J Gen Virol Tips for Better Browsing
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via CrossRef
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Iniguez, V.
Right arrow Articles by Aiken, J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Iniguez, V.
Right arrow Articles by Aiken, J.
Agricola
Right arrow Articles by Iniguez, V.
Right arrow Articles by Aiken, J.
Journal of General Virology (2000), 81, 2565-2571.
© 2000 Society for General Microbiology


Other Agents

Strain-specific propagation of PrPSc properties into baculovirus-expressed hamster PrPC

Volga Iniguez1, Debbie McKenzie1, Jean Mirwald1 and Judd Aiken1

Department of Animal Health and Biomedical Sciences, University of Wisconsin-Madison, 1656 Linden Drive, Madison, WI 53706, USA1

Author for correspondence: Judd Aiken. Fax +1 608 262 7420. e-mail aiken{at}ahabs.wisc.edu


   Abstract
TOP
Abstract
Introduction
Methods
Results
Discussion
References
 
The conversion of the cellular isoform of the prion protein (PrPC) to the abnormal disease-associated isoform (PrPSc) has been simulated in cell-free conversion reactions in which PrPSc-enriched preparations induce the conformational transition of PrPC into protease-resistant PrP (PrP-res). We explored the utility of recombinant hamster (Ha)PrPC purified from baculovirus-infected insect cells (bacHaPrPC) as a replacement for mammalian-derived HaPrPC in the conversion reactions. Protease-resistant recombinant HaPrP was generated after incubation of 35S-bacHaPrPC with PrPSc-enriched preparations. Moreover strain-specific PrP-res was also reproduced using insect-cell derived HaPrPC and PrPSc from two different strains of hamster-adapted transmissible mink encephalopathy, designated hyper (HY) and drowsy (DY). Two strain-mediated properties were tested: (i) molecular mass of the protease-digested products and (ii) relative resistance to proteinase K (PK) digestion. Similar to in vivo generation of PrPHY and PrPDY, the converted products selectively reproduced both characteristics, with the DY conversion product being smaller in size and less resistant to PK digestion than the HY product. These data demonstrate that non-mammalian sources of recombinant HaPrP can be converted into PK-resistant form and that strain-mediated properties can be transmitted into the newly formed PrP-res.


   Introduction
TOP
Abstract
Introduction
Methods
Results
Discussion
References
 
The transmissible spongiform encephalopathies (TSEs) are a group of unusual neurodegenerative diseases that include Creutzfeldt–Jakob disease, fatal familial insomnia, Gerstmann–Sträussler–Scheinker syndrome and kuru in humans, as well as scrapie in sheep, transmissible mink encephalopathy (TME) and bovine spongiform encephalopathy. These diseases are characterized by the accumulation of abnormal aggregated isoforms of the prion protein (PrPSc) in affected animals. The crucial pathogenic event in TSE diseases appears to be the conformational transition of the normal cellular PrP (PrPC) into PrPSc. PrPSc forms insoluble aggregates that are protease-resistant and that have higher {beta}-sheet content than PrPC. Although the biochemical basis for the conversion of PrPC to PrPSc remains unknown, direct PrPC–PrPSc interactions appear to be involved (Caughey & Chesebro, 1997Down ). Current models for PrPSc replication include template-assisted conversion (Prusiner, 1991Down ), in which the conformational transition of PrPC is induced by a monomeric PrPSc through a cycle of unfolding and refolding reactions, and nucleation-dependent polymerization (Jarrett & Lansbury, 1993Down ), where infectious PrPSc is an ordered aggregate that acts as a nucleant. PrPC, upon binding to the seed, acquires the conformation of the PrPSc polymer.

According to the conformational hypothesis of strain variation, distinct PrPSc infectious conformers are able to impart their particular properties onto host PrPC (Cohen & Prusiner, 1998Down ). PrPSc conformations are an important component of TSE strain diversity (Parchi et al., 1996Down ; Collinge et al., 1996Down ; Telling et al., 1996Down ; Hill et al., 1997Down ; Rubenstein et al., 1998Down ; Safar et al., 1998Down ; Aucouturier et al., 1999Down ; Kuczius & Groshup, 1999Down ; Bartz et al., 2000Down ), suggesting that different biochemical properties of PrPSc account for the strain phenotypes observed in vivo.

The in vitro assay for the conversion reaction of PrPC to PrPSc, in the presence of exogenous PrPSc (Kocisko et al., 1994Down ), reproduces several biological properties of the in vivo TSE infection such as strain-diversity, species-specificity and PrP polymorphism barrier phenomena (Bessen et al., 1995Down ; Kocisko et al., 1995Down ; Raymond et al., 1997Down ; Bossers et al., 1997Down ). In the present study, recombinant HaPrPC, expressed in a non-mammalian system (baculovirus-infected insect cells), was readily converted to a proteinase K (PK)-resistant form in a cell-free system. These conversion reactions were performed using PrPSc purified from two strains of hamster-adapted TME in combination with 35S-labelled recombinant hamster (Ha)PrPC (35S-bacHaPrPC). In addition to the distinguishing PK cleavage site (Bessen et al., 1995Down ), another strain-specific property of hamster-adapted TME, differential PK resistance, was found to be transmitted to the newly converted 35S-bacHaPrP-res. These studies show that recombinant PrP from a non-mammalian source can be converted into PrP-res forms, whose properties mimic in vivo PrPSc.


