J Gen Virol Faster Access
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via CrossRef
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Maguire, T.
Right arrow Articles by Ward, V. K.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Maguire, T.
Right arrow Articles by Ward, V. K.
Agricola
Right arrow Articles by Maguire, T.
Right arrow Articles by Ward, V. K.
Journal of General Virology (2000), 81, 2803-2811.
© 2000 Society for General Microbiology


Insect

The inhibitors of apoptosis of Epiphyas postvittana nucleopolyhedrovirus

Terry Maguire1, Penelope Harrison1, Otto Hyink1, James Kalmakoff1 and Vernon K. Ward1

Department of Microbiology, School of Medical Sciences, University of Otago, PO Box 56, Dunedin, New Zealand1

Author for correspondence: Vernon Ward. Fax +64 3 479 8540. e-mail vernon.ward{at}stonebow.otago.ac.nz


   Abstract
TOP
Abstract
Introduction
Methods
Results
Discussion
References
 
In this study, four inhibitor of apoptosis genes (iaps) in the genome of Epiphyas postvittana nucleopolyhedrovirus (EppoMNPV) that are homologous to iap-1, iap-2, iap-3 and iap-4 genes of other baculoviruses have been identified. All four iap genes were sequenced and the iap-1 and iap-2 genes were shown to be functional inhibitors of apoptosis. The iap-1, iap-2 and iap-3 genes contain two baculovirus apoptosis inhibitor repeat motifs and a C3HC4 RING finger-like motif. The activity of the iap genes was tested by transient expression in Spodoptera frugiperda (Sf-21) cells treated with the apoptosis-inducing agents actinomycin D, cycloheximide, anisomycin, tumour necrosis factor-{alpha} and UV light. The iap-2 gene prevented apoptosis induced by all agents tested, indicating activity towards a conserved component(s) of multiple apoptotic pathways. However, the iap-2 gene was unable to function in the absence of a gene immediately upstream of iap-2 that has homology to the orf69 gene of Autographa californica MNPV. The use of a CMV promoter rescued the apoptosis inhibition activity of the iap-2 gene, indicating that the upstream orf69 homologue is associated with expression of iap-2. The iap-1 gene was able to delay the onset of apoptosis caused by all of the induction agents tested but, unlike iap-2, was unable to prevent the development of an apoptotic response upon prolonged exposure of cells to the apoptosis induction agents. No anti-apoptotic activity was observed for the iap-3 and iap-4 genes of EppoMNPV.


   Introduction
TOP
Abstract
Introduction
Methods
Results
Discussion
References
 
Apoptosis is a genetically programmed series of events that leads to the death of a cell. The fundamental processes for which apoptosis is important include tissue remodelling during embryogenesis (Ucker, 1991Down ), maintenance of organism homeostasis, immune system function and insect metamorphosis (Jiang et al., 1997Down ; Steller & Grether, 1994Down ). A series of defined events including blebbing of the cell surface involving phosphatidylserine reorganization, cell shrinkage, chromatin condensation, nuclear disassembly and internucleosomal cleavage, and the formation of apoptotic bodies, are distinct to apoptosis. The commitment to apoptosis involves both signalling and effector phases. Numerous signals lead to apoptosis and these vary in different cell types. The array of apoptosis induction signals trigger signalling pathways that coalesce, probably at mitochondria, to activate central effector pathways involving a series of proenzymes, the caspases. Activation of the terminal caspases means that the cell has undergone an irreversible commitment to die.

The dysregulation of apoptosis is important in many disease states (Thompson, 1995Down ; Barr & Tomei, 1994Down ). Apoptosis is an important factor in the replication of many viruses, with cellular suicide being an important virus defence mechanism (O’Brien, 1998Down ). Viruses often carry genes that can intercede directly in the apoptosis signalling pathways or act as inhibitors of caspases (Tschopp et al., 1998Down ). In common with several other large DNA viruses, baculoviruses contain genes that can inhibit apoptosis (Miller, 1997Down ). The p35 gene of Autographa californica nucleopolyhedrovirus (AcMNPV) (Clem et al., 1991Down ) encodes a direct inhibitor of caspases (Bump et al., 1995Down ), while the inhibitor of apoptosis (iap) genes are thought to prevent the activation of caspases (Seshagiri & Miller, 1997Down ). A p35-like gene called Slp49 has been identified in Spodoptera littoralis nucleopolyhedrovirus (Du et al., 1999Down ). The baculovirus p35 gene has been identified in very few baculoviruses (Clem et al., 1991Down ; Kamita et al., 1993Down ), while the iap genes have been identified in all baculoviruses studied to date, and in insect iridescent viruses (Crook et al., 1993Down ). The role of the viral iap genes was determined by functional replacement of the p35 gene of AcMNPV with an iap gene from the granulovirus of Cydia pomonella (CpGV) (Crook et al., 1993Down ). Subsequently, an iap gene from Orgyia pseudotsugata nucleopolyhedrovirus (OpMNPV) has been identified as an active inhibitor of apoptosis (Birnbaum et al., 1994Down ).

Most NPVs carry multiple genes that have the characteristic iap motifs of baculovirus inhibitor repeats (BIRs) and a RING finger domain, yet functionality has only been shown for the two iaps described above (Crook et al., 1993Down ; Birnbaum et al., 1994Down ). The domain requirements of IAPs are variable. Mammalian cellular IAPs have been shown not to require a RING finger domain for functionality (Roy et al., 1997Down ), unlike invertebrate IAPs of both cellular and viral origin, which require this domain to be active (Clem & Miller, 1994Down ; Huang et al., 2000Down ; Seshagiri et al., 1999Down ).

There is very little information on what apoptotic pathways IAPs can block. Recent evidence that an IAP from OpMNPV can block apoptosis in mammalian cells (Hawkins et al., 1996Down ), combined with the similarity to IAPs from the cells of vertebrate organisms, suggests that IAPs target a universal point(s) in apoptosis. The importance of iap genes has been reinforced by the discovery of cellular homologues of baculovirus iaps in a variety of mammalian (Liston et al., 1996Down ), dipteran (Hay et al., 1995Down ) and avian (You & Bose, 1998Down ) cells.

