J Gen Virol Tips for Better Browsing
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via CrossRef
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Hertzler, S.
Right arrow Articles by Lipton, H. L.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Hertzler, S.
Right arrow Articles by Lipton, H. L.
Agricola
Right arrow Articles by Hertzler, S.
Right arrow Articles by Lipton, H. L.
Journal of General Virology (2000), 81, 2485-2490.
© 2000 Society for General Microbiology


Animal: RNA Viruses

Selection and characterization of a BHK-21 cell line resistant to infection by Theiler’s murine encephalomyelitis virus due to a block in virus attachment and entry

Shannon Hertzler1, Mark Trottier2 and Howard L. Lipton2,3

Integrated Graduate Program, Northwestern University Medical School, Chicago, IL, USA1
Department of Neurology, Evanston Hospital, 2650 Ridge Avenue, Evanston, IL 60201, USA2
Departments of Neurology, Microbiology-Immunology, and Biochemistry, Molecular Biology and Cell Biology, Northwestern University, Evanston/Chicago, IL, USA3

Author for correspondence: Howard Lipton (at Evanston Hospital). Fax +1 847 570 1568. e-mail hllipton{at}merle.acns.nwu.edu


   Abstract
TOP
Abstract
Main text
References
 
A clonal population of BHK-21 cells resistant to infection with the low-neurovirulence BeAn strain of Theiler’s murine encephalomyelitis virus (TMEV) was derived after four cycles of infection and characterized. These cells were resistant to both low- and high-neurovirulence TMEV strains due to a block in virus attachment and entry and not in virus replication, since transfection of these cells with TMEV RNA to bypass the entry step(s) induced virus replication and assembly. The resistance to infection was stable for more than a year, suggesting that it is a heritable property arising from a mutation in the susceptible parent BHK-21 population. This cell line is being used to identify a receptor for TMEV.


   Main text
TOP
Abstract
Main text
References
 
Theiler’s murine encephalomyelitis virus (TMEV), a natural pathogen of mice, is a member of the genus Cardiovirus in the family Picornaviridae, which includes a separate serogroup formed by Mengo virus and encephalomyocarditis virus (EMCV) isolates. TMEVs can be divided into two groups based on neurovirulence following intracerebral inoculation of mice. High neurovirulence TMEV, such as GDVII and FA, cause a rapidly fatal encephalitis, while less virulent strains, such as BeAn and DA, are characterized by at least a 105-fold increase in the mean 50% lethal dose. The low neurovirulence TMEV cause a persistent infection in the central nervous system of susceptible strains of mice that results in immune-mediated as well as cytolytic destruction of oligodendrocytes, and hence, demyelination (Blakemore et al., 1988Down ; Clatch et al., 1986Down ; Gerety et al., 1994Down ; Rodriguez et al., 1983Down ). This animal model has been used as an experimental analogue of multiple sclerosis.

The availability of a cell line lacking a specific virus receptor but otherwise fully susceptible to infection by that virus provides a powerful reagent for the identification of the receptor molecule. In this instance, a clone or clones in a cDNA library expressing the receptor can be detected by its ability to mediate virus entry in the receptor-negative cell line. This is particularly relevant since a TMEV receptor protein has not yet been identified. However, extensive screening of animal and human cell lines has not revealed a TMEV receptor-negative cell line, perhaps because the TMEV receptor is widely expressed in eukaryotic cells. Therefore, we used an alternative strategy to select a TMEV receptor-negative cell line, based on the observation that a small fraction (<0·1%) of BHK-21 cells survive infection with BeAn virus at high m.o.i. The possibility that these cells represent genetic variants that are resistant to virus infection is consistent with several reports of receptor-negative cells derived from cells surviving persistent infections (Borzakian et al., 1992Down ; Kaplan et al., 1989Down ; Kaplan & Racaniello, 1991Down ). To explore the nature of the resistance of BHK-21 cells to TMEV, clonal populations of resistant cells were derived and further characterized.

