|
|
||||||||
Animal: RNA Viruses |
University of Cambridge Department of Medicine, Level 5, Addenbrookes Hospital, Hills Road, Cambridge CB2 2QQ, UK1
Clinical Microbiology and Public Health Laboratory, Level 6, Addenbrookes Hospital, Hills Road, Cambridge CB2 2QW, UK2
Author for correspondence: Andrew Lever. Fax +44 1223 336846. e-mail amll1{at}mole.bio.cam.ac.uk
| Abstract |
|---|
|
|
|---|
| Main text |
|---|
|
|
|---|
There is much evidence for Tax exerting a role in virus pathogenesis and cellular transformation (Nerenberg, 1990
; Pozzatti et al., 1990
; Grassmann et al., 1992
). The tax gene can be found in ATLL tumour tissue even when other proviral sequences have been deleted (Korber et al., 1991
; Ohshima et al., 1991
). We have previously demonstrated a correlation between provirus transcriptional activity and an abnormal level of cellular proliferation (Richardson et al., 1997
). With its many effects on cellular genes, Tax is the likely cause of this.
Despite possessing oncogenic properties, no part of the HTLV-I genome shows identity to known oncogenes. As the site of HTLV-I provirus integration into the host cell genome is generally regarded as random, oncogenesis by insertional mutagenesis is probably extremely infrequent. Despite this, a predilection for transcriptionally active proviruses to be found in G+C-rich chromatin was previously noted (Zoubak et al., 1994
). With only one report to date of two individuals sharing a common HTLV-I integration site (Macera et al., 1992
), the involvement of viral gene products in cellular transformation is more likely. The progression to leukaemia is probably a multi-step process (Okamoto et al., 1989
) with Tax involvement likely occurring early in virus pathogenesis.
HTLV-I has been divided into genetic groups [reviewed in Slattery et al. (1999)
]. HTLV-I sequences, including tax, differ between strain types (Ratner et al., 1991
). There is a greater degree of sequence conservation within TSP/HAM patients than within or between asymptomatic carriers (Niewiesk et al., 1994
, 1995
). No specifically neuropathic strain of HTLV-I has been identified.
We have studied a series of HTLV-I-infected T-cell clones generated from the blood of infected individuals, Du, Mu and Ph1C, as previously described (Wucherpfennig et al., 1989
; Hyer et al., 1991
; Höllsberg et al., 1992
; Zoubak et al., 1994
; Richardson et al., 1997
). Several of these clones, despite being isolated from a single TSP/HAM-affected individual, differ in their proliferative phenotypes: some exhibiting relatively IL-2-independent proliferation while others do not. An identical host background highlights the relative contribution of viral sequence changes to cellular dysfunction. Since the tax gene and its product are likely to be involved in cell proliferation (Richardson et al., 1997
), we characterized the tax gene sequence of each of these clones to look for mutations. PCR amplification of tax genes was effected using overlapping primer pairs spanning nucleotides 7195 and 8474 [ATK sequence, Seiki et al. (1983)
; tax1s 5' bio-TTCCTCCACCAGCAGGTCCT 3', tax1a 5' TGGGTTCCATGTATCCATTTG 3', tax
2s 5' bio-GCTCAGCTCTACAGTTCCTTA 3', tax
2a 5' AGCTGGTAGAGGTACAT 3', tax
2s 5' bio-ATGGATACATGGAACCCA 3', tax
2a 5' AGGCTGTCAGCGTGACG 3', tax
2s 5' bio-CCAATGTTCCCTACAAACGA 3', tax3s 5' CGTCACGCTGACAGCCT 3', tax3a 5' bio-GGAGGTCTGAGCTTATGATT 3': s, sense oligonucleotide; a', antisense oligonucleotide; bio', biotin]. Biotinylated sequencing was carried out according to the manufacturers instructions (Dynal) using oligonucleotides tax1.seq 5' GGGTTGTATGAGTGATT 3', tax
2.seq 5' AGACAGGGTTGGGAGGTGCTGC 3', tax
2.seq 5' GGCAAACAGTCCTCGGGTAG 3', tax
2.seq 5' AGGAGGACTGTAGTACTA 3', and tax3.seq 5' TACCGATGGCACGCCTATGATT 3'. Two independent PCR products were analysed to ensure polymerase fidelity.