In this paper, we investigate the iap genes identified on the EppoMNPV genome and their ability to function as inhibitors of apoptosis. The ability of the IAPs to block multiple apoptosis pathways and the requirement of additional genes to produce an active IAP were investigated.


   Methods
TOP
Abstract
Introduction
Methods
Results
Discussion
References
 
{blacksquare} Cells and viruses.
Spodoptera frugiperda (fall armyworm) Sf-21 cells (Vaughn et al., 1977Down ) were maintained as suspension cultures at 28 °C in serum-free medium (Sf900-II, GIBCO BRL Life Technologies). For apoptosis assays, 35 mm dishes were seeded with Sf-21 cells in Sf900-II medium and grown overnight as monolayers. Cell viability was determined by trypan blue exclusion.

{blacksquare} CpGV iap and Bombyx mori NPV p35.
The iap gene from CpGV was kindly supplied as plasmid pSB490 by L. Miller (Departments of Genetics and Entomology, The University of Georgia, Athens, GA, USA) and the Bombyx mori NPV p35 gene (Kamita et al., 1993Down ) was kindly supplied by S. Maeda (Department of Entomology, University of California, Davis, CA, USA).

{blacksquare} Cloning and sequencing.
Screening of restriction enzyme libraries of EppoMNPV DNA was performed as described by Hyink et al. (1998Down ). Sequencing of the termini of HindIII and EcoRI restriction fragment clones was used to identify homologues of iap-2 and iap-4 genes by BLAST searching of the GenBank database (Altschul et al., 1997Down ). Based upon comparison of the genetic maps of EppoMNPV (Hyink et al., 1998Down ) and OpMNPV (Ahrens et al., 1997Down ), the presence of an iap-1 gene and an iap-3 gene was predicted on HindIII fragment A. The HindIII-A fragment was subcloned in pBluescriptII SK+ and screened by sequencing for the presence of iap homologues. All four iap-containing clones were fully sequenced using an ABI 377 automated sequencer at the Centre for Gene Research, University of Otago. Analysis of derived sequences was performed using the Lasergene suite of DNA analysis programs (DNAStar). Alignment of IAP sequences was performed using the Clustal V algorithm (Higgins & Sharp, 1988Down ) and the phylogeny was determined using PHYLIP (Felsenstein, 1995Down ). The reliability of the phylogeny was estimated by BOOTSTRAP analysis using 100 datasets.

{blacksquare} Induction of apoptosis.
Sf-21 cells were treated with actinomycin D at a final concentration of 2 µg/ml, anisomycin (50 µg/ml), cycloheximide (100 µg/ml), tumour necrosis factor-{alpha} (TNF{alpha}; 0·1 µg/ml) plus cycloheximide (5 µg/ml), or 5,6-dichloro-1-{beta}-D-ribofuranosylbenzimidazole (DRB; 50 µg/ml) for 18 h at 28 °C. Apoptosis induction by cycloheximide was also performed in Sf900-II medium that had been supplemented with 10% foetal calf serum (GIBCO BRL Life Technologies). All chemicals were obtained from Sigma. Apoptosis was induced by exposure of Sf-21 cells to UV irradiation by inverting 6-well tissue culture plates, from which the medium had been removed, onto a standard laboratory transilluminator (Ultra Violet Products) for 15 s. The medium was then replaced.

{blacksquare} Analysis of apoptosis.
Sf-21 cell monolayers in 35 mm dishes were treated with 200 µl of lysis buffer (10 mM Tris pH 7·5, 25 mM EDTA, 0·2% Triton X-100) (Cartier et al., 1994Down ) for 1 h at room temperature. The lysate was extracted once with phenol, once with phenol/chloroform, twice with chloroform, then alcohol-precipitated. The precipitate was centrifuged at 14000 r.p.m. for 5 min then washed with 70% alcohol and dried at 37 °C. The DNA was redissolved in 20 µl RNase A (50 µg/ml in water) and the total volume was electrophoresed on 1% agarose LE (Roche) gels in TAE buffer. DNA was visualized by ethidium bromide staining and UV illumination. To quantify the anti-apoptotic effect of anti-apoptotic genes, cell monolayers were stained with 0·04% trypan blue and cell viability was scored using an inverted light microscope. For each treatment, five fields of view were scored.

{blacksquare} Inhibition of chemical- and UV-induced apoptosis.
The iap genes were obtained as clones in the plasmid pBluescriptII SK+ as shown in Fig. 1Down. Plasmid DNA was prepared for transfection using anion resin-exchange columns (Qiagen). Sf-21 cells (1·5x106 cells per 35 mm diameter well) were transfected with 2 µg of plasmid DNA using Cellfectin (GIBCO BRL Life Technologies) or FuGENE 6 (Roche) following the manufacturers’ protocols and the plates were incubated for 18–24 h at 28 °C. The inducing chemical was then added to each well, or the cells were UV-irradiated to induce apoptosis, and the plates were incubated for 18 h or 30 h. Total cytoplasmic DNA was then extracted as described above and tested for oligonucleosome ladder formation by electrophoresis in 1% agarose.



