|
|
||||||||
Animal: DNA Viruses |
Department of Microbiology, Faculty of Medicine1 and Institute of Molecular Agrobiology2, National University of Singapore, Block MD4/4A, 5 Science Drive 2, Singapore 117597, Republic of Singapore
Author for correspondence: Huaizhong Hu. Fax +65 776 6872. e-mail michuhz{at}nus.edu.sg
| Abstract |
|---|
|
|
|---|
| Introduction |
|---|
|
|
|---|
EBV is associated with a spectrum of malignancies of lymphoid and epithelial cell origin (Rickinson & Kieff, 1996
), such as Burkitts lymphoma, T-cell lymphoma, Hodgkins disease, undifferentiated nasopharyngeal carcinoma (NPC) and gastric carcinoma. NPC is the most consistently EBV-associated malignancy and occurs mainly among the Chinese population in Southern China and Southeast Asia. However, the EBV genome has been detected in malignant epithelial cells in NPC patients regardless of geographical origin (Wolf et al., 1973
). The demonstration of monoclonality of the viral DNA indicates that the malignancy has arisen from clonal expansion of a single EBV-infected progenitor cell (Raab-Traub & Flynn, 1986
). EBV latency-associated gene expression is consistently detected in NPC tumour cells and is regarded therefore as one of the factors in the oncogenesis (Brooks et al., 1992
). However, various lines of evidence indicate that reactivation of EBV can also occur in NPC tumour cells. Infectious EBV can be isolated from NPC tumour cells (Trumper et al., 1977
), and the linear form of the EBV genome, which is indicative of the productive cycle, can be detected in NPC tumour tissues in spite of the presence of the predominant episomal form (Raab-Traub & Flynn, 1986
). Levels of serum immunoglobulin A (IgA) directed against EBV lytic gene products, the early antigen (EA) and the viral capsid antigen (VCA), are elevated in NPC patients, and have been used as serological markers for diagnosis (Henle & Henle, 1976
). Moreover, cell-free EBV DNA has been detected in the plasma of most NPC patients, indicating productive virus release into the blood (Lo et al., 1999
).
Upon EBV reactivation, two key immediate early (IE) lytic genes, BZLF1 and BRLF1, encoding Zta (BZLF1 transcription activator) and Rta (BRLF1 transcription activator) respectively, are transcribed, and consequently activate several downstream viral promoters and lead to an ordered cascade of viral gene expression (Kieff, 1996
). Recently, Rta was reported to disrupt viral latency in an epithelial cell-specific fashion (Zalani et al., 1996
). Another study further proposed that Rta is sufficient for disruption of latency in both B lymphocytes and epithelial cells, although much higher levels of Rta were needed for efficient lytic cycle induction in B lymphocytes (Ragoczy et al., 1998
). These in vitro experiments suggest that there might be a difference in EBV replication mode between B cells and epithelial cells. As previously reported, EBV replication in healthy people occurs mainly in B cells residing in the oropharynx (Babcock et al., 1998
; Anagnostopoulos et al., 1995
; Thorley-Lawson et al., 1996
). NPC tumour tissues could be representative of EBV lytic replication in epithelial cells. By using biopsy tissues obtained from these two groups of people, it might be possible to identify whether there is indeed a difference in EBV replication between B and epithelial cells. We performed such a study, and found expression of EBV lytic genes, BZLF1, BALF2 and BCLF1, in both the NPC and the control biopsies. However, BRLF1 could be detected in NPC biopsies only, suggesting that in vivo EBV replication in NPC tumour epithelial cells differs from that in EBV-harbouring non-malignant cells in the control individuals. This finding is very interesting and meaningful, since the specific expression of EBV BRLF1 mRNA and especially its protein product, Rta, could be regarded as a tumour antigen for NPC, and therefore have potential use in NPC diagnosis.
| Methods |
|---|
|
|
|---|
Samples and cell line.B95-8 is an EBV-positive marmoset B cell line with approximately 5% of the cells in replication cycle. Cells were maintained in RPMI 1640 growth medium (GibcoBRL) supplemented with 10% FCS, 2 mM glutamine, 100 IU/ml penicillin, and 100 µg/ml streptomycin. Extensive EBV replication was induced by treating the cells with 20 ng/ml 12-O-tetradicanoylphorbol 13-acetate (TPA) and 3 mM sodium butyrate when needed.
