J Gen Virol Email Content Delivery
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via CrossRef
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Rebel, J. M. J.
Right arrow Articles by Moormann, R. J. M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Rebel, J. M. J.
Right arrow Articles by Moormann, R. J. M.
Agricola
Right arrow Articles by Rebel, J. M. J.
Right arrow Articles by Moormann, R. J. M.
Journal of General Virology (2000), 81, 2763-2769.
© 2000 Society for General Microbiology


Animal: RNA Viruses

Construction of a full-length infectious cDNA clone of swine vesicular disease virus strain NET/1/92 and analysis of new antigenic variants derived from it

J. M. J. Rebel1, C. H. Leendertse1, A. Dekker1, F. van Poelwijk1 and R. J. M. Moormann1

Institute of Animal Science and Health (ID-Lelystad), Department of Mammalian Virology, Houtribweg 39, PO Box 65, 8200 AB Lelystad, The Netherlands1

Author for correspondence: J. Rebel. Fax +31 320 238668. e-mail J.M.J.Rebel{at}id.wag-ur.nl


   Abstract
TOP
Abstract
Introduction
Methods
Results
Discussion
References
 
The Dutch swine vesicular disease virus (SVDV) isolate NET/1/92 was one of the first isolates belonging to a new SVDV antigenic group. This strain was completely sequenced and was shown to have 93% similarity with the UKG/27/72 isolate. To enable antigenicity, replication, maturation and pathogenicity studies of NET/1/92, an infectious full-length cDNA clone, designated pSVD146, was prepared. The in vitro and in vivo biological properties of the virus derived from pSVD146 were studied by analysing antigenicity, plaque morphology, growth curves and virulence in pigs. The epitopes of newly prepared monoclonal antibodies were roughly mapped by fusion-PCR. Fine mapping of epitopes at the amino acid level was achieved by introducing single amino acid mutations in pSVD146. Two new amino acids important in epitope formation were located in VP1; one was mapped in the C-terminal end and the second is thought to be located in the H–I loop. Growth curve and plaque sizes in vitro were similar between virus derived from pSVD146 and the parent wild-type virus. In virulence studies in pigs, the lesions score, neutralization titres and the seroconversion rates were comparable between virus derived from pSVD146 and the parent strain. Since virus derived from pSVD146 had the same biological properties as the parent strain NET/1/92, the full-length infectious cDNA clone pSVD146 will be very useful in studies of the antigenicity, virulence, pathogenesis, maturation and replication of SVDV.


   Introduction
TOP
Abstract
Introduction
Methods
Results
Discussion
References
 
Swine vesicular disease virus (SVDV) is the causative agent of a highly contagious disease in pigs that causes vesicular lesions in the mouth and on the feet. Symptoms are clinically indistinguishable from those caused by foot and mouth disease virus and swine vesicular disease is therefore classified as a list A disease by the Office International des Epizooties (OIE). SVDV belongs to the family Picornaviridae, genus Enterovirus. The virus is non-enveloped and has a 30 nm capsid of icosahedral symmetry made up of 60 copies of four proteins, VP1 to VP4 (Murphy et al.,1995Down ; Rueckert, 1996Down ), which encase the RNA genome. The genome of SVDV is a positive single-stranded RNA molecule of approximately 7400 nucleotides in length (Inoue et al., 1989Down ; Seechurn et al., 1990Down ) that codes for a single polyprotein. This polyprotein shows similarity to the human coxsackievirus B5 and poliovirus polyproteins (Rueckert, 1996Down ).