   Methods
TOP
Abstract
Introduction
Methods
Results
Discussion
References
 
{blacksquare} Plasmid construction.
A 781 bp DNA fragment containing the entire 254 amino acid hamster PrPC open reading frame was amplified from hamster genomic DNA using the primers Shp1 (-14 to +33: 5' GCAGATCAGCCATCATGGCGAACCTTAGCTACTGGCTGCTGGCACTC 3') and Shp2 (+734 to +767: 5' CCCATCCCCATGAGAAAAATGA 3'). The PCR fragment was ligated into the baculovirus transfer vector pBlueBacIII (Invitrogen) using BglI and PstI unique restriction sites, producing the recombinant vector pBlueBacIII-HaPrPC.

{blacksquare} Cell and virus culture.
Cultures of Spodoptera frugiperda (Sf21 cells) were cotransfected with the pBlueBacIII-HaPrPC construct and linearized baculovirus DNA using the Invitrogen Bac-N-Blue transfection kit. Seventy-four purified plaques of the recombinant virus were used to infect Sf21 cultures and screened for expression of bacHaPrPC by SDS–PAGE and Western immunoblotting using the anti-PrP monoclonal antibody 3F4 (Kascsak et al., 1987Down ). One stable, high expression virus (BacIII-HaPrPC) was selected and used for the remainder of the study.

{blacksquare} Purification of the 35S-bacHaPrPC.
Cells expressing bacHaPrPC were labelled for 3 h with 1 mCi [35S]methionine/[35S]cysteine (Expre35S35S Protein labelling mix, DuPont–NEN) per 25 cm3 flask of 80% confluent cells in methionine- and cysteine-deficient Grace’s insect medium (Sigma). The cells were lysed in ice with LB buffer (0·05 M Tris–HCl, pH 7·4; 0·15 M NaCl; 0·5% Triton X-100; 0·5% sodium deoxycholate) and the radiolabelled proteins were immunoprecipitated in buffer A [0·05 M Tris–HCl, pH 8·2; 0·15 M NaCl; 2% (w/v) N-laurylsarcosine; 0·4% (w/v) lecithin] using the 3F4 antibody and protein A–Sepharose beads (Caughey et al., 1995Down ). The 35S-bacHaPrPC was eluted from the antibody–protein A–Sepharose complex in 0·1 M acetic acid and stored at 4 °C (Kocisko et al., 1996Down ).

{blacksquare} Animal bioassay.
BacHaPrPC was tested for infectivity using an animal bioassay. Syrian Golden hamsters (n=8) were intracerebrally inoculated with 200–250 ng of the recombinant protein in PBS (50 µl). Hamsters were monitored for clinical signs of TSE for 400 days.

{blacksquare} Isolation of PrPSc.
PrPSc-enriched fractions were prepared from the brains of Syrian Golden hamsters (infected with either the hyper or drowsy strain of hamster-adapted TME) as described (Caughey et al., 1995Down ).

{blacksquare} Protein concentration assay.
Protein concentrations were measured with the Bio-Rad protein assay.

{blacksquare} Cell-free conversion reaction.
PrPSc-enriched preparations (1–2 mg/ml) were partially denatured by incubation in 2·5 M guanidine hydrochloride (Gdn-HCl) for 7 h at 37 °C. Aliquots of denatured PrPSc (2–3 µg) and the 35S-bacHaPrPC solution (50 ng) were mixed, diluted to 1 M Gdn-HCl in conversion buffer (1% N-laurylsarcosine; 5 mM cetylpyridinium chloride; 50 mM sodium citrate, pH 6·0), sonicated for 10 s and incubated at 37 °C for 2 days (Caughey et al., 1995Down ). To measure proteinase K resistance to PK, the samples were treated with 25 µg/ml PK at 37 °C for 1 h. A PK inhibitor (Pefabloc; Boehringer Mannheim) and 20 µg of a carrier protein (thyroglobulin) were added and the proteins were precipitated in 4 vols of methanol at -20 °C. The resulting pellet was boiled in sample buffer and fractionated by SDS–PAGE. Conversion of 35S-bacHaPrPC was analysed by the presence and size of the protease-resistant 35S-labelled material (35S-bacHaPrP-res) by autoradiography and quantified using a Phosphoimager (Molecular Dynamics) and ImageQuant software.