Remarkably no two clones harboured identical sequences for Tax or the LTR even in clones derived from a single individual. The 24 different variant tax nucleotides found both sense (residue unaltered) and missense (residue altered) are summarized in Table 1
and Fig. 1
. Clones Du20 and Du43 possessed a change (TGG to TAG) resulting in stop codons at positions 56 and 28, respectively. Of the six coding changes, three (G149S, H279R and G339S) do not appear to affect Tax function, as these also occur in productively infected clones (Du4, Du26 or Mu16) which exhibit spontaneous proliferation and produce infectious HTLV-I particles (Richardson et al., 1997
). Moreover, the G339S change is located in a region dispensable for Tax function (Semmes & Jeang, 1995
). The G14R and H279Q changes in proviruses Du34 and Ph1C, respectively, may affect Tax activity. The A221V change in the Du and Mu clones is a natural variant of Cosmopolitan-type HTLV-I (Mahieux et al., 1995
; Renjifo et al., 1995
).
|
|
|
Mutagenesis of plasmids pcDNA3Tax/Rex (Tax expression vector, Tax gene driven by cytomegalovirus promoter) and CR-CAT [pU3R-I (Sodroski et al., 1984
); CAT gene driven by HTLV-I LTR] was effected via site-directed mutagenesis (Kunkel et al., 1987
) of a pBluescript KSII(+) (Stratagene) intermediate containing either the 2047 bp HindIIIEcoRI fragment overlapping the tax region from pcDNA3Tax/Rex or the 716 bp XhoIHindIII LTR-containing fragment from CR-CAT. Construct pcDNA3Tax(Du34)Rex produces the G14R mutant; pcDNA3Tax(Ph1C)Rex produces the H279Q mutant; CR(Du34)-CAT harbours the TRE II mutation and CR(Mu40)-CAT harbours the RBS mutation. The function of these mutants was assessed. DEAE-dextran (Sambrook et al., 1989
) transient cotransfection of 5 µg of CR-CAT and an equal amount of either pcDNA3Tax(Du34)Rex or pcDNA3Tax(Ph1C)Rex, or 5 µg of either CR(Du34)-CAT or CR(Mu40)-CAT and 5 µg of pcDNA3Tax/Rex into COS-1 fibroblasts was performed. The combined effect of the Tax and LTR mutations from clone Du34 was analysed by cotransfecting 5 µg CR(Du34)-CAT and 5 µg pcDNA3Tax(Du34)/Rex. CAT acetylation was assessed by thin layer chromatography and quantified on an Instant Imager (Canberra Packard). The pcDNA3Tax(Ph1C)Rex and CR(Mu40)-CAT constructs function at a level comparable to wild-type (Fig. 1b
); however, the pcDNA3Tax(Du34)Rex and CR(Du34)-CAT constructs show acetylation levels approximately fivefold and twofold lower than the wild-type. In this context the effects of the Du34 Tax and enhancer mutations were not additive. A Tax allele containing the G14R substitution has been shown to be functionally compromised (Niewiesk et al., 1995
): our data support this observation. This change falls within a defined CTL epitope and results in loss of CTL recognition in vitro and trans-activation pertaining to the in vitro up-regulation of the viral LTR or the IL-2R
chain promoter (Parker et al., 1994
; Niewiesk et al., 1995
). A high level of Tax1119-specific CD8+ T-cells in the peripheral blood of TSP/HAM-affected individuals with enrichment occurring in the cerebrospinal fluid of these patients was demonstrated (Greten et al., 1998
). These data highlight how escape mutations at immunologically important epitopes may compromise virus protein function.
The central conserved domain of the TRE is crucial for CREB-binding. When the Du34 Tax and LTR mutants were cotransfected, the resulting level of acetylation mirrored that of the Tax mutant alone, suggesting that the Tax change is the predominant silencing mutation in the in vitro system.