The first outbreak of SVDV occurred in Italy in 1966 (Nardelli et al., 1968Down ). Since then, several more outbreaks of SVDV have occurred in Europe (Brocchi et al., 1997Down ); the most recent ones occurred in Italy in 2000 (OIE, 2000Down ). In 1992 there were six outbreaks of SVDV in the Netherlands and isolated in the first of these outbreaks was SVDV strain NET/1/92. To enable manipulation of the SVDV strain NET/1/92 genome for further investigation, we sequenced and constructed a full-length infectious cDNA copy of the RNA genome. Since the first construction of an infectious cDNA clone for poliovirus (Racaniello & Baltimore, 1981Down ), many cDNA copies from RNA genomes of members of the Picornaviridae have been constructed. These cDNA copies have been used for the development of recombinant vaccines and to study virulence and pathogenicity. Full-length cDNA copies were constructed from two Japanese SVDV strains (J1'73 and H/3'76) (Inoue et al., 1990Down ; Kanno et al., 1998Down ). These two SVDV cDNA copies were used to study virulence differences between the two strains (Kanno et al., 1999Down ). Until now, no full-length cDNA copies of the European SVDV isolate were available. Recently isolated SVDV strains, like NET/1/92, differ significantly at the genetic and antigenic level from the Japanese strains, which were isolated in the 1970s (Brocchi et al., 1997Down ; Zhang et al., 1999Down ). Based on the monoclonal antibody (MAb) reaction pattern, NET/1/92 was classified into group IV together with all other SVDV strains isolated in Europe from 1992 to 1995 (Dekker et al., 2000Down ).

Identifying epitopes is essential for studying virus pathogenesis, epidemiology, virus–host interactions, and for the design of effective vaccines. Using MAb-resistant mutants Kanno et al. (1995Down ) and Nijhar et al. (1999Down ) showed that three major epitopes could be identified in SVDV similar to the situation seen with poliovirus. However, with MAb-resistant mutants, only epitopes of neutralizing MAbs can be mapped. We therefore tried a different approach to identify epitopes of neutralizing and non-neutralizing MAbs. Using the chimeric SVDV constructed using a fusion-PCR technique we were able to roughly map the epitope regions of eight MAbs, neutralizing and non-neutralizing, which discriminate between the two SVDV strains ITL/1/66 and NET/1/92 (Dekker et al., 2000Down ). From the information provided by these roughly mapped epitope regions, we predicted specific amino acids involved in epitope formation. The sites of interest were mutated in the infectious cDNA clone of NET/1/92 produced in this study. We constructed four antigenic variants of the SVDV NET/1/92 strain. Amino acids important for two different epitopes, which have not been described before, were found. The other epitopes found in this study have been previously described for either SVDV or poliovirus. We show the usefulness of this infectious cDNA clone for the fine mapping of the epitopes described by Dekker et al. (2000Down ).

Furthermore, we show that the virus derived from the infectious cDNA clone mimics the parent strain regarding growth in cell culture and virulence in pigs, demonstrating that this clone is an excellent tool for further studies of the antigenicity, virulence and pathogenesis of SVDV.


   Methods
TOP
Abstract
Introduction
Methods
Results
Discussion
References
 
{blacksquare} Viruses and cells.
SVDV strain NET/1/92 was isolated in Lelystad and strain ITL/1/66 was obtained from E. Brocchi (Brescia, Italy). The other SVDV strains used for this study were obtained from the European Reference Laboratory for SVDV (Pirbright, UK). All viruses were grown on IBRS-2 cells using Eagle’s medium supplemented with 5% foetal bovine serum and antibiotics. When the cells displayed 90% cytopathic effect, the cell cultures were frozen and thawed. Before use, the virus suspension was clarified by centrifugation at 6000 g for 10 min. SK6T7 cells expressing the T7 polymerase (Van Gennip et al., 1999Down ) were used for transfection of DNA.

{blacksquare} Sequencing of NET/1/92.
SVDV strain NET/1/92 was isolated from vesicular lesions and subsequently grown on secondary porcine kidney cells (PK2). From this virus stock, RNA was isolated (Sambrook et al., 1989Down ). RT–PCR was performed and PCR products were amplified and cloned into a pGEM-T vector (Promega). The cloned products were sequenced using a double-stranded DNA sequencing method and the ABI PRISM BigDye terminator cycle sequencing ready reaction kit (Perkin Elmer). The primer designs were based on the published sequence of SVDV (Inoue et al., 1989Down ; Seechurn et al., 1990Down ). Data collection was carried out with the ABI PRISM 310 Genetic Analyser (Perkin Elmer). The complete genome was sequenced from two or more individually isolated NET/1/92 RNA genomes, in two directions. To obtain the sequence of the 5' end of NET/1/92, a 5' RACE was performed as described previously (Meulenberg et al., 1998Down ).