RTPCR and hybridization.
Total RNA was isolated from snap-frozen biopsies and aliquots of 5x106 MNC with a high RNA isolation kit (Boehringer Mannheim), according to the manufacturers instructions and a procedure described previously (Hu et al., 1999
). To avoid DNA contamination, all RNA samples were treated with RNase-free DNase at 37 °C for 30 min. cDNA was synthesized in a 20 µl reaction mixture containing 2 µg of RNA as template using oligo-p(dT)15 primer and AMV reverse transcriptase (Boehringer Mannheim). To detect expression of BZLF1, BRLF1, BALF2 and BCLF1 mRNA, primers for two rounds of PCR and an internal oligonucleotide probe for Southern blotting were synthesized according to previously published sequences (Prang et al., 1997
). Procedures for RTPCR and hybridization have been described previously (Hu et al., 1999
). Briefly, 1 µl of the cDNA was added to a final volume of 50 µl PCR reaction mixture containing dNTP (0·2 mM), first round sense and antisense primers (0·5 µM each) and 1 unit of DynaZyme II DNA polymerase (Finnzymes). After being heated to 94 °C for 5 min, amplification was carried out for 35 cycles each consisting of 94 °C for 40 s, 55 °C for 40 s, and 72 °C for 1 min. Except for the internal control of the house-keeping gene histone 3.3, a nested PCR was performed in the presence of the second round primers and 1 µl of the first-round PCR product as templates, with an additional 20 cycles of amplification under the same conditions as described above. RNA isolated from B95-8 cells was used as a positive control for RTPCR detection of EBV lytic gene expression. Negative controls were performed in the absence of cDNA templates.
PCR products were separated on 1·7% agarose gel. After denaturation and neutralization, DNA was transferred from the gel onto a nylon membrane, and pre-hybridized in a buffer containing 5x Denhardts solution, 6x SSPE, 0·1% BSA and 0·02% SDS at 42 °C overnight. The internal oligonucleotide probe end-labelled with digoxigenin 11-dUTP (DIG) (Boehringer Mannheim) was added and allowed to hybridize at 42 °C for 1 h. The blot was washed with 2x SSPE containing 0·1% SDS at the melting temperature of each probe for 10 min and washed twice with 2x SPSS at room temperature. After blocking with buffer A (0·1 M maleic acid, 0·15 M NaCl; pH 7·5) supplemented with 1% blocking reagents (Boehringer Mannheim) at room temperature for 1 h, the membrane was incubated with alkaline phosphatase-conjugated anti-DIG monoclonal antibody at room temperature for 30 min, followed by washing twice with buffer A containing 0·3% Tween 20 and equilibrating with a buffer containing 0·1 M TrisHCl (pH 9·5) and 0·1 M NaCl for 3 min. Finally, chemiluminescent alkaline phosphatase substrate CSPD (Boehringer Mannheim) was added, and the signal was detected by exposing the membrane to X-ray film.
Plasmid construction.