   Results
TOP
Abstract
Introduction
Methods
Results
Discussion
References
 
Expression and characterization of HaPrPC in baculovirus-infected cells
HaPrPC was synthesized in insect cells infected with recombinant virus BacIII-HaPrPC. Cell lysates were analysed by Western blot analysis using an anti-PrP monoclonal antibody, 3F4. The recombinant protein exhibited a molecular mass of 26–30 kDa (Fig. 1ADown). The protein was detected as early as 16 h post-infection (p.i.) (Fig. 1BDown) and was largely virion-associated at 3 days p.i. The yield (quantified by Western blot analysis) was approximately 5 mg of HaPrPC per litre of culture medium.



View larger version (20K):
[in this window]
[in a new window]
 
Fig. 1. Heterologous expression of bacHaPrPC in Sf21 insect cells. Western blot analysis using the PrP monoclonal antibody 3F4. (A) Lane 1, Sf21 cell lysate (control); lane 2, lysate of Sf21 cells infected with the BacIII-HaPrPC virus; lane 3, PK-digested lysate of Sf21 cells infected with the BacIII-HaPrPC virus; lane 4, PK-digested PrPHY-enriched preparation. (B) Time-course of bacHaPrPC expression is Sf21 cells following infection with the BacIII-HaPrPC virus. Molecular mass marker is indicated to the right.

 
The baculovirus expression system produced a protease-sensitive-PrPC (PrP-sen) that was completely degraded after PK treatment (25 µg/ml, 1 h, 37 °C; Fig. 1AUp). BacHaPrPC was not infectious as no clinical symptoms of scrapie were observed in hamsters inoculated intracerebrally with the recombinant protein (>1 year).

Conversion of bacHaPrPC to protease-resistant form
To determine whether bacHaPrPC could act as a substrate for conversion to a PK-resistant form in a cell-free system, 35S-bacHaPrPC was incubated for 2 days with partially denatured PrPHY. PK-resistant 35S-bacHaPrPC was observed after PK digestion. The PK digestion products exhibited a 6–7 kDa decrease in molecular mass as expected for PK cleavage of PrPSc (Fig. 2ADown). 35S-bacHaPrPC incubated under the same conditions in the absence of PrPSc-enriched preparations was completely digested by PK (Fig. 2ADown), indicating that the conversion was PrPSc-dependent. The conversion efficiencies of 35S-bacHaPrPC to 35S-bacHaPrP-res were ~25–30%. 35S -PrP-res products were not observed when more extensively denatured PrPSc (6 M Gdn-HCl) was used in the reaction (data not shown). The conversion of bacHaPrPC into protease-resistant forms increased as a function of time (Fig. 2ADown, BDown). Serial dilution of the PrPSc-enriched preparations resulted in the absence of conversion at PrPSc concentrations below 100 µg/ml (Fig. 2CDown), suggesting that a critical PrPSc concentration was required for conversion.



View larger version (36K):
[in this window]
[in a new window]
 
Fig. 2. Effect of incubation time and protein concentration on cell-free conversion efficiency. (A) Cell-free conversion time-course. Recombinant 35S-bacHaPrPC was incubated in the presence of unlabelled partially denatured PrPHY for the indicated times and 35S-bacHaPrP-res was detected by Phosphoimager analysis. The 6–7 kDa shift in size of the 35S-bacHaPrP-res following PK digestion is similar to the size shift observed in brain-derived PK-treated PrPSc. Molecular mass markers are indicated to the right. (B) Percentage 35S-bacHaPrPC conversion as a function of time. (C). Concentration dependence of the conversion reaction. Partially denatured PrPHY-enriched preparations (50–300 µg/ml) were incubated with 35S-bacHaPrPC for 32 h prior to PK digestion. Molecular mass markers are indicated to the right.

 
Strain specificity of the conversion reaction
The hyper and drowsy strains of hamster-adapted TME produce strain-specific abnormal PrP that can be distinguished after PK digestion. PrPHY, upon PK digestion, is 1–2 kDa larger in size than similarly treated PrPDY (Fig. 3ADown) (Bessen & Marsh, 1992aDown , bDown , 1994Down ; Caughey et al., 1998Down ). To determine whether bacHaPrPC was converted in a similar manner, we performed experiments using abnormal PrP from each strain. PrPHY- and PrPDY-enriched preparations drove the conversion of 35S-bacHaPrPC into products with the sizes predicted after PK digestion. The observed 1–2 kDa size difference in the converted products after protease digestion (Fig. 3BDown) was reproducible using four independent PrPHY- and four independent PrPDY-enriched preparations.



View larger version (44K):
[in this window]
[in a new window]
 
Fig. 3. Strain-specific cell-free conversion reactions. (A) Western blot analysis of PK-treated PrPHY and PrPDY. Molecular mass marker is indicated to the right. (B) Phosphoimager analysis of conversion of 35S-bacHaPrPC into strain-specific 35S-bacHaPrP-res. Conversion products driven by PrPHY and PrPDY display differences in the PK-cleavage site. Conversion reactions were performed by incubating 35S-bacHaPrPC with equivalent amounts of PrPHY (lane 1) and PrPDY (lane 2) followed by PK digestion (25 µg/ml, 1 h, 37 °C). Molecular mass marker is indicated to the right.