{blacksquare} Construction of a full-length cDNA copy.
On the isolated RNA of NET/1/92, an RT–PCR reaction was performed with a primer, pr49, complementary to the poly(A) tail. This 3' primer, pr49, contained a stretch of 40 T nucleotides and additional restriction sites; 5' AGATCTGCAGAAGCTTCGATCG(T)40 3'. Amplification was performed using the same 3' primer and a primer, pr45, at the 5' end. The primer pr45 contained a T7 promoter (underlined) and some additional restriction sites; 5' CCCCTGCAGATCTAATACGACTCACTATAGTTAAAACAGCTTGTGGGTTGTT 3'. The PCR reaction resulted in a cDNA copy of the complete NET/1/92 genome. This full-length PCR product was digested with EcoRI/BglII or EcoRI/PstI as depicted in Fig. 1Down and cloned into pOK 12 (Viera & Messing, 1991Down ) in two steps. From this pOK 12 the EcoRV/FspI fragment containing the T7 promoter was then deleted. The infectious full-length cDNA clone obtained was named pSVD146.



View larger version (7K):
[in this window]
[in a new window]
 
Fig. 1. Construction of the full-length infectious cDNA clone pSVD146. PCR fragments are indicated by the black bars. The restriction sites used are also indicated. The full-length cDNA copy was inserted into the BglII/PstI site of the pOK 12 plasmid.

 
{blacksquare} Mutagenesis.
Site-directed mutagenesis was performed in the region of interest (see Table 1Down for primers) using a fusion-PCR. Individual parts were amplified with the reverse or the forward mutated primer. The two mutated PCR products were hybridized together and amplified with two primers outside the mutation. The mutated fragments were then digested with NgoMIV and AlfII and were reintroduced into pSVD146. After sequence analysis the mutated clones were transfected into SK6T7 cells to obtain mutated virus.


View this table:
[in this window]
[in a new window]
 
Table 1. Sequences of the primers used for mutagenesis and construction of a full-length cDNA copy of the SVDV genome

 
{blacksquare} Transfection.
Transfection of 100 ng linearized DNA (PvuI-digested) was performed in SK6T7 cells with lipofectin according the manufacturer's protocol (Gibco BRL). To increase virus titres, the supernatant of transfected SK6T7 was passaged onto IBRS-2 cells 48 h after transfection. Monolayers of SK6T7 cells were used to check the virus production with an immunoperoxidase monolayer assay (Wensvoort et al., 1986Down ) in which swine anti-SVDV hyper-immune serum (Dekker et al., 1995Down ) was used to detect virus.

{blacksquare} MAb screening ELISA.
ELISA plates (Costar) were coated overnight at 4 °C with a predetermined dilution of rabbit antibodies directed against SVDV in coating buffer (sodium carbonate buffer, pH 9·6). After washing with tap water containing 0·05% Tween 80, antigen (virus) was added and incubated for 1 h at 37 °C. MAbs conjugated with horseradish peroxidase were added after washing and the plates were then incubated for 1 h at 37 °C. The MAbs used have previously been described by Dekker et al. (2000Down ). The plates were then washed and 100 µl of chromogen substrate (TMB/H2O2) was added. After 15 min the reaction was stopped by the addition of 100 µl of 1 M H2SO4. The plates were read in a spectrophotometer (Titretek) at a wavelength of 450 nm. In each test, a conjugated hyper-immune serum (HIS SVD) was included. This serum was raised against SVDV isolate UKG/27/7 and reacts with all SVDV isolates studied to date.

{blacksquare} Growth curves.
Single-step growth curves of virus SVD146 obtained from the pSVD146 construct and SVDV strain NET/1/92 were performed at an m.o.i. of approximately 5 on both IBRS-2 and PK2 cells. The cultures were frozen at different time-points and the virus titres were determined, after thawing, by a standard plaque assay on IBRS-2 cells.