The strategy for isolation of BeAn virus-resistant BHK-21 cell lines was as follows. After four cycles of infection of BHK-21 cells with BeAn virus at an m.o.i. of 10, and allowing several weeks for growth of surviving cells after each cycle, a subpopulation arose that showed no sign of CPE at 10 days post-infection (p.i.) with BeAn virus. In contrast, BHK-21 cell monolayers infected in parallel displayed extensive CPE at 24 h. Multiple passages of the resistant cells for more than 6 months did not result in crisis, i.e. the appearance of CPE due to virus persistence and the emergence of susceptible cells. The morphology of the cells was identical to that of parental BHK-21 cells except that there were more rounded cells (see below). 35S-Labelled BeAn and GDVII viruses showed <10% binding to the resistant cells at 40 min compared to 40–55% binding to BHK-21 cells (Fig. 1Down). The binding assay revealed <10% BeAn binding in six TMEV-resistant BHK-21 clones isolated by limiting dilution; one clone, designated R26, was chosen for further characterization (Fig. 1Down). The doubling time of R26 cells was the same as that of BHK-21 cells (data not shown), with the morphology identical to that of uncloned resistant cells.



View larger version (13K):
[in this window]
[in a new window]
 
Fig. 1. Binding of BeAn GDVII viruses to BHK-21 cells, uncloned TMEV-resistant BHK-21 cells and the TMEV-resistant R26 clone. [35S]Methionine-labelled BeAn or GDVII virus was incubated with 106 cells/ml at a particle-to-cell ratio of 2x104 at 4 °C as described (Hertzler et al., 2000Down ). After a 40 min binding period, cell-associated radioactivity was determined. Results are expressed as percentage of total radioactivity in the cell pellet. Standard deviation bars are shown for triplicate samples. ND, not done.

 
To determine whether R26 cells supported virus growth without CPE, monolayers of BHK-21 and R26 cells were infected with BeAn and GDVII viruses at an m.o.i. of 100. At 0, 24 and 48 h pi, cells were harvested and the virus titre determined by plaque assay on susceptible BHK-21 cells. GDVII and BeAn virus replication in BHK-21 cells showed the expected growth kinetics, with a 1–3 log increase in virus titres at 24 h, followed by a decline in titres at 48 h (Fig. 2aDown). By contrast, after infection of R26 cells virus titres declined steadily, possibly reflecting a loss of residual input virus seen at the zero time-point due to inactivation of the virus at 33 °C or nonspecific interaction with the cells. To determine whether virus antigen was synthesized in the absence of detectable virus replication, BHK-21 and R26 cells were infected with BeAn virus at an m.o.i. of 100, stained with indirect immunofluorescence for TMEV antigen(s), and analysed by flow cytometry. Virtually all of the BHK-21 cells were strongly positive for virus antigen(s), whereas virus antigen was not detected in R26 cells (Fig. 2bDown). To exclude the presence of a subgenomic BeAn replicon in R26 cells that could conceivably downregulate the virus receptor, real time RT–PCR was used to amplify BeAn P3 sequences (for proteins 3A, 3B and 3C) from total RNA extracted from R26 cells. As shown in Fig. 2Down, the amplification of BeAn sequences from 5 µg of total RNA from R26 cells was no different than that of uninfected BHK-21 cells or the no template control. This is equivalent to a background level of <100 viral copies in 2·5x105 cells.



View larger version (34K):
[in this window]
[in a new window]
 