 
Another distinguishing characteristic of PrPHY and PrPDY is the increased susceptibility of PrPDY to protease digestion (Bessen & Marsh, 1994Down ). PK digestion (100 µg/ml, 37 °C) results in an 80% reduction of in vivo generated PrPDY after 1 h, whereas a similar reduction in PrPHY requires 48 h (Bessen & Marsh, 1994Down ). To determine whether this characteristic was also transferred from PrPSc to radiolabelled bacHaPrPC, a PK-digestion time-course (0·5–2 h, 50 µg/ml, 37 °C) and protease digestion under increasing concentrations of PK (25–100 µg/ml for 1 h at 37 °C) of the strain-specific converted products were performed. In both sets of experiments, the DY-derived 35S-bacHaPrP-res product was less resistant to PK digestion than the HY-derived product (Fig. 4ADown, BDown). To further characterize the differential PK sensitivity, the effect of increasing PK concentrations was measured between the strain conversion products. The percentage of PK-resistant material obtained after PK digestions (25, 50 and 100 µg/ml for 1 h at 37 °C) was quantified and normalized as a percentage to the amount present at 25 µg/ml. As shown in Fig. 4(C)Down, the percentage of the DY-derived 35S-bacHaPrP-res product that remained resistant to 50 and 100 µg/ml PK was significantly lower (P<0·05, Student’s t-test) than the HY-converted material under both conditions. These results suggest that the PK-resistant material generated by the in vitro conversion of 35S-bacHaPrPC into 35S-bacHaPrPHY and 35S-bacHaPrPDY exhibited two defining strain characteristics: (i) differential PK cleavage site and (ii) differing susceptibility to PK digestion.



View larger version (53K):
[in this window]
[in a new window]
 
Fig. 4. Propagation of two distinguishing strain-specific properties into 35S-bacHaPrPC. The conversion products driven by PrPHY and PrPDY display differences in the PK-cleavage site as well as the relative resistance to PK. Molecular mass markers are indicated to the right. (A) Converted products driven by PrPHY and PrPDY. PK-digestion time-course of the conversion products driven by equivalent amounts of PrPHY and PrPDY. Conversion reactions were digested with PK (50 µg/ml) at 37 °C for increasing periods of time (30 min–2 h). The presence of minor converted products can be observed in both reactions. (B) Converted products driven by PrPHY and PrPDY. Conversion reactions driven by equivalent amounts of PrPHY and PrPDY were digested with increasing concentrations of PK (25–100 µg/ml, 1 h, 37 °C). The presence of minor converted products can be observed in both reactions. (C) Percentage of remaining PK resistance of the converted products (data represent an average of three independent reactions ±standard deviations). Conversion reactions were divided into three equal aliquots and digested with 25, 50 or 100 µg/ml PK (1 h, 37 °C). The percentage of remaining PK resistance represents the percentage of 35S-bacHaPrP-res [% conversion=(vol. of protease-resistant radiolabelled material)/(vol. of undigested PrP)x100] obtained after PK digestions (at 50 and 100 µg/ml) normalized to the percentage of 35S-bacHaPrP-res present at 25 µg/ml. Shaded and black bars represent conversion products driven by PrPHY and PrPDY, respectively.

 

   Discussion
TOP
Abstract
Introduction
Methods
Results
Discussion
References
 
The purification difficulties and low yield of cellular PrPC obtained from brain tissue (Turk et al., 1988Down ; Pergami et al., 1996Down ) has led to the use of various recombinant expression systems including E. coli (Weiss et al., 1995Down ; Mehlhorn et al., 1996Down ; Hornemann et al., 1997Down ; Negro et al., 1997Down ), yeast (Weiss et al., 1995Down ), baculovirus (Scott et al., 1988Down ; Weiss et al., 1995Down ) and mammalian cell culture (Chesebro et al., 1993Down ; Priola et al., 1995Down ; Hill et al., 1999Down ) for the production of PrPC. We report here the expression of HaPrPC in baculovirus-infected insect cells. The expressed protein, containing a processed full-length form of HaPrP (23–231), displayed predominantly a molecular mass of 27 kDa corresponding to the unglycosylated HaPrPC form. The presence of partially glycosylated minor isoforms were also observed (28–30 kDa) but in much lower quantities. In contrast, HaPrPC obtained from uninfected brain tissues has a molecular mass of 33–35 kDa (Oesch et al., 1985Down ), as a result of GPI anchor addition and glycosylation. These findings suggest that insect cell lines do not generate the complex post-translational modifications present in mammalian cells. Similar results were obtained using a different baculovirus expression vector (Scott et al., 1988Down ).