The nucleotide changes in tax might also affect the overlapping rex and tof genes (Fig. 1
, Table 1
). The rex ORF overlaps the tax gene as far as tax codons 171/172 whereas tof only overlaps as far as tax codons 84/85 (Ciminale et al., 1992
; Koralnik et al., 1992
). Changes in Rex that abrogate its function may result in altered post-translational splicing control of the mRNA species. An arginine-rich N-terminal region of Rex is involved in its nuclear localization and binding to the RxRE (Hammes & Greene, 1993
), and an activation domain thought to be a target for a cellular factor spans residues 79 and 99 (Weichselbraun et al., 1992
). The R72K and P169Q variants do not affect Rex function as these occur in the productively infected clone Du4, which expresses all of the structural viral proteins. The functional significance of the G47S, G75R, P180L and L106S changes has yet to be evaluated as they were identified in silently infected clones, the first three occurring in the proviruses from either Du20 or Du43, which have premature stop codons in tax.
The Tof D211N substitution appears to be functionally insignificant as it occurs within the Du4 provirus. The significance of a R171Q change in the clone Du34 is unclear. Given the lack of evidence that Tof is essential it seems unlikely that this change in Du34 is central to the ablation of provirus activity.
The cause of the transcriptional inactivity of the three proviruses harboured by clone Ph1C may relate to the CD8 phenotype of this clone. Much higher levels of transcription from the HTLV-I LTR in primary CD4+ T-cells, compared with primary CD8 cells, have been demonstrated, suggesting that cellular factors within CD8 T-cells may be insufficient to support efficient use of the HTLV-I promoter (Newbound et al., 1996
). Alternatively active suppression of transcription by CREB family members or other cellular factors might contribute (Xu et al., 1990
).
As well as contributing to the functional mapping of Tax, Rex and Tof and the 5' LTR our results illustrate the diversity of proviral sequence within an individual and show that transcriptional inactivity of the HTLV-I provirus in naturally infected T-cell clones can be caused by naturally occurring mutations, suggesting interplay with a variety of factors. Defective tax genes causing truncated proteins, or proteins with reduced trans-activation activity are associated with the non-virus-expressing and non-proliferative cellular phenotype. LTR defects may also contribute to virus silencing. A CD8 cell phenotype, integration site context and mutations resulting in abnormal mRNA production (Major et al., 1995
) may also cause provirus inactivation. In some clones, however, none of these factors pertain, the LTR is functionally intact and the reasons for transcriptional inactivity are unclear. Further work to investigate the causes of virus silencing in these clones is ongoing.
| Acknowledgments |
|---|
The authors acknowledge the scientific support of the HTLV-I European Research Network. This work was financially supported in part by grants from the Medical Research Council (UK), Isaac Newton Trust, the Sykes Trust, and the Wellcome Trust. N.J.R was supported for part of this study by a Lady Tata Memorial Trust fellowship.
| Footnotes |
|---|
| References |
|---|
|
|
|---|
Bosselut, R., Duvall, J., Gégonne, A., Bailly, M., Hémar, A., Brady, J. & Ghysdael, J. (1990). The product of the c-ets-1 proto-oncogene and the related Ets2 protein act as transcriptional activators of the long terminal repeat of human T cell leukemia virus HTLV-1. EMBO Journal 9, 3137-3144.[Medline]
Ciminale, V., Pavlakis, G., Derse, D., Cunningham, C. & Felber, B. (1992). Complex splicing in the human T-cell leukemia virus (HTLV) family of retroviruses: novel mRNAs and proteins produced by HTLV type I. Journal of Virology 66, 1737-1745.
Evangelista, A., Maroushek, S., Minnigan, H., Larson, A., Retzel, E. & Haase, A. (1990). Nucleotide-sequence analysis of a provirus from an individual with tropical spastic paraparesis. Microbial Pathogenesis 8, 259-278.[Medline]
Fujisawa, J.-I., Toita, M., Yoshimura, T. & Yoshida, M. (1991). The indirect association of human T-cell leukemia virus tax protein with DNA results in transcriptional activation. Journal of Virology 65, 4525-4528.