Plasmid pTOPO-R605 (Fig. 1
), containing the 1818 bp full-length BRLF1 cDNA, was constructed by PCR using template cDNA synthesized from B95-8 mRNA of and the TOPO TA Cloning Kit (Invitrogen) according to the manufacturers instructions. The primers used were 5' CCGGAATTCATGAGGCCTAAAAAGGATGGCTT 3' (sense), and 5' TGCTCTAGACTAAAATAAGCTGGTGTCAAAAATAG 3' (antisense). Vector pKT for subcloning was derived from plasmid pING14 (Liu et al., 1994
). pKT-R172N, pKT-R435C and pKT-R222C constructs contained three truncated BRLF1 fragments under the control of T7 promoter (Fig. 1
). pKT-R172N contained the 519 bp N-terminal fragment of BRLF1, which was amplified by PCR using pTOPO-R605 plasmid DNA as template with primers 5' TAATACGACTCACTATAGGG 3' (sense) and 5' CTGTTGGATCCTTACACTACCTGCTTGCC 3' (antisense). The fragment was digested with EcoRV and BamHI and cloned into PvuII/BamHI-digested pKT vector. pKT-R435C was cloned using pTOPO-R605 plasmid DNA as template with primers 5' GCCTTCCATGGCAGCGGTCCACCAA 3' (sense) and 5' TGCTCTAGACTAAAATAAGCTGGTGTCAAAAATAG 3' (antisense), which amplified a DNA fragment of 1305 bp. pKTR222C was cloned with primers 5' GCCTTCCATGGCAGCGGTCCACCAA 3' (sense) and 5' TGCTCTAGACTAAAATAAGCTGGTGTCAAAAATAG 3' (antisense), which amplified a DNA fragment of 666 bp. In these two constructs, NcoI and XbaI restriction enzyme sites were incorporated at the end of the primers, and used for cloning.
|
In vitro translation.
Immunoprecipitation.
TNT product (5 µl) was added to 95 µl of a dilution buffer (0·14 M NaCl, 10 mM TrisHCl, pH 8·0, and 0·5% Nonidet P-40). After vortexing, 5 µl of plasma was added and incubated at room temperature for 30 min; 80 µl of protein ASepharose beads (100 mg/ml; Sigma) was then added and incubated with rotation at room temperature for 30 min. The beads were pelleted and washed three times with RIPA buffer (50 mM TrisHCl, pH 8·0, 150 mM NaCl, 1% Nonidet P-40, 1% sodium deoxycholate and 1% SDS), and then resuspended in 35 µl of loading buffer and boiled for 5 min. After centrifugation, supernatants were resolved on SDSPAGE (12·5% polyacrylamide). The gel was fixed in a solution containing 10% acetic acid and 50% methanol for 30 min, amplified with Amplify solution (Amersham) for 30 min, dried and finally exposed to X-ray film.
Statistical analysis.
Differences in anti-Rta antibody reactivity between NPC and healthy individuals were compared by Chi-square test. P<0·05 was considered to be significant.
| Results |
|---|
|
|
|---|
|
|
Detection of antibodies directed against BRLF1 gene product Rta
The entire BRLF1 open reading frame was cloned into pCRII-TOPO vector under the control of the T7 promoter. Transcription and translation of this construct in an in vitro TNT system in the presence of [35S]methionine resulted in the detection of a product with a molecular mass of approximately 70 kDa (Fig. 3
, lane 10). This should represent the full-length Rta. The radiolabelled Rta was used in an immunoprecipitation assay to detect anti-Rta IgG (IgG-Rta) antibodies. Plasma samples from 53 NPC patients prior to therapy and 53 healthy controls were used. Representative results from 4 NPC patients and 4 controls are shown in Fig. 3
. IgG-Rta was detected in plasma from 44 of the 53 NPC patients (83%), but in only 1 of the 53 healthy individuals (1·9%). This difference was statistically significant (P<0·01).
|
|
| Discussion |
|---|
|
|
|---|
Expression of BRLF1 may play an important role in the regulation of viral reactivation and in the development of NPC. BZLF1 and BRLF1 are expressed simultaneously within 2 h of induction of EBV replication (Takada & Ono, 1989
). Rta can act alone or synergistically with Zta to induce maximal activation of several viral promoters that are essential for EBV replication, including BMLF1, BMRF1, BHRF1 and the EBV DNA polymerase gene (Kenney et al., 1989
; Holley-Guthrie et al., 1990
; Cox et al., 1990
; Liu et al., 1996
). Rta also has a profound effect on cell cycle regulation (Henderson et al., 1993
; Gutsch et al., 1994
; Swenson et al., 1999
; Zacny et al., 1998
), and this might contribute to the oncogenesis of NPC. The gene product of BHRF1, one of the Rta-responsive lytic genes, is known as a viral homologue of proto-oncogene bcl-2, and can protect cells from apoptosis (Henderson et al., 1993
). Rta can activate the c-myc gene (Gutsch et al., 1994
) and induce elevation of E2F1 (Swenson et al., 1999
), a cellular factor important for proliferation. Together with its ability to inactivate the retinoblastoma protein (Rb), a crucial cell cycle suppressor, Rta can efficiently activate S-phase entry during viral lytic infection (Swenson et al., 1999
; Zacny et al., 1998
).