Fig. 2. (a) TMEV replication in BHK-21 and R26 cells. Cell monolayers in 35 mm multi-well plates were infected with the indicated viruses at an m.o.i. of 100. After a 45 min adsorption period at 24 °C (zero time-point), the virus inoculum was removed, and cells were washed and incubated at 33 °C in complete DMEM medium [Dulbecco’s modified Eagle’s medium supplemented with 2 mM L-glutamine, 100 mg/ml streptomycin, 100 U/ml penicillin, 1% foetal bovine serum and 6·5 mg/ml tryptose phosphate broth (Gibco BRL)]. Combined cells and supernatants were harvested at the indicated times, frozen and thawed twice, and virus titres determined by plaque assay (Rozhon et al., 1983Down ). Standard deviation bars are shown for triplicate samples. BHK-21 cells infected with BeAn ({square}) and GDVII ({blacksquare}); R26 cells infected with BeAn ({circ}) and GDVII ({bullet}). (b) Flow cytometry of cytoplasmic staining for BeAn virus following infection of BHK-21 and R26 cells at an m.o.i. of 100 p.f.u. per cell. Cells were harvested, treated with 0·03% saponin, and stained with rabbit polyclonal anti-TMEV antibodies (1:1000) and FITC-conjugated goat anti-rabbit IgG (1:200). Uninfected (——) and infected (–––) cells. (c) Real-time RT–PCR amplification plots of total RNA extracted from cells or in vitro transcribed BeAn RNA. Plot A is 100 ng total RNA from BeAn virus infected BHK-21 cells, B is 1 ng of in vitro-transcribed BeAn RNA, C is 5 µg total RNA from mock-infected BHK-21 cells, D is 5 µg total RNA from R26 cells, and E is a no template control. RNA was reverse-transcribed using Multiscribe reverse transcriptase (PE Biosystems) in the presence of with 2·5 µM random hexamers in 10 µl. One µl of each cDNA reaction was PCR-amplified using a reverse primer corresponding to the complement of viral nucleotides 5959–5938 (5' CTAGAACCTTCCCGCCTCCTT 3') and a forward primer equivalent to viral nucleotides 5857–5878 (5' TTGAGCTCTCTGAGGGTGAACA 3'). Cycle number is plotted against normalized fluorescence (Rx) resulting from degradation of a Taqman probe (PE Biosystems). The Taqman probe is complementary to viral nucleotides 5899–5918 (5' CGCGCGCCCAAAAGCAAAGC 3'). The 5' end of the probe is labelled with a reporter (FAM) and the 3' end is labelled with a quencher (TAMRA). Intact probes produce no fluorescence, whereas amplification of BeAn cDNA results in increased annealing of the Taqman probe to PCR products. Further amplification results in Taq polymerase-induced exonuclease activity as the enzyme displaces the probe from the template that in turn releases the reporter from the probe resulting in fluorescence. The earlier (in cycles) the fluorescence crosses the threshold limit (horizontal black line), the higher the initial amount of viral RNA in the sample.

 
The resistance of R26 cells to TMEV infection might reflect either specific resistance to TMEV, e.g. due to the lack of expression of the virus receptor, or to an alteration in glycosylation or protein expression, either of which might inhibit infection by other viruses. To examine the specificity of the virus block, R26 cells were infected with the related cardiovirus Mengo virus and the non-related rhabdovirus vesicular stomatitis virus (VSV). As shown in Fig. 3Down, BeAn, GDVII, Mengo virus and VSV produced extensive CPE in BHK-21 cells, whereas R26 cells were resistant to BeAn and GDVII. R26 cells were also resistant to DA virus, another low-neurovirulence TMEV strain, and Vilyuisk virus, a TMEV distantly related to BeAn and GDVII (not shown) (Casals, 1963Down ). R26 monolayers infected with Mengo virus and VSV developed CPE as rapidly as did BHK-21 cells. Thus, resistance of R26 cells appears to be specific for TMEV, but one cannot exclude an alteration of the glycosylation pattern.



View larger version (130K):
[in this window]
[in a new window]
 
Fig. 3. Cytopathology of BHK-21 and R26 cell monolayers after infection at an m.o.i. of ~10 with the TMEV GDVII and BeAn strains, the related cardiovirus Mengo virus, and the unrelated rhabdovirus VSV. Photomicrographs show the morphology of the infected cells at 12 h p.i.

 
To confirm that resistance of the R26 cells was due to a block in attachment and virus entry, BHK-21 and R26 cells were transfected with GDVII virus RNA. At 6, 20 and 40 h, virus titres in cell lysates were determined by plaque assay on BHK-21 cells. CPE appeared and progressed at the same rate in both cell types (not shown). Virus yields peaked at 20 h in the transfected R26 cells and declined thereafter, but continued to rise in BHK-21 cells at 40 h (Fig. 4Down). Since the transfection efficiency of virus RNA is less than 100%, this difference probably reflects the inability of the virus to initiate secondary rounds of infection in R26 cells. The similar rates of CPE development in R26 and BHK-21 cells also suggest the absence of a block later in the virus replication cycle. Thus, when the attachment and entry steps are bypassed, R26 cells fully support TMEV replication.



View larger version (20K):
[in this window]
[in a new window]
 
Fig. 4. Virus replication following transfection of BHK-21 and R26 cells with GDVII RNA. Cell monolayers in 35 mm multi-well plates were transfected with 400 ng of purified GDVII virion RNA using Lipofectin (Gibco BRL) (Hertzler et al., 2000Down ), and cell lysates were harvested at the indicated times. Virus titres were determined by standard plaque assay on BHK-21 cells.