The ‘prion hypothesis’ predicts that PrPSc display self-converting activity by interacting with PrPC (Prusiner, 1998Down ). We tested the ability of bacHaPrP to acquire a PrPSc-like conformation in the presence of PrPSc-enriched preparations. Since previous cell-free conversion experiments used recombinant PrPC expressed in mammalian cell lines or PrP immunoprecipitated from brain homogenates, it is possible that other putative factor(s) may copurify with the prion protein and affect these reactions (Westaway et al., 1998Down ). A number of studies have shown that bacterial chaperones (DebBurman et al., 1997Down ), transition metals (McKenzie et al., 1998Down , 1999Down ) and cell lysates (Saborio et al., 1999Down ) can facilitate the in vitro formation of PK-resistant protein. Our data demonstrate that recombinant HaPrPC synthesized in a non-mammalian expression system can be converted in vitro into PK-resistant form upon interaction with PrPSc-enriched preparations. Since 35S-bacHaPrPC and PrPSc molecules constituted the main components of the assay, our data indicate that the formation of PrP-res is the result of the PrPScself ability to propagate. These results also reinforce the specificity of the PrPC–PrPSc interactions and the utility of the cell-free assay, although they do not eliminate the possible requirement of accessory molecules that may be essential and/or influence PrP-res formation. Similar to conversion studies using mammalian HaPrPC (Kocisko et al., 1994Down ; Bessen et al., 1995Down ), post-translational modifications of PrPC do not seem to be required for the conversion reaction. This suggests that, independent of the cell source where the primary polypeptide was expressed, the conformation(s) imposed by the primary HaPrP sequence is sufficient for its ability to act as a substrate in the in vitro assay. Correspondingly, the converting activity of PrPSc was also functional upon interacting with bacHaPrPC. Our data, therefore, represent the first study of functional PrPSc-converting activity of non-mammalian derived HaPrPC.

The acquisition of PK resistance of baculovirus-expressed HaPrPC upon incubation with partially denatured PrPSc, including the specific PK-cleavage site characteristic of PrPSc, is time-dependent and requires a critical PrPSc concentration. This pattern was consistent with other studies (Caughey et al., 1995Down , 1997Down ), indicating that PrPSc aggregates are critical for converting activity and support the nucleated polymerization model for the PrPC-to-PrPSc transition (Harper & Lansbury, 1997Down ). The slight size increase of the converted material observed during the time-course of 35S-bacHaPrP-res formation (Fig. 2AUp) suggests that, in the early stages of the reaction, the converted material adopts a conformation that is less structured and, therefore, more accessible to PK digestion. Efficiency levels for the formation of 35S-bacHaPrP-res (25–30%) are comparable to cell-free conversions using mammalian cell-derived recombinant PrPC (Caughey et al., 1995Down ; Raymond et al., 1997Down ; Bossers et al., 1997Down ). In some conversion reactions, two different bands were observed (Fig. 2CUp), possibly a result of gel running conditions.

To further characterize the specificity of the cell-free conversion assay using baculovirus-expressed PrPC, PrPHY- and PrPDY-enriched preparations were tested for their ability to convert bacHaPrPC into strain-specific products. We characterized the conversion through the analysis of two strain-specific biochemical markers, the molecular size difference after PK digestion and the degree of PK resistance. As a result of conversion of recombinant PrPC driven by either PrPHY or PrPDY, the converted material displays not only the electrophoretic mobility shift characteristic for each strain after PK digestion (Bessen et al., 1995Down ) but also the relative resistance to PK. These data indicate that, upon propagation of the PrPSc-state, insect cell-derived HaPrP can acquire different PrPSc conformations and that strain-specific PrP-res properties can be also reproduced when this source of PrP was used as a conversion substrate. The acquisition of both strain biochemical properties by the 35S-bacHaPrPC and the fact that these properties rely on the PrPSc conformation strongly suggest that in vivo derived PrPSc can specifically propagate its own strain-specific conformation into bacHaPrP. Our results provide additional evidence that the cell-free assay reproduces, in vitro and at the molecular level, strain properties of hamster-adapted TME agent.

In hamster-adapted TME, PrPDY accumulates at a slower rate than PrPHY (McKenzie et al., 1996Down ). These observations could result from strain-specific differences in conformational conversion rates and/or metabolic clearance of the converted products. The efficiency of conversion using our standard PK digestion treatment (25 µg/ml, 1 h, 37 °C) was 25–30% (±7%) in both PrPHY- and PrPDY-derived products. Under these conditions, we do not observe differences in conversion activity between the two strains. There is, however, a remarkable effect on the strain-properties of the converted products when higher concentrations of PK or longer protease-digestion periods are used (Fig. 4Up). As time of digestion and/or PK concentration increase (50–100 µg/ml), the 35S-DY-like converted product exhibits a higher susceptibility to PK (Fig. 4Up A–CUp). These results suggest that the strain-derived products do not have distinguishing converting efficiencies but rather conformational differences that determine their stability and accessibility to PK cleavage. Therefore, our data argue that differential turnover of PrPHY and PrPDY could account for the differences observed in the incubation period upon their transmission into hamsters. In contrast to these observations, Bessen et al. (1995)Down reported different converting efficiencies between the strain-specific converted products. Furthermore, the investigators did not detect differences in PK sensitivity in the converted products. The discrepancies with our observations are perhaps the result of different experimental conditions used in the assay (conversion buffer composition, recombinant HaPrP source, PK concentrations and digestion times). It should be emphasized that, similar to our findings, in vivo PrPHY is more resistant to PK than PrPDY.