View larger version (44K):
[in this window]
[in a new window]
 
Fig. 1. Structure of EppoMNPV iap gene-containing clones. Op and Ac designations indicate similarity to Orgyia pseudotsugata MNPV or Autographa californica MNPV ORFs respectively. (a) The 2050 bp HindIII-T fragment containing the EppoMNPV iap-2 gene (solid arrow) is shown. An open arrow indicates a partial OpMNPV lef-3 homologue. Complete ORFs homologous to OpMNPV orf73 and AcMNPV orf69 are shown as stippled arrows. PCR-derived subclones are shown as shaded bars. Clone 137iap-2 contains the iap-2 gene and 137 bp of upstream sequence. Clone 330iap-2 contains the iap-2 gene and 330 bp of upstream sequence. 898iap-2 contains all of the iap-2 gene and AcMNPV orf69 homologue. Clone orf69(RF-) has the orf69 homologue as the only complete gene. CMViap-2 contains the iap-2 gene (hatched arrow) placed after the CMV promoter in the plasmid pCMV·SPORT. (b) The 2159 bp XbaI–KpnI fragment containing the iap-1 gene (solid arrow) is shown. Open arrows indicate partial ORFs. The complete OpMNPV orf42 homologue ORF is shown as a stippled arrow. A PCR-derived clone in which the only complete gene is iap-1 (302iap-1) is shown. (c) The 1787 bp MluI fragment containing the iap-3 gene is shown. Partial ORFs with similarity to the fgf and orf36 genes of OpMNPV are shown as open arrows. CMViap-3 contains the iap-3 gene (hatched arrow) placed after the CMV promoter in the plasmid pCMV·SPORT. (d) The 1175 bp EcoRI-N fragment containing the iap-4 gene homologue is shown. An open arrow indicates a partial ORF with homology to OpMNPV orf107.

 
{blacksquare} Confirmation of iap-2 as an apoptosis inhibitor gene.
The HindIII-T fragment was subcloned to ensure that the iap-2 homologue was the active inhibitor gene (Fig. 1Up). Three subclones were generated by PCR. Each clone contained increasing amounts of sequence upstream of the putative iap-2 ATG start codon. Clone 137iap-2 contained 137 bp of upstream sequence, clone 330iap-2 contained 330 bp of upstream sequence and clone 898iap-2 contained 898 bp of upstream sequence. The PCR primers used to generate the clones were primer TM50 (5' TTTGGTGTGCATTAACAAGT 3'), TM47 (5' TAACAGGGCGCTTATCTTGC 3') and TM45 (5' CGTTCAACGCAACAATCGTTA 3') respectively, each paired with the universal reverse primer (5' GGAAACAGCTATGACCATG 3'). The PCR products were generated using the Expand High Fidelity PCR kit (Roche). The PCR products were treated with Klenow (Roche) then digested with HindIII to regenerate the original cloning site nine nucleotides outside the stop codon of the iap-2 gene. The PCR fragments were ligated into pBluescriptII SK+ DNA digested with restriction enzymes SmaI and HindIII.

A further construct, designated orf69(RF-), was made in which the 3' end of clone 898iap-2 was removed to eliminate the RING finger motif from the iap-2 gene, leaving the orf69 homologue as the only complete gene in the clone. Clone 898iap-2 was digested with BglII, which has a recognition site 223 bp inside the 3' end of the iap-2 gene, and BamHI, which cuts in the multiple cloning site of pBluescriptII SK+. The plasmid was recircularized by ligation with T4 DNA ligase.

The iap-2 gene was subcloned into the expression vector pCMV·SPORT (GIBCO BRL Life Technologies). The gene was amplified by PCR using the universal forward primer and a primer complementary to the 5' end of the iap-2 gene (5' GAATGGATCCCTAAGCATGGATTTGCAAAAGT 3'). This primer contained a BamHI restriction site (underlined) and the ATG start codon (bold). The PCR product was digested with BamHI and HindIII and then ligated into BamHI- and HindIII-digested pCMV·SPORT.

All clones were transformed into E. coli strain DH5{alpha} and screened by standard protocols. All PCR-derived clones were sequenced to ensure that no PCR errors had occurred. The ability of each construct to inhibit apoptosis was determined as described above using 2 µg of plasmid per transfection.

{blacksquare} Confirmation of iap-1 as an apoptosis inhibitor gene.
An analogous approach was taken with the iap-1-containing clone iap-1/42, which contained a homologue of OpMNPV orf42. Primer TM59 (5' TTCAACTCGGTCAAATGCGCG 3') was paired with the universal reverse primer to generate the iap-1 gene plus 302 bp of upstream sequence from the clone iap-1/42 by PCR. The PCR product was cloned into pBluescript SK- and designated as 302iap-1. The clone contained the iap-1 gene as the only complete gene and was tested as described above.

{blacksquare} Nucleotide sequence accession numbers.
The GenBank accession numbers are: iap-1,AF119227; iap-2,AF037358; iap-3, AF180757; iap-4, AF119228.


   Results
TOP
Abstract
Introduction
Methods
Results
Discussion
References
 
EppoMNPV contains four iap homologues
Two iap gene homologues, iap-2 and iap-4, were identified in a previous mapping study of EppoMNPV (Hyink et al., 1998Down ). The iap-2 gene was isolated on the HindIII-T fragment and iap-4 was isolated on the EcoRI-N fragment. Based upon the similarity of the EppoMNPV genome to that of OpMNPV we predicted that iap-1 and iap-3 homologues were likely to occur within the HindIII-A fragment of the genome. The iap-1 and iap-3 genes were obtained as a 2·1 kb XbaI–KpnI subclone and a 1·8 kb MluI subclone of HindIII-A respectively.

The HindIII-T clone contained the iap-2 gene and three other open reading frames (ORFs; Fig. 1aUp). A partial homologue of lef3 was identified, as was a complete ORF with 69% amino acid identity to OpMNPV orf73 (61% identity to AcMNPV orf68). A complete gene with 57% identity to AcMNPV orf69 was also present. There is no homologue of AcMNPV orf69 in OpMNPV. The gene order in this region of the genome was identical to AcMNPV but not to OpMNPV.

The 2·1 kb XbaI–KpnI subclone (clone iap-1/42) contained three ORFs in addition to the iap-1 gene (Fig. 1bUp). A homologue to baculovirus lef6 genes was located downstream of the iap-1 gene. BLAST analysis of the 70 amino acids present in the clone showed the closest similarity to the first 70 amino acids of the OpMNPV lef6 gene. A complete ORF of 127 amino acids located upstream of the iap-1 gene showed 62% and 52% identity to orf42 of OpMNPV and orf26 of AcMNPV respectively. A partial gene sequence representing 237 amino acids of a homologue of OpMNPV orf43 (AcMNPV orf25) was present upstream of the orf42 homologue. The order of the genes surrounding iap-1 is identical to that found in OpMNPV (Ahrens et al., 1997Down ).