The expression of BRLF1 in NPC patients may have clinical uses, for instance as a diagnostic parameter for NPC. Our preliminary data have shown that the IgG antibodies directed against Rta can serve as a serological parameter for NPC diagnosis and screening in a susceptible population. This parameter seems to be highly specific, and the sensitivity could be further improved by using a larger amount of serum, which in this study was 5 µl diluted into 100 µl of the reaction buffer. However, it is not practical to use the present immunoprecipitation protocol for routine testing in a serological laboratory. Since we have identified the antibody-binding regions in Rta, it should be possible to develop a simpler method such as ELISA for detecting the IgG antibodies in the blood. We have previously reported that there are a large number of activated infiltrating T cells in the NPC tumour tissues, and many of these cells secrete interferon-
(Tang et al., 1999
). It will be interesting to investigate whether there are Rta-specific T cells among these infiltrating cells. In fact, multiple epitopes of Rta can be recognized by in vitro generated EBV-specific cytotoxic T cells from blood of healthy EBV-seropositive adults (Pepperl et al., 1998
).
In conclusion, we have demonstrated the expression of EBV lytic gene BRLF1 in NPC patients. The expression of its product, Rta, may facilitate tumour cell growth and consequently contribute to the disease progress. The detection of IgG antibodies directed against Rta in NPC patients can be developed into a diagnostic parameter.
| References |
|---|
|
|
|---|
Babcock, G. J., Decker, L. L., Volk, M. & Thorley-Lawson, D. A. (1998). EBV persistence in memory B cells in vivo.Immunity9, 395-404.[Medline]
Brooks, L., Yao, Q. Y., Rickinson, A. B. & Young, L. S. (1992). EpsteinBarr virus latent gene transcription in nasopharyngeal carcinoma cells: coexpression of EBNA1, LMP1, and LMP2 transcripts.Journal of Virology66, 2689-2697.
Cox, M. A., Leahy, J. & Hardwick, J. M. (1990). An enhancer within the divergent promoter of EpsteinBarr virus responds synergistically to the R transactivators and Z transactivators.Journal of Virology64, 313-321.
Feng, P., Chan, S. H., Ooi, E. E., Soo, M. Y. R., Loh, K. S., Wang, D., Ren, E. C. & Hu, H. Z. (1999). Elevated blood levels of soluble tumor necrosis factor receptors in nasopharyngeal carcinoma: correlation with humoral immune response to lytic replication of EpsteinBarr virus.International Journal of Oncology15, 167-172.[Medline]
Gutsch, D. E., Marcu, K. B. & Kenney, S. C. (1994). The EpsteinBarr virus BRLF1 gene product transactivates the murine and human c-myc promoters.Cellular and Molecular Biology40, 747-760.
Henderson, S., Huen, D., Rowe, M., Dawson, C., Johnson, G. & Rickinson, A. B. (1993). EpsteinBarr virus-coded BHRF1 protein, a viral homologue of Bcl-2, protects human B cells from programmed cell death.Proceedings of the National Academy of Sciences, USA90, 8479-8483.
Henle, G. & Henle, W. (1976). EpsteinBarr virus specific IgA serum antibody as an outstanding feature of nasopharyngeal carcinoma.International Journal of Cancer17, 1-7.
Holley-Guthrie, E. A., Quinlivan, E. B., Mar, E. C. & Kenney, S. C. (1990). The EpsteinBarr virus (EBV) BMRF1 promoter for early antigen (EA-D) is regulated by the EBV transactivators, BRLF1 and BZLF1, in a cell-specific manner.Journal of Virology64, 3753-3759.