{blacksquare} Virulence.
Two groups of five 12-week-old pigs were housed in separate stables in a high containment unit. All pigs were negative for antibodies to SVDV prior to infection. The virus SVD146, obtained from pSVD146, and the parent virus, strain NET/1/92, were plaque-purified on PK2 cells and virus with a titre of 105 TCID50/ml was used to infect pigs. Approximately 0·1 ml virus was inoculated into five separate injection sites of the bulb of the left outside heel. On days 0, 2, 5, 7, 12, 16 and 21 after infection, the pigs were anaesthetized and the lesions on the feet and in the mouth were scored (Burrows et al., 1974Down ). Serum and faecal samples were taken on each day that the pigs were examined for lesions. Sera were examined for neutralizing antibodies as described by Dekker et al. (1995Down ).


   Results
TOP
Abstract
Introduction
Methods
Results
Discussion
References
 
Sequence of NET/1/92
The sequence of NET/1/92 is the consensus sequence of at least two independently sequenced RNA genomes isolated from the plaque-purified virus. The sequence shares 93% identity with UKG/27/72 (used as the reference strain internationally). The nucleotide sequence of NET/1/92 has been submitted to GenBank (accession no. AF268065).

Construction of the full-length cDNA clone pSVD146 and production of derived virus
Digested PCR products representing the complete NET/1/92 genome were successfully ligated and inserted into the pOK 12 vector according to the scheme depicted in Fig. 1Up. The 5' end of this product contains the T7 promoter sequence, which was introduced into the terminal 5' primer (Table 1Up). This full-length cDNA construct was named pSVD146. The orientation and composition of the inserts were confirmed by restriction analysis and the complete clone was sequenced in both directions. Three amino acid (aa) substitutions compared to the parent strain sequence were found. At aa 449 in VP3, a methionine was changed to a threonine; at aa 1511 in 3A, a leucine was changed to a phenylalanine; and at aa 1776 in 3D, an aspartic acid was changed to asparagine.

Virus derived from pSVD146 was obtained by transfecting PvuI-linearized pSVD146 into SK6T7 cells. In this cell line, plasmid DNA is transcribed by the stably expressed T7 polymerase. To increase virus titres, the supernatant of the transfected cells was passaged on IBRS-2 cells. The genome from the progeny virus, SVD146, was sequenced around the three amino acid substitutions that were different from the NET/1/92 parent strain. These substitutions appeared to be stable.

Epitope mapping and construction of antigenic variants of NET/1/92
The epitopes of MAbs that reacted specifically with strain ITL/1/66 but not with NET/1/92 were roughly mapped as described by Dekker et al. (2000Down ). These results, obtained using a fusion-PCR technique, showed that MAbs 143·9 and 143·10 have their epitopes in the region between aa 5 and aa 87 of VP1, whereas the other MAbs used have their epitopes in the region between aa 199 and aa 283 of VP1. The fusion-PCR results, taken together with the reaction pattern of these MAbs with SVDV strains SPA/1/93, UKG/27/72, ITL/1/66 and NET/1/92 (Table 2Down) and the sequence data (Fig. 2Down), resulted in a few amino acids that could be a candidates for epitope formation. The amino acids possibly involved in epitope formation were aa 225 or aa 269 of VP1 for MAb 145·2. For MAb 145·12, aa 210, aa 258 or aa 266 of VP1 were implicated and for the MAbs 143·9 and 143·10, aa 87 of VP1 was implicated. In these experiments, the epitope for MAb 5B7, from which an essential amino acid was previously localized at aa 163 in VP2 (Nijhar et al., 1999Down ), was used as a positive control.


View this table:
[in this window]
[in a new window]
 
Table 2. MAb reaction patterns against different SVDV strains and mutated viruses

 


View larger version (77K):
[in this window]
[in a new window]
 
Fig. 2. The consensus sequence of VP1 of NET/1/92 (matching the sequence of SVD146) compared to the sequences of SVDV strains SPA/1/93, ITL/1/66 and UKG/27/72 in the regions where epitopes were expected. Bold and underlined amino acids differ from the NET/1/92 consensus sequence. The predicted region (––) from fusion-PCR results in which MAbs 143·9 and 143·10 react is shown. The predicted region (==) from fusion-PCR results in which MAbs 145·2 and 145·12 react is shown.