The iap-3 ORF was the only complete ORF on the 1·787 kb MluI subclone (Fig. 1cUp). Flanking the iap-3 gene were two partial ORFs with similarity to OpMNPV fgf (119 amino acids) and OpMNPV orf36 (155 amino acids). The gene content and arrangement of this region of the EppoMNPV genome is different to that of OpMNPV (Ahrens et al., 1997Down ).

The iap-4 gene was the only complete ORF on the EcoRI-N clone. A 168 amino acid partial ORF upstream of the iap-4 gene was similar to OpMNPV orf107.

IAPs fall into distinct homology groups
The IAP-1 protein of EppoMNPV is a 284 amino acid protein that has a predicted molecular mass of 32550 Da, with 71% and 59% identity to OpMNPV IAP-1 and AcMNPV IAP-1 respectively. The IAP-2 protein contains 239 amino acids (27363 Da), with 63% and 57% identity to OpMNPV IAP-2 and AcMNPV IAP-2 respectively. The IAP-3 protein is a 261 amino acid protein (29981 Da) with a sequence identity of 56% to OpMNPV IAP-3. IAP-4 is a 141 amino acid protein (15932 Da) with 51% identity to the IAP-4 of OpMNPV. An alignment and phylogenetic analysis of the IAP-1, IAP-2 and IAP-3 proteins of baculoviruses is presented in Fig. 2Down. The IAPs fall into distinct groups (Fig. 2bDown). The only exception to the clustering of IAP types is Buzura suppressaria NPV IAP-1, which was named by order on the viral genome rather than sequence homology (Hu et al., 1998Down ). IAP-4s were not included because none have been shown to be active, so there is no evidence, other than sequence homology, that these are indeed inhibitors of apoptosis. Two BIRs are present in the IAP-1, IAP-2 and IAP-3 proteins (Fig. 2aDown). Comparison with other IAPs showed a conserved BIR motif of GX9–11CX2CX8–10E/DX5HX3–6C. A characteristic C3HC4 RING finger motif is also present in the IAP-1, IAP-2 and IAP-3 proteins (Fig. 2aDown). Analysis of the IAP-4 protein showed only one BIR region and the RING finger motif.



View larger version (113K):
[in this window]
[in a new window]
 
Fig. 2. Comparison of baculovirus IAP-1, IAP-2 and IAP-3 amino acid sequences. (a) Alignment of IAP amino acid sequences. Ac, Autographa californica MNPV; Eppo, Epiphyas postvittana MNPV; Op, Orgyia pseudotsugata MNPV; Cf, Choristoneura fumiferana MNPV; CpGV, Cydia pomonella granulovirus; Busu, Buzura suppressaria SNPV. The IAP designations are indicated. Heavy underlining indicates the core BIR motif of GX9–11CX2CX8–10E/DX5HX3–6C. Double underlining indicates the C3HC4 RING finger motif. Shading highlights the conserved residues in each of the three motifs. The published designation for each IAP has been used. The GenBank sources (accession numbers) for each sequence used in this comparison are: AcMNPV complete genome, L22858; OpMNPV complete genome, U75930; Cf IAP, U82510; CpGV IAP, L05494; Busu IAP-1, AF045936. (b) Phylogenetic tree constructed from the alignment displayed in (a). The virus and IAP designations are as described above. The three clades formed by IAP-1, IAP-2 and IAP-3 apoptosis inhibitors are indicated. BOOTSTRAP analysis using 100 replicates gave 100% support for the major divisions between IAP clades.

 
Induction of apoptosis in Sf-21 cells
An array of apoptosis induction signals was tested against Sf-21 cells grown in serum-free Sf900-II medium (Life Technologies). All of the agents tested induced apoptosis in the Sf-21 cells within 18 h (Fig. 3Down). The induction of apoptosis by RNA synthesis inhibitors is well documented; however, the induction by cycloheximide and TNF{alpha} was not expected. Supplementation of the serum-free Sf900-II medium with 10% foetal calf serum prevented the induction of apoptosis by cycloheximide. The induction of apoptosis by TNF{alpha} required the presence of a low level of cycloheximide; however, the dose of 5 µg/ml cycloheximide used to potentiate the TNF{alpha} response did not cause apoptosis in the absence of TNF{alpha} (data not shown).



View larger version (33K):
[in this window]
[in a new window]
 
Fig. 3. Induction of apoptosis in Sf-21 cells. (a) Induction of apoptosis and generation of oligonucleosomal ladders was as described in Methods. DRB, 5,6-Dichloro-1-{beta}-D-ribofuranosylbenzimidazole; TNF{alpha}, tumour necrosis factor-{alpha}. The relative migration of molecular size markers is shown in base pairs. (b) Cell death (%) after induction by the indicated apoptosis-inducing agents as determined by trypan blue vital staining and microscopic examination. The SE is shown for each sample.

 
IAP-2 is a functional inhibitor of apoptosis
The HindIII-T clone containing the iap-2 gene inhibited apoptosis induction by actinomycin D (Fig. 4Down) and all of the other inducing agents tested (Table 1Down). Because the clone contained two other complete ORFs that are homologues of AcMNPV orf68 and orf69, subcloning was undertaken to confirm that the iap-2 gene was responsible for the anti-apoptotic activity. Three constructs containing increasing amounts of upstream sequence were generated as shown in Fig. 1Up. Subclones of the iap-2 gene containing 137 bp and 330 bp of upstream sequence were not capable of preventing apoptosis induced by actinomycin D (Fig. 4bDown) and subsequent testing against other inducing agents confirmed this lack of anti-apoptotic activity (Table 1Down). The inclusion of 898 bp of upstream sequence restored anti-apoptotic function; however, this subclone includes the entire upstream gene homologous to orf69 of AcMNPV (Fig. 1Up). To confirm the role of iap-2 as an anti-apoptosis gene, the RING finger motif was removed from the clone containing both the orf69 and iap-2 genes. Clone orf69(RF-) was unable to prevent apoptosis (Fig. 4bDown), thus confirming the requirement for iap-2. In addition, the iap-2 gene prevented apoptosis when placed after the constitutive CMV early promoter in the expression vector pCMV·SPORT (Fig. 4bDown). That this promoter was active in insect cells had been confirmed by transfecting cells with pCMV·SPORT–{beta}-galactosidase and staining of the cells with X-Gal (data not shown). The activity of the promoter in Sf-21 cells was also confirmed with the manufacturer (Life Technologies) of pCMV·SPORT.