Gégonne, A., Bosselut, R., Bailly, R.-A. & Ghysdael, J. (1993). Synergistic activation of the HTLV1 LTR Ets-responsive region by transcription factors Ets1 and Sp1. EMBO Journal 12, 1169-1178.[Medline]
Gessain, A., Boeri, E., Yanagihara, R., Gallo, R. & Franchini, G. (1993). Complete nucleotide sequence of a highly divergent human T-cell leukemia (lymphotropic) virus type I (HTLV-I) variant from Melanesia: genetic and phylogenetic relationship to HTLV-I strains from other geographical regions. Journal of Virology 67, 1015-1023.
Gitlin, S., Bosselut, R., Gégonne, A., Ghysdael, J. & Brady, J. (1991). Sequence-specific interaction of the Ets1 protein with the long terminal repeat of the human T-lymphotropic virus type I. Journal of Virology 65, 5513-5523.
Grassmann, R., Berchtold, S., Radant, I., Alt, M., Fleckenstein, B., Sodroski, J., Haseltine, W. & Ramstedt, U. (1992). Role of human T-cell leukemia virus type 1 X region proteins in immortalization of primary human lymphocytes in culture. Journal of Virology 66, 4570-4575.
Greatorex, J., Laisse, V., Dokhélar, M.-C. & Lever, A. (1996). Sequences involved in the dimerisation of human T cell leukaemia virus type-1 RNA. Nucleic Acids Research 24, 2919-2923.
Greten, T., Slansky, J., Kubota, R., Soldan, S., Jaffee, E., Leist, T., Pardoll, D., Jacobson, S. & Schneck, J. (1998). Direct visualization of antigen-specific T cells: HTLV-1 Tax1119-specific CD8+ T cells are activated in peripheral blood and accumulate in cerebrospinal fluid from HAM/TSP patients. Proceedings of the National Academy of Sciences, USA 95, 7568-7573.
Hammes, S. & Greene, W. (1993). Multiple arginine residues within the basic domain of HTLV-I Rex are required for specific RNA binding and function. Virology 193, 41-49.[Medline]
Hanly, S., Rimsky, L., Malim, M., Kim, J., Hauber, J., Duc Dodon, M., Le, S.-Y., Maizel, J., Cullen, B. & Greene, W. (1989). Comparative analysis of the HTLV-I Rex and HIV-1 Rev trans-regulatory proteins and their RNA response elements. Genes & Development 3, 1534-1544.
Höllsberg, P. & Hafler, D. (1993). Pathogenesis of diseases induced by human lymphotropic virus type I infection. Seminars in Medicine of the Beth Israel Hospital, Boston 328, 1173-1182.
Höllsberg, P., Wucherpfennig, K., Ausubel, L., Calvo, V., Bierer, B. & Hafler, D. (1992). Characterization of HTLV-I in vivo infected T cell clones. Journal of Immunology 148, 3256-3263.[Abstract]
Hyer, S., Richardson, J., Brown, M., Lever, A. & Nussey, S. (1991). Progressive flaccid myelopathy associated with HTLV-I. Lancet 338, 944.[Medline]
Koralnik, I., Gessain, A., Klotman, M., Monico, A., Berneman, Z. & Franchini, F. (1992). Protein isoforms encoded by the pX region of human T-cell leukemia/lymphotropic virus type I. Proceedings of the National Academy of Sciences, USA 89, 8813-8817.
Korber, B., Okayama, A., Donnelly, R., Tachibana, N. & Essex, M. (1991). Polymerase chain reaction analysis of defective human T-cell leukemia virus type I proviral genomes in leukemic cells of patients with adult T-cell leukemia. Journal of Virology 65, 5471-5476.
Kunkel, T., Roberts, J. & Zakour, R. (1987). Rapid and efficient site-specific mutagenesis without phenotypic selection. Methods in Enzymology 154, 367-382.[Medline]
Macera, M., Szabo, P. & Verma, R. (1992). Chromosomal localization of HTLV-1 viral integration sites using in situ hybridization: detection of a novel IL2R fragment. Molecular and General Genetics 234, 466-474.