Hu, H. Z., Li, G. L., Lim, Y. K., Chan, S. H. & Yap, E. H. (1999). Kinetics of interferon-
secretion and its regulatory factors in the early phase of acute graft-versus-host disease.Immunology98, 379-385.[Medline]
Kenney, S., Holley-Guthrie, E., Mar, E. C. & Smith, M. (1989). The EpsteinBarr virus BMLF1 promoter contains an enhancer element that is responsive to the BZLF1 and BRLF1 transactivator.Journal of Virology63, 3878-3883.
Kieff, E. (1996). EpsteinBarr virus and its replication. In Fields Virology, pp. 2342-2396. Edited by B. N. Fields, D. M. Knipe & P. M. Howley. Philadelphia: LippincottRaven.
Liu, D. X., Brierley, I., Tibbles, K. W. & Brown, T. D. K. (1994). A 100-kilodalton polypeptide encoded by open reading frame (OFR) 1b of the coronavirus infectious bronchitis virus is processed by ORF 1a products.Journal of Virology68, 5772-5780.
Liu, C., Sista, N. D. & Pagano, J. S. (1996). Activation of the EpsteinBarr virus DNA polymerase promoter by the BRLF1 immediate-early protein is mediated through USF and E2F.Journal of Virology70, 2545-2555.[Abstract]
Lo, Y. M. D., Chan, L. Y. S., Lo, K. W., Leung, S. F., Zhang, J., Chan, A. T. C., Lee, J. C. K., Hjelm, N. M., Johnson, P. J. & Huang, D. P. (1999). Quantitative analysis of cell-free EpsteinBarr virus DNA in plasma of patients with nasopharyngeal carcinoma.Cancer Research59, 1188-1191.
Martelrenoir, D., Grunewald, V., Touitou, R., Schwaab, G. & Joab, I. (1995). Qualitative-analysis of the expression of Epstein-Barr-Virus lytic genes in nasopharyngeal carcinoma biopsies.Journal of General Virology76, 1401-1408.
Pepperl, S., Benninger-Doring, G., Modrow, S., Wolf, H. & Jilg, W. (1998). Immediate-early transactivator Rta of EpsteinBarr virus (EBV) shows multiple epitopes recognized by EBV-specific cytotoxic T lymphocytes.Journal of Virology72, 8644-8649.
Prang, N. S., Hornef, M. W., Jager, M., Wagner, H. J., Wolf, H. & Schwarzmann, F. M. (1997). Lytic replication of EpsteinBarr virus in the peripheral blood: analysis of viral gene expression in B lymphocytes during infectious mononucleosis and in the normal carrier state.Blood89, 1665-1677.
Raab-Traub, N. & Flynn, K. (1986). The structure of the termini of the EpsteinBarr virus as a marker of clonal cellular proliferation.Cell47, 883-889.[Medline]
Ragoczy, T., Heston, L. & Miller, G. (1998). The EpsteinBarr virus Rta protein activates lytic cycle genes and can disrupt latency in B lymphocytes.Journal of Virology72, 7978-7984.
Rickinson, A. & Kieff, E. (1996). EpsteinBarr virus. In Fields Virology, pp. 2397-2415. Edited by B. N. Fields, D. M. Knipe & P. M. Howley. Philadelphia: LippincottRaven.
Rodriguez, A., Armstrong, M., Dwyer, D. & Flemington, E. (1999). Genetic dissection of cell growth arrest functions mediated by the EpsteinBarr virus lytic gene product, Zta.Journal of Virology73, 9029-9038.
Sixbey, J. W., Nedrud, J. G., Raab-Traub, N., Hanes, R. A. & Pagano, J. S. (1984). EpsteinBarr virus replication in oropharyngeal epithelial cells.New England Journal of Medicine310, 1225-1230.[Abstract]
Swenson, J. J., Mauser, A. E., Kaufmann, W. K. & Kenney, S. C. (1999). The EpsteinBarr virus protein BRLF1 activates S phase entry through E2F1 induction.Journal of Virology73, 6540-6550.
Takada, K. & Ono, Y. (1989). Synchronous and sequential activation of latently infected EpsteinBarr virus genomes.Journal of Virology63, 445-449.