View larger version (63K):
[in this window]
[in a new window]
 
Fig. 4. Inhibition of apoptosis by EppoMNPV iap genes. DNA laddering assays represent total DNA extracted from 35 mm tissue culture wells, which was analysed by gel electrophoresis and ethidium bromide staining. (a) Dose–response of apoptosis inhibition in actinomycin D-induced Sf-21 cells by clone HindIII-T containing the EppoMNPV iap-2 gene. Molecular size markers are included. The dose (µg) represents the quantity of plasmid clone used to transfect 1·5x106 Sf-21 cells in a 35 mm diameter tissue culture dish. Vector, pBluescriptII SK+. (b) The iap-2 gene is capable of preventing actinomycin D-induced apoptosis in Sf-21 cells. A description of each clone is given in the legend to Fig. 1(aUp). A 2 µg aliquot of each clone was used for each transfection assay. Cellfectin, transfection control. (c) IAP-1 causes a delay in actinomycin D-induced apoptosis in Sf-21 cells. A description of each clone is given in the legend to Fig. 1Up. 18h and 30h, Incubation of Sf-21 cells with actinomycin D for 18 h or 30 h respectively prior to analysis for oligonucleosomal laddering; Cellfectin, transfection control. (d, e) IAP-3 and IAP-4 do not prevent actinomycin D-induced apoptosis in Sf-21 cells. The clones tested are described in the legend to Fig. 1(cUp) and (dUp). Cellfectin, transfection control. (f) Cell death (%) as determined by trypan blue vital staining and microscopic examination. ActD, apoptosis induced by actinomycin D.

 

View this table:
[in this window]
[in a new window]
 
Table 1. Ability of EppoMNPV IAP clones to inhibit apoptosis induction

 
IAP-1 delays apoptosis in Sf-21 cells
Transfection of the iap-1-containing clone into Sf-21 cells was observed to delay the onset of apoptosis. The delay in apoptosis was also observed when apoptosis inducers other than actinomycin D were used (Table 1Up). Analysis of induced cells 18 h post-induction showed marked inhibition of apoptosis (by microscopic analysis; Fig. 4fUp) or DNA oligonucleosome formation (Fig. 4cUp). However, unlike the iap-2 gene, longer exposure (30 h) to the inducing agents led to the development of an apoptotic response (Fig. 4cUp, fUp). Removal of part of the orf42 coding sequence (clone 302iap-1) did not affect the functionality of IAP-1 (Fig. 4cUp).

EppoMNPV IAP-3 and IAP-4 are not functional
IAP-3 and IAP-4 were not found to block apoptosis induced by actinomycin D (Fig. 4dUp, eUp). The use of a CMV promoter, which had been shown to work for the iap-2 gene (see above), did not produce an active iap-3 gene. The iap-4 gene was not tested with a CMV promoter. Subsequent analysis showed no inhibition of apoptosis for any of the inducing agents used in this study for either the iap-3 gene or the iap-4 gene (Table 1Up).


   Discussion
TOP
Abstract
Introduction
Methods
Results
Discussion
References
 
This paper describes four iap gene homologues identified on the genome of EppoMNPV. The similarities between the EppoMNPV genome and the genomes of OpMNPV and AcMNPV suggest that the presence of another iap is unlikely. This homology-based approach may not identify apoptosis inhibitors that are not iaps.

When only 330 bp of sequence was present upstream of the iap-2 gene, the iap-2 gene was not functional. The iap-2 gene was functional when the orf69 gene homologue and a possible promoter region were located upstream. Removal of the RING finger motif from iap-2 abolished anti-apoptotic activity, confirming both the role of EppoMNPV iap-2 and the essential requirement for a RING finger motif in baculoviral IAPs. The use of a CMV promoter to express the iap-2 gene confirmed the functionality of IAP-2 and suggests that the orf69 homologue has a role in expression of iap-2. A recent study by Li et al. (1999Down ) has shown that orf69 of AcMNPV can function as an activator of gene expression. An alternative explanation is that iap-2 promoter sequences lie in the region between 898 and 330 bp upstream of the iap-2 gene, within orf69.

Comparison of the iap-1, iap-2 and iap-3 genes showed that they fall into distinct homology classes and that the naming of new IAPs should be based upon gene homologies rather than order within a viral genome. The homology groupings and the presence of multiple iaps on NPV genomes suggest a requirement for different iaps. As far as the authors know, this is the first report of anti-apoptosis activity for iap-1 and iap-2 genes. That these genes do possess anti-apoptosis activity suggests that this is likely to be their primary function. Given the broad range of anti-apoptotic activity demonstrated in this paper, the different iaps are more likely to be needed for different cells, tissues and hosts than for the inhibition of different stimuli. The iap genes that have been demonstrated as active from baculoviruses other than EppoMNPV cluster in the iap-3 group of iap genes. It is likely that the apparent lack of an active iap-3 gene in EppoMNPV is compensated by the activity of the iap-1 and iap-2 genes. EppoMNPV does not grow in Sf-21 cells (K. Caradoc-Davies, personal communication) and this study indicates that an active iap is unlikely to be a host range determinant for EppoMNPV infection of Sf-21 cells.