 
The predicted amino acids were mutated in pSVD146 in such a way that they matched the relevant amino acids in the ITL/1/66 sequence. For these specific mutations, the primers used are described in Table 1Up. The viruses obtained after transfection of the mutated pSVD146 were tested by ELISA to investigate the reaction pattern of the MAbs. HIS SVD was used as a positive control to check for the presence of antigen.

As expected, the reaction of MAb 5B7 with SVD146 (mutated at aa 163 of VP2) became negative in the ELISA after the change of glutamic acid (pSVD146) to glutamine. Subsequently, all the above-described candidate amino acids were mutated in pSVD146 and the mutated viruses obtained were analysed by ELISA in order to see differences in MAb reaction patterns (Table 2Up). Two different amino acids involved in the epitope for MAb 145·2 were predicted. The amino acid at aa 225 of VP1 was changed from a glycine (pSVD146) to an asparagine or aa 269 of VP1 was changed from a serine (pSVD146) to a glycine. The change of aa 225 of VP1 showed a positive response in the ELISA; the other mutation did not change the reaction pattern of MAb 145·2 (Table 2Up). For MAbs 143·9 and 143·10, only aa 87 of VP1 was predicted to be important in epitope formation. Therefore, this amino acid was changed from a glycine (pSVD146) to an aspartic acid. This resulted in MAb recognition of the mutant virus. Three possible amino acid candidates (aa 258, aa 266 or aa 269 of VP1) were proposed for MAb 145·12. Neither of the mutated viruses resulted in a strong specific reaction with this MAb. The mutation of either aa 258 (absorbance value of 0·23) or aa 266 (absorbance value of 0·53) of VP1 in pSFV146 resulted in an intermediate response in the ELISA. Therefore a double mutation was performed at locations aa 258 and aa 266 of VP1. This resulted in a strong reaction in the ELISA of MAb 145·12 (absorbance value of 1·4). Amino acid substitutions and MAb reaction patterns are shown in Table 2Up.

Characteristics of SVD146 virus
Single-step growth curves of SVD146 on IBRS-2 and PK2 cells were performed and the results showed that the virus had the same growth properties as the parent strain NET/1/92 (Fig. 3Down). The plaque sizes of SVD146 and NET/1/92 were also similar (data not shown). Furthermore, the reaction pattern of a panel of MAbs raised against NET/1/92 was the same for both SVD146 and NET/1/92 (data not shown).



View larger version (12K):
[in this window]
[in a new window]
 
Fig. 3. Single-step growth curves of SVD146 and NET/1/92 on IBRS-2 cells.

 
To study whether SVD146 was as virulent as NET/1/92, an in vivo study was performed. Both viruses were inoculated into the bulb of the heel of five 12-week-old pigs using a titre of 105 TCID50/ml. In both groups, the first lesions were observed 2 days after infection. In the group infected with NET/1/92, four out of five pigs developed lesions; in the group infected with SVD146, all pigs developed lesions. The lesion score during the experiment between both strains was comparable. In all pigs, seroconversion was observed by day 5 and lasted until the end of the experiment. The neutralization titre of both groups reached the highest level 12 days after infection (Table 3Down). Virus was isolated from faecal samples 5 days after infection from all pigs and the titres between the groups were comparable. Viraemia was detected in both groups. The results are summarized in Table 3Down.


View this table:
[in this window]
[in a new window]
 
Table 3. Experimental infection of pigs with SVD146 or NET/1/92

 

   Discussion
TOP
Abstract
Introduction
Methods
Results
Discussion
References
 
From the Dutch SVDV isolate NET/1/92, a full-length infectious cDNA clone, pSVD146, was successfully constructed. After transfection of the DNA into SK6T7 cells, infectious virus SVD146 was obtained. The in vitro characteristics, antigenicity, growth curve and plaques of the virus SVD146 were identical to the parent NET/1/92 virus. In vivo experiments also showed that the clinical disease characteristics between SVD146 and the parent strain were the same. Therefore, we concluded that pSVD146 is an accurate cDNA copy of the NET/1/92 strain genome. The three amino acid differences of the SVD146 genome compared to the NET/1/92 genome were stable and did not influence the growth and virulence properties of the SVD146 virus compared to the NET/1/92 virus. Also these amino acids are not involved in epitope formation as analysed with the MAbs available thus far.