Although the infectious nature of the converted products remains to be determined, we have demonstrated that recombinant HaPrP expressed in non-mammalian systems can be converted in vitro into PrP-res in the presence of PrPSc. Moreover, conformational differences between PrPHY and PrPDY that account for their strain-specific biochemical properties were faithfully transferred into insect cell-derived-HaPrP. Altogether these data support the self-propagating activity of PrPSc. It has been proposed that the in vivo PrP conformational transition requires the presence of molecular chaperones (Prusiner, 1998Down ). The use of defined components in the conversion reactions should facilitate the identification of potential cofactors involved in PrPSc formation.


   Acknowledgments
 
We would like to thank Dr Richard Bessen for his helpful suggestions and Dr Jason Bartz for performing the animal bioassays.


   References
TOP
Abstract
Introduction
Methods
Results
Discussion
References
 
Aucouturier, P., Kascsak, R. J., Frangione, B. & Wisniewski, T. (1999). Biochemical and conformational variability of human prion strains in sporadic Creutzfeldt–Jakob disease.Neuroscience Letters 274, 33-36.[Medline]

Bartz, J. C., Bessen, R. A., McKenzie, D., Marsh, R. F. & Aiken, J. M. (2000). Adaptation and selection of prion protein strain conformations following interspecies transmission of transmissible mink encephalopathy.Journal of Virology 74, 5542-5547.[Abstract/Free Full Text]

Bessen, R. A. & Marsh, R. F. (1992a). Biochemical and physical properties of the prion protein from two strains of the transmissible mink encephalopathy agent.Journal of Virology 66, 2096-2101.[Abstract/Free Full Text]

Bessen, R. A. & Marsh, R. F. (1992b). Identification of two biologically distinct strains of transmissible mink encephalopathy in hamsters.Journal of General Virology 73, 329-334.[Abstract/Free Full Text]

Bessen, R. A. & Marsh, R. F. (1994). Distinct PrP properties suggest the molecular basis of strain variation in transmissible mink encephalopathy.Journal of Virology 68, 7859-7868.[Abstract/Free Full Text]

Bessen, R. A., Kocisko, D. A., Raymond, G. J., Nandan, S., Lansbury, P. T. & Caughey, B. (1995). Non-genetic propagation of strain-specific properties of scrapie prion protein.Nature 375, 698-700.[Medline]

Bossers, A., Belt, P. B. G., Raymond, G. J., Caughey, B., De Vries, R. & Smits, M. A. (1997). Scrapie susceptibility-linked polymorphisms modulate the in vitro conversion of sheep prion protein to protease-resistant forms.Proceedings of the National Academy of Sciences, USA 94, 4931-4936.[Abstract/Free Full Text]

Caughey, B. & Chesebro, B. (1997). Prion protein and the transmissible spongiform encephalopathies.Trends in Cell Biology 7, 56-62.

Caughey, B., Kocisko, D. A., Raymond, G. J. & Lansbury, P. T. (1995). Aggregates of scrapie-associated prion protein induce the cell-free conversion of protease-sensitive prion protein to the protease-resistant state.Chemistry & Biology 2, 807-817.[Medline]

Caughey, B., Raymond, G. J., Kocisko, D. A. & Lansbury, P. T. (1997). Scrapie infectivity correlates with converting activity, protease resistance, and aggregation of scrapie-associated prion protein in guanidine denaturation studies.Journal of Virology 71, 4107-4110.[Abstract]

Caughey, B., Raymond, G. J. & Bessen, R. A. (1998). Strain-dependent differences in {beta}-sheet conformations of abnormal prion protein. Journal of Biological Chemistry 273, 32230-32235.[Abstract/Free Full Text]

Chesebro, B., Wehlry, K., Caughey, B., Nishio, J., Ernst, D. & Race, R. (1993). Foreign PrP expression and scrapie infection in tissue culture cell lines.Developments in Biological Standardization 80, 131-140.[Medline]

Cohen, F. E. & Prusiner, S. B. (1998). Pathologic conformations of prion proteins.Annual Review of Biochemistry 67, 793-819.[Medline]

Collinge, J., Sidle, K. C., Meads, J., Ironside, J. & Hill, A. F. (1996). Molecular analysis of prion strain variation and the aetiology of ‘new variant’ CJD.Nature 383, 685-690.[Medline]

DebBurman, S. K., Raymond, G. J., Caughey, B. & Lindquist, S. (1997). Chaperone-supervised conversion of prion protein to its protease-resistant form.Proceedings of the National Academy of Sciences, USA 94, 13938-13943.[Abstract/Free Full Text]