 
The resistance of R26 cells to TMEV infection appears to occur at an entry step, and is probably due to the lack of expression of the receptor or expression of a mutant receptor that does not bind or allow entry of the virus. R26 cells are fully permissive for virus multiplication, i.e. there is no apparent block in virus replication and assembly when the entry step(s) is bypassed by transfection of these cells with virus RNA. The stability of the resistance to infection exhibited by R26 cells for more than 6 months of passages suggests that the resistance is a heritable property arising as a result of a mutation in the genome of cells in the susceptible parent BHK-21 population.

Although the protein receptor for TMEV on host cells has not been identified, evidence from competitive inhibition of virus binding suggests that viruses of both TMEV neurovirulence groups bind the same protein receptor (Fotiadis et al., 1991Down ). The present data support this notion since the resistant R26 cells selected by repeated rounds of infection with BeAn virus were also resistant to infection with GDVII virus. On the other hand, it is well-established that the low- but not the high-neurovirulence TMEV strains also bind sialic acid which may facilitate transfer of the virus to the protein receptor (Fotiadis et al., 1991Down ; Zhou et al., 1997Down , 2000Down ). Thus, the high-neurovirulence TMEV, such as GDVII, appear to bind the protein receptor directly, whereas the low-neurovirulence TMEV bind first to sialic acid and then to the protein receptor.

Several studies have shown that passage of persistently infected cells leads to the co-evolution of the virus and cells, resulting in stable cell lines with a block in virus binding (Borzakian et al., 1992Down ; Kaplan et al., 1989Down ; Kaplan & Racaniello, 1991Down ). Kaplan et al. (1989)Down , for example derived a stable HeLa cell line lacking functional virus receptors after co-transfection with poliovirus RNA and R1, a poliovirus subgenomic RNA deleted of nearly all of the capsid region. Southern blot analysis of genomic DNA of these cells revealed no gross alterations, Northern blotting revealed no expression of poliovirus receptor (PVR) transcripts, and transcription of PVR-specific RNA was reduced in an in vitro nuclear run-on assay (Kaplan & Racaniello, 1991Down ). Treatment of these cells with 5-azacytidine restored susceptibility to poliovirus and the appearance of poliovirus receptors on the cell surface, and a role for methylation in regulating the PVR gene was suggested (Kaplan & Racaniello, 1991Down ). Another study demonstrated a correlation between the maintenance of persistent poliovirus variants in HEp-2 cells and selection of mutant cell populations of various phenotypes (Borzakian et al., 1992Down ). In one phenotype, the PVR was not detected by cytofluorimetry, although the mechanism involved in the loss of the cell surface receptor was not further investigated. Other studies have used either physical or chemical mutagenesis followed by virus infection to select for resistant cell lines lacking virus receptors. For example, Hara et al. (1989)Down derived a mutant murine cell line, designated Had-1, which was deficient in Newcastle disease virus receptors. The genetic defect in Had-1 cells was complemented by UDP-galactose transporter (UGT) cDNA; UGT is necessary for sialylation of the cell surface required for Newcastle disease virus attachment (Ishida et al., 1996Down ; Yoshioka et al., 1997Down ). Jnaoui & Michels (1999)Down recently derived an L cell line partially resistant to entry by GDVII but not DA virus. This pattern of resistance was verified using TMEV recombinants in which the capsid sequences of GDVII and DA were exchanged. These experiments suggest the existence of a co-receptor specific for GDVII virus.

Our study demonstrates the feasibility of selecting cell variants that do not bind TMEV after several passages at high m.o.i. rather than through co-evolution of virus variants during persistent infection or mutagenesis. To our knowledge this is the first example of the selection of a virus receptor-negative cell line by merely passaging the virus in susceptible cells.


   Acknowledgments
 
We thank Pat Kallio for technical assistance, and Anil Kumar for assistance in cloning the TMEV-resistant BHK-21 cell lines. This work was supported by NIH grant NS23249 and The Leiper Trust.