All MAbs used in this study for epitope mapping could discriminate between isolates NET/1/92 and ITL/1/66 and are specific for ITL/1/66; the amino acids involved in these epitopes are located in VP1 (Dekker et al., 2000Down ). To map these epitopes in more detail, we have predicted which essential amino acids could be involved in the epitope formation and changed these individual amino acids in pSVD146 to the same amino acids as in strain ITL/1/66. To check whether this approach worked, we used MAb 5B7 for which the epitope (aa 163 of VP2) is known and which discriminates between isolates ITL/1/66 and NET/1/92 (Nijhar et al., 1999Down ). The reaction pattern of this MAb changed due to a single amino acid change. Other MAbs that are specific for the NET/1/92 isolate still reacted with the mutated virus, without a change in reactivity (data not shown). With this strategy it was shown that our approach could lead to the mapping of epitopes.

The epitope recognized by MAb 145.12 needed a double amino acid substitution in pSVD146 (aa 258 and aa 266 of VP1) for the formation of the epitope. To date, these amino acids, located at the C-terminal end of VP1, have not been described in epitope formation. This region is known for antigenicity in different picornaviruses (Minor et al., 1986Down ; Sherry & Rueckert, 1985Down ). The double amino acid substitution that is necessary for the epitope of MAb 145·12 is probably due to the conformation needed for maximum recognition of this MAb, which is only correct when both amino acids are changed. Two other epitopes of SVDV were previously mapped to the C-terminal part of VP1, aa 272 of site 3A and aa 275 of VP1, which is homologous to site 3A of poliovirus (Kanno et al., 1995Down ). Another C-terminal epitope of SVDV VP1 is located at aa 261 (Nijhar et al., 1999Down ). The amino acid important for epitope formation used by MAb 145·12 described in this study is located in the same part of the C-terminal end of VP1. The epitope forming VP1 aa 225, recognized by MAb 145·2, has not been identified in SVDV before. The epitope is probably located in the {beta}H–{beta}I loop. Our results show that MAbs 143·9 and 143·10 recognized the same epitope located at aa 87 of VP1. This amino acid is located in the {beta}B–{beta}C loop, which is analogous to poliovirus antigenic site 1. The localization of this epitope has been described previously for the SVDV MAb 4G07 (Kanno et al., 1995Down ). The two new neutralizing antigenic sites described here are located in the ITL/1/66 strain, as the MAbs used are specific for ITL/1/66. The antigenic sites, aa 258 and aa 266, however, have been recently reported (Borrego et al., 2000Down ) and are also found in recently isolated Italian SVDV isolates. Thus, these epitopes are important antigenic sites, not only for the ITL/1/66 but also for other SVDV strains.

We describe two new amino acid positions important for epitope formations of SVDV, whereas another SVDV epitope described here was previously mapped by others. In conclusion a full-length infectious cDNA clone, pSVD146, of SVDV strain NET/1/92 was prepared. The derived virus had the same in vitro and in vivo properties as the parent strain. Therefore pSVD146 seems to be suited for studies in virulence, antigenicity and pathogenesis of this European SVDV isolate.


   Footnotes
 
The GenBank accession number of the sequence reported in this paper is AF268065.


   References
TOP
Abstract
Introduction
Methods
Results
Discussion
References
 
Borrego, B., Carra, E., Ranea, J. A. G., Valencia, A. & Brocchi, E. (2000). Localization of neutralising sites of swine vesicular disease viruses belonging to the most recent antigenic variant; identification of new epitopes. XIth Meeting of the European Study Group on Molecular Biology of Picornaviruses (Zagare Bay, Italy, 25–31 May 2000).

Brocchi, E., Zhang, G., Knowles, N. J., Wilsden, G., McCauley, J. W., Marquardt, O., Ohlinger, V. F. & De Simone, F.(1997). Molecular epidemiology of recent outbreaks of swine vesicular disease: two genetically and antigenically distinct variants in Europe, 1987–94.Epidemiology and Infection118, 51-61.[Medline]

Burrows, R., Mann, J. A. & Goodridge, D.(1974). Swine vesicular disease: virological studies of experimental infections produced by the England-72 virus.Journal of Hygiene72, 135-143.