Harper, J. O. & Lansbury, P. T. (1997). Models of amyloid seeding in Alzheimer’s disease and scrapie: mechanistic truths and physiological consequences of the time-dependent solubility of amyloid proteins.Annual Review of Biochemistry 66, 385-407.[Medline]

Hill, A. F., Desbruslais, M., Joiner, S., Sidle, K. C. L., Gowland, I., Collinge, J., Doey, L. & Lantos, P. (1997). The same prion strain causes nvCJD and BSE.Nature 389, 448-450.[Medline]

Hill, A. F., Antoniou, M. & Collinge, J. (1999). Protease-resistant prion protein produced in vitro lacks detectable infectivity.Journal of General Virology 80, 11-14.[Abstract]

Hornemann, S., Korth, C., Oesch, B., Riek, R., Wider, G., Wuthrich, K. & Glockshuber, R. (1997). Recombinant full length murine prion protein, mPrP (23–231): purification and spectroscopic characterization.FEBS Letters 413, 277-281.[Medline]

Jarrett, J. T. & Lansbury, P. T. (1993). Seeding ‘‘one dimensional crystallization' of amyloid: a pathogenic mechanism in Alzheimer’s disease and scrapie?Cell 73, 1055-1058.[Medline]

Kascsak, R. J., Rubenstein, R., Tonna-DeMasi, R., Wisniewski, H. M. & Diringer, H. (1987). Mouse polyclonal and monoclonal antibody to scrapie-associated fibril proteins.Journal of Virology 61, 3688-3693.[Abstract/Free Full Text]

Kocisko, D. A., Come, J. H., Priola, S. A., Chesebro, B., Raymond, G. J., Lansbury, P. T.Jr & Caughey, B. (1994). Cell-free formation of protease-resistant prion protein.Nature 370, 471-474.[Medline]

Kocisko, D. A., Priola, S. A., Raymond, G. J., Chesebro, B., Lansbury, P. T. & Caughey, B. (1995). Species specificity in the cell-free conversion of prion protein to protease-resistant forms: a model for the scrapie species barrier.Proceedings of the National Academy of Sciences, USA 92, 3923-3927.[Abstract/Free Full Text]

Kocisko, D. A., Lansbury, P. T. & Caughey, B. (1996). Partial unfolding and refolding of scrapie-associated prion protein: evidence for a critical 16-kDa C-terminal domain.Biochemistry 35, 13434-13442.[Medline]

Kuczius, T. & Groschup, M. H. (1999). Differences in proteinase K resistance and neuronal deposition of abnormal prion proteins characterize bovine spongiform encephalopathy (BSE) and scrapie strains.Molecular Medicine 5, 406-418.[Medline]

McKenzie, D., Bartz, J. & Marsh, R. F. (1996). Transmissible mink encephalopathy.Seminars in Virology 7, 201-206.

McKenzie, D., Bartz, J., Mirwald, J., Olander, D., Marsh, R. & Aiken, J. (1998). Reversibility of scrapie inactivation is enhanced by copper.Journal of Biological Chemistry 273, 25545-25547.[Abstract/Free Full Text]

McKenzie, D., Bartz, J., Mirwald, J., Iniguez, V. & Aiken, J. (1999). Copper and zinc enhance the renaturation of PrPSc and restore infectivity. In New Aspects of Trace Element Research, pp. 241-244. Edited by M. Abdulla, M. Bost, S. Gamon, P. Arnaud & G. Chazot. London: Smith Gordon.

Mehlhorn, I., Groth, D., Stockel, J., Moffat, B., Reilly, D., Yansura, D., Willet, W. S., Baldwin, M., Fletterick, R., Cohen, F. E., Vandlen, R., Henner, D. & Prusiner, S. B. (1996). High-level expression and characterization of a purified 142-residue polypeptide of the prion protein.Biochemistry 35, 5528-5537.[Medline]

Negro, A., De Filippis, V., Skaper, S. D., James, P. & Sorgato, M. C. (1997). The complete mature bovine prion protein highly expressed in Escherichia coli: biochemical and structural studies.FEBS Letters 412, 359-364.[Medline]

Oesch, B., Westaway, D., Wälchli, M., McKinley, M. P., Kent, S. B. H., Aebersold, R., Barry, R. A., Tempst, P., Teplow, D. B., Hood, L. E., Prusiner, S. B. & Weissmann, C. (1985). A cellular gene encodes scrapie PrP 27–30 protein.Cell 40, 735-746.[Medline]

Parchi, P., Castellani, S., Capellari, S., Ghetti, B., Young, K., Chen, S. G., Farlow, M., Dickson, D. W., Sima, A. A., Trojanowski, J. Q., Petersen, R. B. & Gambetti, P. (1996). Molecular basis of phenotypic variability in sporadic Creutzfeldt–Jakob disease.Annals of Neurology 39, 767-778.[Medline]

Pergami, P., Jaffe, H. & Safar, J. (1996). Semipreparative chromatographic method to purify the normal cellular isoform of the prion protein in nondenatured form.Annals of Biochemistry 236, 63-73.