   References
TOP
Abstract
Main text
References
 
Blakemore, W. F., Welsh, C. J., Tonks, P. & Nash, A. A. (1988). Observations on demyelinating lesions induced by Theiler’s virus in CBA mice. Acta Neuropathologica 76, 581-589.[Medline]

Borzakian, S., Couderc, T., Barbier, Y., Attal, G., Pelletier, I. & Colbere-Garapin, F. (1992). Persistent poliovirus infection: establishment and maintenance involve distinct mechanisms. Virology 186, 398-408.[Medline]

Casals, J. (1963). Immunological characterization of Vilyuisk human encephalomyelitis virus. Nature 200, 339-341.[Medline]

Clatch, R. J., Lipton, H. L. & Miller, S. D. (1986). Characterization of Theiler’s murine encephalomyelitis virus (TMEV)-specific delayed-type hypersensitivity responses in TMEV-induced demyelinating disease: correlation with clinical signs. Journal of Immunology 136, 920-926.[Abstract]

Fotiadis, C., Kilpatrick, D. R. & Lipton, H. L. (1991). Comparison of the binding characteristics to BHK-21 cells of viruses representing the two Theiler’s virus neurovirulence groups. Virology 182, 365-370.[Medline]

Gerety, S. J., Rundell, K. M., Dal Canto, M. C. & Miller, S. D. (1994). Class II-restricted T cell responses in Theiler’s murine encephalomyelitis virus-induced demyelinating disease. VI. Potentiation of demyelination with and characterization of an immunopathologic CD4+ T cell line specific for an immunodominant VP2 epitope. Journal of Immunology 152, 919-929.[Abstract]

Hara, T., Hattori, S. & Kawakita, M. (1989). Isolation and characterization of mouse FM3A cell mutants which are devoid of Newcastle disease receptors. Journal of Virology 63, 182-183.[Abstract/Free Full Text]

Hertzler, S., Luo, M. & Lipton, H. L. (2000). Mutation of predicted virion pit residues alters binding of Theiler’s murine encephalomyelitis virus to BHK-21 cells. Journal of Virology 74, 1994-2004.[Abstract/Free Full Text]

Ishida, N., Miura, N., Yoshioka, S. & Kawakita, M. (1996). Molecular cloning and characterization of a novel isoform of the human UDP-galactose transporter, and of related complementary DNAs belonging to the nucleotide sugar transporter gene family. Journal of Biochemistry 120, 1074-1078.[Abstract/Free Full Text]

Jnaoui, K. & Michiels, T. (1999). Analysis of cellular mutants resistant to Theiler’s virus infection: differential infection of L929 cells by persistent and neurovirulent strains. Journal of Virology 73, 7248-7254.[Abstract/Free Full Text]

Kaplan, G. & Racaniello, V. R. (1991). Down regulation of poliovirus receptor RNA in HeLa cells resistant to poliovirus infection. Journal of Virology 65, 1829-1835.[Abstract/Free Full Text]

Kaplan, G., Levy, A. & Racaniello, V. R. (1989). Isolation and characterization of HeLa cell lines blocked at different steps in the poliovirus life cycle. Journal of Virology 63, 43-51.[Abstract/Free Full Text]

Rodriguez, M., Leibowitz, J. L. & Lampert, P. W. (1983). Persistent infection of oligodendrocytes in Theiler’s virus-induced encephalomyelitis. Annals of Neurology 13, 426-433.[Medline]

Rozhon, E. J., Kratochvil, J. D. & Lipton, H. L. (1983). Analysis of genetic variation in Theiler’s virus during persistent infection in the mouse central nervous system. Virology 128, 16-32.[Medline]

Yoshioka, S., Sun-Wada, G.-H., Ishida, N. & Kawakita, M. (1997). Expression of human UDP-galactose transporter in the Golgi membranes of murine Had-1 cells that lack the endogenous transporter. Journal of Biochemistry 122, 691-695.[Abstract/Free Full Text]

Zhou, L., Lin, X., Green, T. J., Lipton, H. L. & Luo, M. (1997). Role of sialyloligosaccharide binding in Theiler’s virus persistence. Journal of Virology 71, 9701-9712.[Abstract]

Zhou, L., Luo, Y., Wu, Y., Tsao, J. & Luo, M. (2000). Sialylation of the host receptor may modulate entry demyelinating persistent Theiler’s virus. Journal of Virology 74, 1477-1485.[Abstract/Free Full Text]

Received 30 March 2000; accepted 29 June 2000.



This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via CrossRef
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Hertzler, S.
Right arrow Articles by Lipton, H. L.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Hertzler, S.
Right arrow Articles by Lipton, H. L.
Agricola
Right arrow Articles by Hertzler, S.
Right arrow Articles by Lipton, H. L.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
INT J SYST EVOL MICROBIOL MICROBIOLOGY J GEN VIROL
J MED MICROBIOL ALL SGM JOURNALS