 2007; 81(5): 2485 - 2496. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Charpentier, T. Nora, O. Tenaillon, F. Clavel, and A. J. Hance Extensive Recombination among Human Immunodeficiency Virus Type 1 Quasispecies Makes an Important Contribution to Viral Diversity in Individual Patients J. Virol., March 1, 2006; 80(5): 2472 - 2482. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. M. Kitrinos, J. A. E. Nelson, W. Resch, and R. Swanstrom Effect of a Protease Inhibitor-Induced Genetic Bottleneck on Human Immunodeficiency Virus Type 1 env Gene Populations J. Virol., August 15, 2005; 79(16): 10627 - 10637. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. M. Troyer, K. R. Collins, A. Abraha, E. Fraundorf, D. M. Moore, R. W. Krizan, Z. Toossi, R. L. Colebunders, M. A. Jensen, J. I. Mullins, et al. Changes in Human Immunodeficiency Virus Type 1 Fitness and Genetic Diversity during Disease Progression J. Virol., July 15, 2005; 79(14): 9006 - 9018. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Li and M. J. Roossinck Genetic Bottlenecks Reduce Population Variation in an Experimental RNA Virus Population J. Virol., October 1, 2004; 78(19): 10582 - 10587. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Magierowska, F. Bernardin, S. Garg, S. Staprans, M. D. Miller, K. K. A. Van Rompay, and E. L. Delwart Highly Uneven Distribution of Tenofovir-Selected Simian Immunodeficiency Virus in Different Anatomical Sites of Rhesus Macaques J. Virol., March 1, 2004; 78(5): 2434 - 2444. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Doukhan and E. Delwart Population Genetic Analysis of the Protease Locus of Human Immunodeficiency Virus Type 1 Quasispecies Undergoing Drug Selection, Using a Denaturing Gradient-Heteroduplex Tracking Assay J. Virol., July 15, 2001; 75(14): 6729 - 6736. [Abstract] [Full Text] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| INT J SYST EVOL MICROBIOL | MICROBIOLOGY | J GEN VIROL |
| J MED MICROBIOL | ALL SGM JOURNALS | |