Mahieux, R., de The, G. & Gessain, A. (1995). The tax mutation at nucleotide 7959 of human T-cell leukemia virus type 1 (HTLV-1) is not associated with tropical spastic paraparesis/HTLV-1-associated myelopathy but is linked to the Cosmopolitan molecular genotype. Journal of Virology 69, 5925-5927.[Medline]
Major, M., Daenke, S., Nightingale, S. & Desselberger, U. (1995). Differential Tax expression in HTLV type I-infected asymptomatic carriers. AIDS Research and Human Retroviruses 11, 415-421.[Medline]
Malik, K. T. A., Even, J. & Karpas, A. (1988). Molecular cloning and complete nucleotide sequence of an adult T cell leukaemia virus/human T cell leukaemia virus type I (ATLV/HTLV-I) isolate of Caribbean origin: relationship to other members of the ATLV/HTLV-I subgroup. Journal of General Virology 69, 1695-1710.
Nerenberg, M. (1990). An HTLV-I transgenic mouse model: role of the Tax gene in pathogenesis in multiple organ systems. Current Topics in Microbiology and Immunology 160, 121-128.[Medline]
Newbound, G. C., Andrews, J. M., ORourke, J. P., Brady, J. N. & Lairmore, M. D. (1996). Human T-cell lymphotropic virus type 1 Tax mediates enhanced transcription in CD4+ T lymphocytes. Journal of Virology 70, 2101-2106.[Abstract]
Niewiesk, S., Daenke, S., Parker, C., Taylor, G., Weber, J., Nightingale, S. & Bangham, C. (1994). The transactivator gene of human T-cell leukemia virus type I is more variable within and between healthy carriers than patients with tropical spastic paraparesis. Journal of Virology 68, 6778-6781.
Niewiesk, S., Daenke, S., Parker, C., Taylor, G., Weber, J., Nightingale, S. & Bangham, C. (1995). Naturally occurring variants of human T-cell leukemia virus type I Tax protein impair its recognition by cytotoxic T lymphocytes and the transactivation function of Tax. Journal of Virology 69, 2649-2653.[Abstract]
Ohshima, K., Kikuchi, M., Masuda, Y., Kobari, S., Sumiyashi, Y., Eguchi, F., Mohtai, H., Yoshida, T., Takeshita, M. & Kimura, M. (1991). Defective provirus form of human T-cell leukemia virus type 1 in adult T-cell leukemia/lymphoma: clinicopathological features. Cancer Research 57, 4639-4642.
Okamoto, T., Ohno, Y., Tsugane, S., Watanabe, S., Shimoyama, M., Tajima, K., Miwa, M. & Shimotohno, K. (1989). Multi-step carcinogenesis model for adult T-cell leukemia. Japanese Journal of Cancer Research 80, 191-195.[Medline]
Paine, E., Garcia, J., Philpott, T., Shaw, G. & Ratner, L. (1991). Limited sequence variation in human T-lymphotropic virus type 1 isolates from North American and African patients. Virology 182, 111-123.[Medline]
Parker, C., Nightingale, S., Taylor, G., Weber, J. & Bangham, C. (1994). Circulating anti-Tax cytotoxic T lymphocytes from human T-cell leukemia virus type I-infected people, with and without tropical spastic paraparesis, recognise multiple epitopes simultaneously. Journal of Virology 68, 2860-2868.
Pozzatti, R., Vogel, J. & Jay, G. (1990). The human T-lymphotropic virus type I tax gene can cooperate with the ras oncogene to induce neoplastic transformation of cells. Molecular and Cellular Biology 10, 413-417.