The induction of Sf-21 cell apoptosis by the RNA synthesis inhibitors actinomycin D, DRB and anisomycin has been reported previously (Clem & Miller, 1994Down ). These transcription inhibitors have distinct modes of action (White & Phillips, 1988Down ; Zandomeni et al., 1983Down ), but would be expected to initiate the same or a very similar apoptotic signalling pathway. What was surprising was the induction by cycloheximide and TNF{alpha}. Clem & Miller (1994Down ) reported that cycloheximide does not induce apoptosis in Sf-21 cells. The study of Clem & Miller (1994Down ) employed cells in serum-containing medium. The addition of 10% serum to the Sf900-II medium prevented the induction of apoptosis in Sf-21 cells by cycloheximide. Cycloheximide-induced apoptosis has also been observed for Choristoneura fumiferana (CF-203) cells (Palli et al., 1996Down ). The induction by TNF{alpha} suggests the presence of a TNFR-like protein on the surface of the Sf-21 cell and the presence of a signalling pathway that may be analogous to that involving the death domain proteins such as RIP, TRAFF and caspase-8 in mammalian cells. The human cellular IAPs have been reported to interact with these death domain proteins (Rothe et al., 1995Down ; Uren et al., 1996Down ); however, it appears that mammalian IAPs are distinct from invertebrate cellular and viral IAPs. In particular, mammalian IAPs do not require a RING finger motif for activity and interact directly with caspase-3 to prevent apoptosis (Deveraux et al., 1997Down ; Roy et al., 1997Down ), rather than preventing terminal caspase activation as shown for invertebrate IAPs (Huang et al., 2000Down ; Manji et al., 1997Down ; Seshagiri & Miller, 1997Down ; Seshagiri et al., 1999Down ). Despite these differences, some invertebrate IAPs are active in mammalian cells. Hawkins et al. (1996Down ) have shown that OpMNPV IAP-3 is active in mammalian cells and the recent study of Huang et al. (2000Down ) showed that invertebrate IAPs can inhibit mammalian caspase-9, which is involved in the activation of terminal caspases. Huang et al. (2000Down ) predicted that SfIAP and CpIAP target a caspase-9-like protease in S. frugiperda cells to prevent the activation of Sf-caspase-1. These data support the conservation that is evident between the apoptosis systems of metazoans, allowing comparison with mammalian systems for elucidating the function of baculovirus IAPs.

It has been suggested that caspases are an amplification system that accelerates the cell death response (Li et al., 1997Down ; Liu et al., 1996Down ). In mammalian cells, most apoptosis signals converge to cause the release of cytochrome c from mitochondria, which in turn contributes to apoptosome formation and the activation of caspase-9, followed by the subsequent activation of caspase-3 (Green & Kroemer, 1998Down ). The ability of EppoMNPV IAP-2 to block apoptosis induced by an array of induction signals that in mammalian cells converge at the mitochondrion, suggests that IAP-2 functions after the signals have converged. If an analogy is made to mammalian cells then the target of IAP-2 must be associated with the mitochondria, the apoptosome, or the direct activation of effector caspases. Seshagiri & Miller (1997Down ) have shown that at least one baculoviral IAP functions upstream of Sf-caspase-1 and Duckett et al. (1998Down ) have proposed that the human IAP-like protein regulates apoptosis downstream of the mitochondrion. The paper by Huang et al. (2000Down ) supports this theory.

One proposed theory of caspase amplification is that caspases interact with the mitochondrion in a cyclical amplification (Green & Kroemer, 1998Down ). A consequence of this theory would be that direct inhibition of caspases that interact with the mitochondrion would lead to a delay in apoptosis but not a prevention of apoptosis. The delay in apoptosis caused by IAP-1 is such a response. IAP-1 may interfere with a caspase/mitochondrion amplification loop, although care must be taken when comparing invertebrate and mammalian cells.

This paper has presented the first evidence that iap-1 and iap-2 genes of baculoviruses can function as inhibitors of apoptosis. The paper also shows that these inhibitors can function against a wide array of apoptosis inducers that can be expected to trigger multiple initiator pathways of apoptosis, and provides insights into the mode of action of IAPs.


   Acknowledgments
 
This work was supported by Marsden Fund grant no. UOO602 to J.K. and V.K.W.


   References
TOP
Abstract
Introduction
Methods
Results
Discussion
References
 
Ahrens, C. H., Russell, R. L. Q., Funk, C. J., Evans, J. T., Harwood, S. H. & Rohrmann, G. F.(1997). The sequence of the Orgyia pseudotsugata multinucleocapsid nuclear polyhedrosis virus genome.Virology229, 381-399.[Medline]

Altschul, S. F., Madden, T. L., Schaffer, A. A., Zhang, J., Zhang, Z., Miller, W. & Lipman, D. J.(1997). Gapped BLAST and PSI-BLAST: a new generation of protein database search programs.Nucleic Acids Research25, 3389-3402.[Abstract/Free Full Text]

Barr, P. J. & Tomei, L. D.(1994). Apoptosis and its role in human disease.Bio/technology12, 487-493.[Medline]

Birnbaum, M. J., Clem, R. J. & Miller, L. K.(1994). An apoptosis-inhibiting gene from a nuclear polyhedrosis virus encoding a polypeptide with cys/his sequence motifs.Journal of Virology68, 2521-2528.[Abstract/Free Full Text]

Bump, N. J., Hackett, M., Hugunin, M., Seshagiri, S., Brady, K., Chen, P., Ferenz, C. S., Franklin, C., Ghayur, T., Li, P., Licari, P., Mankovich, J., Shi, L., Greenberg, A. H., Miller, L. K. & Wong, W. W.(1995). Inhibition of ICE family proteases by baculovirus antiapoptotic protein P35.Science269, 1885-1888.[Abstract/Free Full Text]

Cartier, J. L., Hershberger, P. A. & Friesen, P. D.(1994). Suppression of apoptosis in insect cells stably transfected with baculovirus p35: dominant interference by N-terminal sequences p351–76.Journal of Virology68, 7728-7737.[Abstract/Free Full Text]

Clem, R. J. & Miller, L. K.(1994). Control of programmed cell death by the baculovirus genes p35 and iap.Molecular and Cellular Biology14, 5212-5222.[Abstract/Free Full Text]

Clem, R. J., Fechheimer, M. & Miller, L. K.(1991). Prevention of apoptosis by a baculovirus gene during infection of insect cells.Science254, 1388-1390.[Abstract/Free Full Text]