Priola, S. A., Caughey, B., Wehrly, K. & Chesebro, B. (1995). A 60-kDa prion protein (PrP) with properties of both the normal and scrapie-associated forms of PrP.Journal of Biological Chemistry 270, 3299-3305.[Abstract/Free Full Text]

Prusiner, S. B. (1991). Molecular biology of prion diseases.Science 252, 1515-1522.[Abstract/Free Full Text]

Prusiner, S. B. (1998). Prions.Proceedings of the National Academy of Sciences, USA 95, 13363-13383.[Abstract/Free Full Text]

Raymond, G. J., Hope, J., Kocisko, D. A., Priola, S. A., Raymond, L. D., Bossers, A., Ironside, J., Will, R. G., Cheng, S. G., Petersen, R. B., Gambetti, P., Rubenstein, R., Smits, M. A., Lansbury, P. T. & Caughey, B. (1997). Molecular assessment of the potential transmissibilities of BSE and scrapie to humans.Nature 388, 285-288.[Medline]

Rubenstein, R., Gray, P. C., Wehlburg, C. M., Wagner, J. S. & Tisone, G. C. (1998). Detection and discrimination of PrPSc by multi-spectral ultraviolet fluorescence.Biochemical and Biophysical Research Communications 246, 100-106.[Medline]

Saborio, G. P., Soto, C., Kascsak, R. J., Levy, E., Kascsak, R., Harris, D. A. & Frangione, B. (1999). Cell-lysate conversion of prion protein into its protease-resistant isoform suggests the participation of a cellular chaperone.Biochemical and Biophysical Research Communications 250, 187-193.

Safar, J., Wille, H., Itri, V., Groth, D., Serban, H., Torchia, M., Cohen, F. E. & Prusiner, S. B. (1998). Eight prion strains have PrPSc molecules with different conformations.Nature Medicine 10, 1157-1165.

Scott, M. R., Buttler, D. A., Bredesen, D. E., Wälchli, M., Hsiao, K. K. & Prusiner, S. B. (1988). Prion protein gene expression in cultured cells.Protein Engineering 2, 69-76.[Abstract/Free Full Text]

Telling, G. C., Parchi, P., DeArmond, S. J., Cortelli, P., Montagna, P., Gabizon, R., Mastrianni, J., Lugaresi, E., Gambetti, P. & Prusiner, S. B. (1996). Evidence for the conformation of the pathologic isoform of the prion protein enciphering and propagating prion diversity.Science 274, 2079-2082.[Abstract/Free Full Text]

Turk, E., Teplow, D. B., Hood, L. E. & Prusiner, S. B. (1988). Purification and properties of the cellular and scrapie hamster prion proteins.European Journal of Biochemistry 176, 21-31.[Medline]

Weiss, S., Famulok, M., Edenhofer, F., Wang, Y. H., Jones, I. M., Groshup, M. & Winnacker, E. L. (1995). Overexpression of active Syrian golden hamster prion protein PrPC as a glutathione S-transferase fusion in heterologous systems.Journal of Virology 69, 4776-4783.[Abstract]

Westaway, D., Telling, G. C. & Priola, S. (1998). Prions.Proceedings of the National Academy of Sciences, USA 95, 11030-11031.[Free Full Text]

Received 5 June 2000; accepted 30 June 2000.


This article has been cited by other articles:


Home page
J. Gen. Virol.Home page
L. Kirby, W. Goldmann, F. Houston, A. C. Gill, and J. C. Manson
A novel, resistance-linked ovine PrP variant and its equivalent mouse variant modulate the in vitro cell-free conversion of rPrP to PrPres
J. Gen. Virol., December 1, 2006; 87(12): 3747 - 3751.
[Abstract] [Full Text] [PDF]


Home page
J. Gen. Virol.Home page
C. Johnson, J. Johnson, J. P. Vanderloo, D. Keane, J. M. Aiken, and D. McKenzie
Prion protein polymorphisms in white-tailed deer influence susceptibility to chronic wasting disease
J. Gen. Virol., July 1, 2006; 87(7): 2109 - 2114.
[Abstract] [Full Text] [PDF]


Home page
J. Gen. Virol.Home page
L. Kirby, C. R. Birkett, H. Rudyk, I. H. Gilbert, and J. Hope
In vitro cell-free conversion of bacterial recombinant PrP to PrPres as a model for conversion
J. Gen. Virol., April 1, 2003; 84(4): 1013 - 1020.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via CrossRef
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Iniguez, V.
Right arrow Articles by Aiken, J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Iniguez, V.
Right arrow Articles by Aiken, J.
Agricola
Right arrow Articles by Iniguez, V.
Right arrow Articles by Aiken, J.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
INT J SYST EVOL MICROBIOL MICROBIOLOGY J GEN VIROL
J MED MICROBIOL ALL SGM JOURNALS