Ratner, L., Philpott, T. & Trowbridge, D. (1991). Nucleotide sequence analysis of isolates of human lymphotropic virus type 1 of diverse geographical origins. AIDS Research and Human Retroviruses 7, 923-941.[Medline]
Renjifo, B., Borrero, I. & Essex, M. (1995). Tax mutation associated with tropical spastic paraparesis/human T-cell leukemia virus type I-associated myelopathy. Journal of Virology 69, 2611-2616.[Abstract]
Richardson, J., Höllsberg, P., Windhagen, A., Child, L., Hafler, D. & Lever, A. (1997). Variable immortalizing potential and frequent virus latency in blood-derived T cell clones infected with human T-cell leukemia virus type I. Blood 89, 3303-3314.
Sambrook, J., Fritsch, E. & Maniatis, T. (1989). In Molecular Cloning: A Laboratory Manual, 2nd edn. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory.
Seiki, M., Hattori, S., Hirayama, Y. & Yoshida, M. (1983). Human adult T-cell leukemia virus: complete nucleotide sequence of the provirus genome integrated in leukemia cell DNA. Proceedings of the National Academy of Sciences, USA 80, 3618-3622.
Semmes, O. & Jeang, K.-T. (1995). Definition of a minimal activation domain in human T-cell leukemia virus type I Tax. Journal of Virology 69, 1827-1833.[Abstract]
Slattery, J., Franchini, G. & Gessain, A. (1999). Genomic evolution, patterns of global dissemination, and interspecies transmission of human and simian T-cell leukemia/lymphotropic viruses. Genome Research 9, 525-540.
Sodroski, J., Rosen, C. & Haseltine, W. (1984). Trans-acting transcriptional activation of the long terminal repeat of human T lymphotropic viruses in infected cells. Science 225, 381-385.
Toyoshima, H., Itoh, M., Inoue, J.-I., Seiki, M., Takaku, F. & Yoshina, M. (1990). Secondary structure of the human T-cell leukemia virus type 1 rex-responsive element is essential for rex regulation of RNA processing and transport of unspliced RNAs. Journal of Virology 64, 2825-2832.
Weichselbraun, I., Farrington, G., Rusche, J., Böhnlein, E. & Hauber, J. (1992). Definition of the human immunodeficiency virus type 1 Rev and human T-cell leukemia virus I Rex protein activation domain by functional exchange. Journal of Virology 66, 2583-2587.
Wucherpfennig, K., Höllsberg, P., Richardson, J., Benjamin, D. & Hafler, D. (1989). T-cell activation by autologous human T-cell leukemia virus type I-infected T-cell clones. Proceedings of the National Academy of Sciences, USA 89, 2110-2114.
Xu, Y.-L., Adya, N., Siores, E., Gao, Q. & Giam, C.-Z. (1990). Cellular factors involved in transcription and Tax-mediated trans-activation directed by the TGACGT motifs in human T-cell leukemia virus type I promoter. Journal of Biological Chemistry 265, 20285-20292.
Yoshida, M. (1996). Multiple targets of HTLV-I for dysregulation of host cells. Seminars in Virology 7, 349-360.
Zoubak, S., Richardson, J., Rynditch, A., Höllsberg, P., Hafler, D., Boeri, E., Lever, A. & Bernardi, G. (1994). Regional specificity of HTLV-I proviral integration in the human genome. Gene 143, 155-163.[Medline]
Received 9 August 1999;
accepted 9 September 1999.
This article has been cited by other articles:
![]() |
T. Koiwa, A. Hamano-Usami, T. Ishida, A. Okayama, K. Yamaguchi, S. Kamihira, and T. Watanabe 5'-Long Terminal Repeat-Selective CpG Methylation of Latent Human T-Cell Leukemia Virus Type 1 Provirus In Vitro and In Vivo J. Virol., August 12, 2002; 76(18): 9389 - 9397. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. J. Rose and A. M. L. Lever The rapamycin sensitivity of human T-cell leukaemia virus type I-induced T-cell proliferation is mediated independently of the polypyrimidine motifs in the 5' long terminal repeat J. Gen. Virol., February 1, 2001; 82(2): 435 - 439. [Abstract] [Full Text] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| INT J SYST EVOL MICROBIOL | MICROBIOLOGY | J GEN VIROL |
| J MED MICROBIOL | ALL SGM JOURNALS | |