Crook, N. E., Clem, R. J. & Miller, L. K.(1993). An apoptosis-inhibiting baculovirus gene with a zinc finger-like motif.Journal of Virology67, 2168-2174.[Abstract/Free Full Text]

Deveraux, Q. L., Takahashi, R., Salvesen, G. S. & Reed, J. C.(1997). X-linked IAP is a direct inhibitor of cell-death proteases.Nature388, 300-304.[Medline]

Du, Q., Lehavi, D., Faktor, O., Qi, Y. & Chejanovsky, N.(1999). Isolation of an apoptosis suppressor gene of the Spodoptera littoralis nucleopolyhedrovirus.Journal of Virology73, 1278-1285.[Abstract/Free Full Text]

Duckett, C. S., Li, F., Wang, Y., Tomaselli, K. J., Thompson, C. B. & Armstrong, R. C.(1998). Human IAP-like protein regulates programmed cell death downstream of Bcl-xL and cytochrome c.Molecular and Cellular Biology18, 608-615.[Abstract/Free Full Text]

Felsenstein, J. (1995). PHYLIP (Phylogeny Inference Package), version 3.5c. Distributed by the author. Department of Genetics, University of Washington, USA.

Green, D. & Kroemer, G.(1998). The central executioners of apoptosis: caspases or mitochondria?Trends in Cell Biology8, 267-271.[Medline]

Hawkins, C. J., Uren, A. G., Hacker, G., Medcalf, R. L. & Vaux, D. L.(1996). Inhibition of interleukin 1{beta}-converting enzyme-mediated apoptosis of mammalian cells by baculovirus IAP.Proceedings of the National Academy of Sciences, USA93, 13786-13790.[Abstract/Free Full Text]

Hay, B. A., Wasserman, D. A. & Rubin, G. M.(1995). Drosophila homologs of baculovirus inhibitor of apoptosis proteins function to block cell death.Cell83, 1253-1262.[Medline]

Higgins, D. G. & Sharp, P. M.(1988). CLUSTAL: a package for performing multiple sequence alignment on a microcomputer.Gene73, 237-244.[Medline]

Hu, Z. H., Arif, B. M., Jin, F., Martens, J. W. M., Chen, X. W., Sun, J. S., Zuidema, D., Goldbach, R. W. & Vlak, J. M.(1998). Distinct gene arrangement in the Buzura suppressaria single-nucleocapsid nucleopolyhedrovirus genome.Journal of General Virology79, 2841-2851.[Abstract]

Huang, Q., Deveraux, Q. L., Maeda, S., Slavesan, G. S., Stennicke, H. R., Hammock, B. D. & Reed, J. C.(2000). Evolutionary conservation of apoptosis mechanisms: lepidopteran and baculoviral inhibitor of apoptosis proteins are inhibitors of mammalian caspase-9.Proceedings of the National Academy of Sciences, USA97, 1427-1432.[Abstract/Free Full Text]

Hyink, O., Graves, S., Fairbairn, F. M. & Ward, V. K.(1998). Mapping and polyhedrin gene analysis of the Epiphyas postvittana nucleopolyhedrovirus genome.Journal of General Virology79, 2853-2862.[Abstract]

Jiang, C., Baehrecke, E. H. & Thummel, C. S.(1997). Steroid regulated programmed cell death during Drosophila metamorphosis.Development124, 4673-4683.[Abstract]

Kamita, S. G., Majima, K. & Maeda, S.(1993). Identification and characterisation of the p35 gene of Bombyx mori nuclear polyhedrosis virus that prevents virus-induced apoptosis.Journal of Virology67, 455-463.[Abstract/Free Full Text]

Li, P., Nijhawan, D., Budihardjo, I., Srinivasula, S. M., Ahmad, M., Alnemri, E. S. & Wang, X.(1997). Cytochrome c and dATP-dependent formation of Apaf-1/caspase-9 complex initiates an apoptotic protease cascade.Cell91, 479-489.[Medline]

Li, L., Harwood, S. H. & Rohrmann, G. F.(1999). Identification of additional genes that influence baculovirus late gene expression.Virology255, 9-19.[Medline]

Liston, P., Roy, N., Tamal, K., Lefebvre, C., Baird, S., Cherton-Horvat, G., Farahani, R., McLean, M., Ikeda, J.-E., MacKenzie, A. & Korneluk, R. G.(1996). Suppression of apoptosis in mammalian cells by NAIP and a related family of IAP genes.Nature379, 349-353.[Medline]

Liu, X., Kim, C. N., Yang, J., Jemmerson, R. & Wang, X.(1996). Induction of apoptotic program in cell free extracts: requirement for dATP and cytochrome c.Cell86, 147-157.[Medline]

Manji, G. A., Hozak, R. R., LaCount, D. J. & Friesen, P. D.(1997). Baculovirus inhibitor of apoptosis functions at or upstream of the apoptotic suppressor P35 to prevent programmed cell death.Journal of Virology71, 4509-4516.[Abstract]

Miller, L. K.(1997). Baculovirus interaction with host apoptotic pathways.Journal of Cellular Physiology173, 178-182.[Medline]

O’Brien, V.(1998). Viruses and apoptosis.Journal of General Virology79, 1833-1845.[Medline]

Palli, S. R., Sohi, S. S., Cook, B. J., Brownwright, A. J., Caputo, G. F. & Retnakaran, A.(1996). RNA- and protein-synthesis inhibitors induce apoptosis in a midgut cell line from the spruce budworm Choristoneura fumiferana.Journal of Insect Physiology42, 1061-1069.