Tang, K. F., Chan, S. H., Loh, K. S., Chong, S. M., Wang, D. Y., Yeoh, K. H. & Hu, H. Z. (1999). Increased production of interferon-
by tumour infiltrating T lymphocytes in nasopharyngeal carcinoma: indicative of an activated status.Cancer Letters140, 93-98.[Medline]
Thorley-Lawson, D. A., Miyashita, E. M. & Khan, G. (1996). EpsteinBarr virus and the B cell: thats all it takes.Trends in Microbiology4, 204-208.[Medline]
Tierney, R. J., Steven, N., Young, L. S. & Rickinson, A. B. (1994). Epstein-Barr-virus latency in blood mononuclear-cells: analysis of viral gene transcription during primary infection and in the carrier state.Journal of Virology68, 7374-7385.
Trumper, P. A., Epstein, M. A., Giovanella, B. C. & Finerty, S. (1977). Isolation of infectious EB virus from the epithelial tumour cells of nasopharyngeal carcinoma.International Journal of Cancer20, 655-662.
Wolf, H., zur Hausen, H. & Becker, V. (1973). EB viral genomes in epithelial nasopharyngeal carcinoma cells.Nature244, 245-247.
Zacny, V. L., Wilson, J. & Pagano, J. S. (1998). The EpsteinBarr virus immediate-early gene product, BRLF1, interacts with the retinoblastoma protein during the viral lytic cycle.Journal of Virology72, 8043-8051.
Zalani, S., Holley-Guthrie, E. & Kenney, S. (1996). EpsteinBarr viral latency is disrupted by the immediate-early BRLF1 protein through a cell-specific mechanism.Proceedings of the National Academy of Sciences, USA93, 9194-9199.
Received 5 June 2000;
accepted 5 July 2000.
This article has been cited by other articles:
![]() |
M. Al-Mozaini, G. Bodelon, C. E. Karstegl, B. Jin, M. Al-Ahdal, and P. J. Farrell Epstein-Barr virus BART gene expression J. Gen. Virol., February 1, 2009; 90(2): 307 - 316. [Abstract] [Full Text] [PDF] |
||||
![]() |
C.-H. Ho, C.-F. Hsu, P.-F. Fong, S.-K. Tai, S.-L. Hsieh, and C.-J. Chen Epstein-Barr Virus Transcription Activator Rta Upregulates Decoy Receptor 3 Expression by Binding to Its Promoter J. Virol., May 1, 2007; 81(9): 4837 - 4847. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. J. C. Stevens, S. A. W. M. Verkuijlen, B. Hariwiyanto, Harijadi, J. Fachiroh, D. K. Paramita, I. B. Tan, S. M. Haryana, and J. M. Middeldorp Diagnostic Value of Measuring Epstein-Barr Virus (EBV) DNA Load and Carcinoma-Specific Viral mRNA in Relation to Anti-EBV Immunoglobulin A (IgA) and IgG Antibody Levels in Blood of Nasopharyngeal Carcinoma Patients from Indonesia J. Clin. Microbiol., July 1, 2005; 43(7): 3066 - 3073. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Germi, P. Morand, K. Brengel-Pesce, S. Fafi-Kremer, O. Genoulaz, C. Ginevra, M. Ballout, G. Bargues, and J.-M. Seigneurin Quantification of gp350/220 Epstein-Barr Virus (EBV) mRNA by Real-Time Reverse Transcription-PCR in EBV-Associated Diseases Clin. Chem., October 1, 2004; 50(10): 1814 - 1817. [Full Text] [PDF] |
||||
![]() |
K.C. A. Chan, J. Zhang, A. T.C. Chan, K. I.K. Lei, S.-F. Leung, L. Y.S. Chan, K. C.K. Chow, and Y.M. D. Lo Molecular Characterization of Circulating EBV DNA in the Plasma of Nasopharyngeal Carcinoma and Lymphoma Patients Cancer Res., May 1, 2003; 63(9): 2028 - 2032. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| INT J SYST EVOL MICROBIOL | MICROBIOLOGY | J GEN VIROL |
| J MED MICROBIOL | ALL SGM JOURNALS | |