Dekker, A., Moonen, P. L. J. M. & Terpstra, C.(1995). Validation of a screening liquid phase blocking ELISA for swine vesicular disease.Journal of Virological Methods51, 343-348.[Medline]

Dekker, A., Leendertse, C. H., Poelwijk, F., Rebel, J. M. J. & Moormann, R. J. M.(2000). Chimeric SVD viruses produced by fusion-PCR: a new method for epitope mapping.Journal of Virological Methods86, 131-141.[Medline]

Inoue, T., Suzuki, T. & Sekiguchi, K.(1989). The complete nucleotide sequence of swine vesicular disease virus.Journal of General Virology70, 919-934.[Abstract/Free Full Text]

Inoue, T., Yamaguchi, S., Saeki, T. & Sekiguchi, K.(1990). Production of infectious swine vesicular disease virus cloned cDNA in mammalian cells.Journal of General Virology71, 1835-1838.[Abstract/Free Full Text]

Kanno, T., Inoue, T., Wang, Y., Sarai, A. & Yamaguchi, S.(1995). Identification of the location of antigenic sites of swine vesicular disease virus with neutralization-resistant mutants.Journal of General Virology76, 3099-3106.[Abstract/Free Full Text]

Kanno, T., Inoue, T., Mackay, D., Kitching, P., Yamaguchi, S. & Shirai, J.(1998). Viruses produced from complementary DNA of virulent and avirulent strains of swine vesicular disease virus retain the in vivo and in vitro characteristics of the parental strain.Archives of Virology143, 1055-1062.[Medline]

Kanno, T., Mackay, D., Inoue, T., Wilsden, G., Yamakawa, M., Yamazoe, R., Yamaguchi, S., Shirai, J., Kitching, P. & Murakami, Y.(1999). Mapping the genetic determinants of pathogenicity and plaque phenotype in swine vesicular disease virus.Journal of Virology73, 2710-2716.[Abstract/Free Full Text]

Meulenberg, J. J. M., Bos de Ruyter, J. N. A., Van de Graaf, R., Wensfoort, G. & Moormann, R. J. M.(1998). Infectious transcripts from cloned genome-length cDNA of porcine reproductive and respiratory syndrome virus.Journal of Virology72, 380-387.[Abstract/Free Full Text]

Minor, P. D., Ferguson, M., Evans, D. M. A., Almond, J. W. & Icenogle, J. P.(1986). Antigenic structure of polioviruses of serotypes 1, 2 and 3.Journal of General Virology67, 1283-1291.[Abstract/Free Full Text]

Murphy, F. A., Fauquet, C. M., Bishop, D. H. L., Ghabrial, S. A., Jarvis, A. W., Martelli, G. P., Mayo, M. A. & Summers, M. D. (editors) (1995). Virus Taxonomy. Sixth report of the International Committee on Taxonomy of Viruses. Vienna & New York: Springer-Verlag.

Nardelli, L. E., Lodetti, G. L., Gualandi, G., Goodridge, D., Brown, F. & Cartwright, B.(1968). A foot and mouth disease syndrome in pigs caused by an enterovirus.Nature219, 1275-1276.[Medline]

Nijhar, S. K., Mackay, D. K. J., Brocchi, E., Ferris, N. P., Kitching, R. P. & Knowles, N. J.(1999). Identification of neutralizing epitopes on a European strain of swine vesicular disease virus.Journal of General Virology80, 277-282.[Abstract]

OIE (2000). Disease Information 13, no. 11. http://www.oie.int/info/AIS_52.HTM.

Racaniello, V. R. & Baltimore, D.(1981). Cloned poliovirus complementary DNA is infectious in mammalian cells.Science214, 916-919.[Abstract/Free Full Text]

Rueckert, R. R.(1996). Picornaviridae: the viruses and their replication. In Fields Virology, pp. 609-645. Edited by B. N. Fields, D. M. Knipe & P. M. Howley. Philadelphia:Lippincott–Raven.