Rothe, M., Pan, M.-G., Henzel, W. J., Ayres, T. M. & Goeddel, D. V.(1995). The TNFR2–TRAF signalling complex contains two novel proteins related to baculoviral inhibitor of apoptosis proteins.Cell83, 1243-1252.[Medline]

Roy, N., Deveraux, Q. L., Takahashi, R., Salvesen, G. S. & Reed, J. C.(1997). The c-IAP-1 and c-IAP-2 proteins are direct inhibitors of specific caspases.EMBO Journal16, 6914-6925.[Medline]

Seshagiri, S. & Miller, L. K.(1997). Baculovirus inhibitors of apoptosis (IAPs) block activation of Sf-caspase-1.Proceedings of the National Academy of Sciences, USA94, 13606-13611.[Abstract/Free Full Text]

Seshagiri, S., Vucic, D., Lee, J. & Dixit, V. M.(1999). Baculovirus-based genetic screen for antiapoptotic genes identifies a novel IAP.Journal of Biological Chemistry274, 36769-36773.[Abstract/Free Full Text]

Steller, H. & Grether, M. E.(1994). Programmed cell death in Drosophila.Neuron13, 1269-1274.[Medline]

Thompson, C. B.(1995). Apoptosis in the pathogenesis and treatment of disease.Science267, 1456-1462.[Abstract/Free Full Text]

Tschopp, J., Thome, M., Hofmann, K. & Meinl, E.(1998). The fight of viruses against apoptosis.Current Opinion in Genetics & Development8, 82-87.

Ucker, D. S.(1991). Death by suicide: one way to go in mammalian cellular development?New Biology3, 103-109.

Uren, A. G., Pakusch, M., Hawkins, C. J., Puls, C. J. & Vaux, D. L.(1996). Cloning and expression of apoptosis inhibitory protein homologs that function to inhibit apoptosis and/or bind tumor necrosis factor receptor-associated factors.Proceedings of the National Academy of Sciences, USA93, 4974-4978.[Abstract/Free Full Text]

Vaughn, J. L., Goodwin, R. H., Tompkins, G. J. & McCawley, P.(1977). The establishment of two cell lines from the insect Spodoptera frugiperda (Lepidoptera: Noctuidae).In Vitro13, 213-217.[Medline]

White, R. J. & Phillips, D. R.(1988). Transcriptional analysis of multisite drug–DNA dissociation kinetics: delayed termination of transcription by actinomycin D.Biochemistry27, 9122-9132.[Medline]

You, M. & Bose, H. R. J.(1998). Identification of v-Rel oncogene-induced inhibitor of apoptosis by differential display.Methods16, 373-385.[Medline]

Zandomeni, R., Bunick, D., Ackerman, S., Mittleman, B. & Weinmann, R.(1983). Mechanism of action of DRB. III. Effect on specific in vitro initiation of transcription.Journal of Molecular Biology167, 561-574.[Medline]

Received 17 April 2000; accepted 27 July 2000.


This article has been cited by other articles:


Home page
J. Gen. Virol.Home page
Q. Yu, T. Lin, G. Feng, K. Yang, and Y. Pang
Functional analysis of the putative antiapoptotic genes, p49 and iap4, of Spodoptera litura nucleopolyhedrovirus with RNAi
J. Gen. Virol., August 1, 2008; 89(8): 1873 - 1880.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
D. Westphal, E. C. Ledgerwood, M. H. Hibma, S. B. Fleming, E. M. Whelan, and A. A. Mercer
A Novel Bcl-2-Like Inhibitor of Apoptosis Is Encoded by the Parapoxvirus Orf Virus
J. Virol., July 1, 2007; 81(13): 7178 - 7188.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
C. J. Hartley, D. R. Greenwood, R. J. C. Gilbert, A. Masoumi, K. H. J. Gordon, T. N. Hanzlik, E. E. Fry, D. I. Stuart, and P. D. Scotti
Kelp Fly Virus: a Novel Group of Insect Picorna-Like Viruses as Defined by Genome Sequence Analysis and a Distinctive Virion Structure
J. Virol., November 1, 2005; 79(21): 13385 - 13398.
[Abstract] [Full Text] [PDF]


Home page
J. Gen. Virol.Home page
J. G. de Jong, H. A. M. Lauzon, C. Dominy, A. Poloumienko, E. B. Carstens, B. M. Arif, and P. J. Krell
Analysis of the Choristoneura fumiferana nucleopolyhedrovirus genome
J. Gen. Virol., April 1, 2005; 86(4): 929 - 943.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
H. A. M. Lauzon, C. J. Lucarotti, P. J. Krell, Q. Feng, A. Retnakaran, and B. M. Arif
Sequence and Organization of the Neodiprion lecontei Nucleopolyhedrovirus Genome
J. Virol., July 1, 2004; 78(13): 7023 - 7035.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
A. Garcia-Maruniak, J. E. Maruniak, P. M. A. Zanotto, A. E. Doumbouya, J.-C. Liu, T. M. Merritt, and J. S. Lanoie
Sequence Analysis of the Genome of the Neodiprion sertifer Nucleopolyhedrovirus
J. Virol., July 1, 2004; 78(13): 7036 - 7051.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
J. C. Means, I. Muro, and R. J. Clem
Silencing of the Baculovirus Op-iap3 Gene by RNA Interference Reveals that It Is Required for Prevention of Apoptosis during Orgyia pseudotsugata M Nucleopolyhedrovirus Infection of Ld652Y Cells
J. Virol., April 15, 2003; 77(8): 4481 - 4488.
[Abstract] [Full Text] [PDF]


Home page
J. Gen. Virol.Home page
O. Hyink, R. A. Dellow, M. J. Olsen, K. M. B. Caradoc-Davies, K. Drake, E. A. Herniou, J. S. Cory, D. R. O'Reilly, and V. K. Ward
Whole genome analysis of the Epiphyas postvittana nucleopolyhedrovirus
J. Gen. Virol., April 1, 2002; 83(4): 957 - 971.
[Abstract] [Full Text] [PDF]


Home page
J. Gen. Virol.Home page
T. Luque, R. Finch, N. Crook, D. R. O'Reilly, and D. Winstanley
The complete sequence of the Cydia pomonella granulovirus genome
J. Gen. Virol., October 1, 2001; 82(10): 2531 - 2547.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via CrossRef
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Maguire, T.
Right arrow Articles by Ward, V. K.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Maguire, T.
Right arrow Articles by Ward, V. K.
Agricola
Right arrow