Sambrook, J., Fritsch, E. F. & Maniatis, T. (1989). Molecular Cloning: A Laboratory Manual. Cold Spring Harbour NY: Cold Spring Harbour Laboratory.

Seechurn, P., Knowles, N. J. & McCauley, J. W.(1990). The complete nucleotide sequence of a pathogenic swine vesicular disease virus.Virus Research16, 255-274.[Medline]

Sherry, B. & Rueckert, R.(1985). Evidence for at least two dominant neutralization antigens on human rhinovirus 14.Journal of Virology53, 137-143.[Abstract/Free Full Text]

Van Gennip, H. G. P., Rijn, P. A., Widjojoatmodjo, M. N. & Moormann, R. J. M.(1999). Recovery of infectious classical swine fever virus (CSFV) from full-length genomic cDNA clones by a swine kidney cell line expressing bacteriophage T7 RNA polymerase.Journal of Virological Methods78, 117-128.[Medline]

Viera, J. & Messing, J.(1991). New pUC-derived cloning vectors with different selectable markers and DNA replication origins.Gene100, 189-194.[Medline]

Wensvoort, G., Terpstra, C., Boonstra, J., Bloemraad, M. & Van Zaane, D.(1986). Production of monoclonal antibodies against swine fever virus and their use in laboratory diagnosis.Veterinary Microbiology12, 101-108.[Medline]

Zhang, G., Haydon, D. T., Knowles, N. J. & McCauley, J. W.(1999). Molecular evolution of swine vesicular disease virus.Journal of General Virology80, 639-651.[Abstract]

Received 19 May 2000; accepted 10 August 2000.


This article has been cited by other articles:


Home page
J. Gen. Virol.Home page
S.-Q. Sun, X.-T. Liu, H.-C. Guo, S.-H. Yin, Y.-J. Shang, X. Feng, Z.-X. Liu, and Q.-G. Xie
Protective immune responses in guinea pigs and swine induced by a suicidal DNA vaccine of the capsid gene of swine vesicular disease virus
J. Gen. Virol., March 1, 2007; 88(3): 842 - 848.
[Abstract] [Full Text] [PDF]


Home page
J. Gen. Virol.Home page
A. E. Shaw, S. M. Reid, N. J. Knowles, G. H. Hutchings, G. Wilsden, E. Brocchi, D. Paton, and D. P. King
Sequence analysis of the 5' untranslated region of swine vesicular disease virus reveals block deletions between the end of the internal ribosomal entry site and the initiation codon
J. Gen. Virol., October 1, 2005; 86(10): 2753 - 2761.
[Abstract] [Full Text] [PDF]


Home page
J. Gen. Virol.Home page
M. Benjeddou, N. Leat, M. Allsopp, and S. Davison
Development of infectious transcripts and genome manipulation of Black queen-cell virus of honey bees
J. Gen. Virol., December 1, 2002; 83(12): 3139 - 3146.
[Abstract] [Full Text] [PDF]


Home page
J. Gen. Virol.Home page
B. Borrego, J. A. Garcia-Ranea, A. Douglas, and E. Brocchi
Mapping of linear epitopes on the capsid proteins of swine vesicular disease virus using monoclonal antibodies
J. Gen. Virol., June 1, 2002; 83(6): 1387 - 1395.
[Abstract] [Full Text] [PDF]


Home page
J. Gen. Virol.Home page
B. Borrego, E. Carra, J. A. Garcia-Ranea, and E. Brocchi
Characterization of neutralization sites on the circulating variant of swine vesicular disease virus (SVDV): a new site is shared by SVDV and the related coxsackie B5 virus
J. Gen. Virol., January 1, 2002; 83(1): 35 - 44.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via CrossRef
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Rebel, J. M. J.
Right arrow Articles by Moormann, R. J. M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Rebel, J. M. J.
Right arrow Articles by Moormann, R. J. M.
Agricola
Right arrow Articles by Rebel, J. M. J.
Right arrow Articles by Moormann, R. J. M.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
INT J SYST EVOL MICROBIOL MICROBIOLOGY J GEN VIROL
J MED MICROBIOL ALL SGM JOURNALS