|
|
||||||||
Insect |
Department of Microbiology, School of Medical Sciences, University of Otago, PO Box 56, Dunedin, New Zealand1
Author for correspondence: Vernon Ward. Fax +64 3 479 8540. e-mail vernon.ward{at}stonebow.otago.ac.nz
| Abstract |
|---|
|
|
|---|
and UV light. The iap-2 gene prevented apoptosis induced by all agents tested, indicating activity towards a conserved component(s) of multiple apoptotic pathways. However, the iap-2 gene was unable to function in the absence of a gene immediately upstream of iap-2 that has homology to the orf69 gene of Autographa californica MNPV. The use of a CMV promoter rescued the apoptosis inhibition activity of the iap-2 gene, indicating that the upstream orf69 homologue is associated with expression of iap-2. The iap-1 gene was able to delay the onset of apoptosis caused by all of the induction agents tested but, unlike iap-2, was unable to prevent the development of an apoptotic response upon prolonged exposure of cells to the apoptosis induction agents. No anti-apoptotic activity was observed for the iap-3 and iap-4 genes of EppoMNPV. | Introduction |
|---|
|
|
|---|
The dysregulation of apoptosis is important in many disease states (Thompson, 1995
; Barr & Tomei, 1994
). Apoptosis is an important factor in the replication of many viruses, with cellular suicide being an important virus defence mechanism (OBrien, 1998
). Viruses often carry genes that can intercede directly in the apoptosis signalling pathways or act as inhibitors of caspases (Tschopp et al., 1998
). In common with several other large DNA viruses, baculoviruses contain genes that can inhibit apoptosis (Miller, 1997
). The p35 gene of Autographa californica nucleopolyhedrovirus (AcMNPV) (Clem et al., 1991
) encodes a direct inhibitor of caspases (Bump et al., 1995
), while the inhibitor of apoptosis (iap) genes are thought to prevent the activation of caspases (Seshagiri & Miller, 1997
). A p35-like gene called Slp49 has been identified in Spodoptera littoralis nucleopolyhedrovirus (Du et al., 1999
). The baculovirus p35 gene has been identified in very few baculoviruses (Clem et al., 1991
; Kamita et al., 1993
), while the iap genes have been identified in all baculoviruses studied to date, and in insect iridescent viruses (Crook et al., 1993
). The role of the viral iap genes was determined by functional replacement of the p35 gene of AcMNPV with an iap gene from the granulovirus of Cydia pomonella (CpGV) (Crook et al., 1993
). Subsequently, an iap gene from Orgyia pseudotsugata nucleopolyhedrovirus (OpMNPV) has been identified as an active inhibitor of apoptosis (Birnbaum et al., 1994
).
Most NPVs carry multiple genes that have the characteristic iap motifs of baculovirus inhibitor repeats (BIRs) and a RING finger domain, yet functionality has only been shown for the two iaps described above (Crook et al., 1993
; Birnbaum et al., 1994
). The domain requirements of IAPs are variable. Mammalian cellular IAPs have been shown not to require a RING finger domain for functionality (Roy et al., 1997
), unlike invertebrate IAPs of both cellular and viral origin, which require this domain to be active (Clem & Miller, 1994
; Huang et al., 2000
; Seshagiri et al., 1999
).
There is very little information on what apoptotic pathways IAPs can block. Recent evidence that an IAP from OpMNPV can block apoptosis in mammalian cells (Hawkins et al., 1996
), combined with the similarity to IAPs from the cells of vertebrate organisms, suggests that IAPs target a universal point(s) in apoptosis. The importance of iap genes has been reinforced by the discovery of cellular homologues of baculovirus iaps in a variety of mammalian (Liston et al., 1996
), dipteran (Hay et al., 1995
) and avian (You & Bose, 1998
) cells.
In this paper, we investigate the iap genes identified on the EppoMNPV genome and their ability to function as inhibitors of apoptosis. The ability of the IAPs to block multiple apoptosis pathways and the requirement of additional genes to produce an active IAP were investigated.
| Methods |
|---|
|
|
|---|
Cells and viruses.
CpGV iap and Bombyx mori NPV p35.
The iap gene from CpGV was kindly supplied as plasmid pSB490 by L. Miller (Departments of Genetics and Entomology, The University of Georgia, Athens, GA, USA) and the Bombyx mori NPV p35 gene (Kamita et al., 1993
) was kindly supplied by S. Maeda (Department of Entomology, University of California, Davis, CA, USA).
Cloning and sequencing.
Screening of restriction enzyme libraries of EppoMNPV DNA was performed as described by Hyink et al. (1998
). Sequencing of the termini of HindIII and EcoRI restriction fragment clones was used to identify homologues of iap-2 and iap-4 genes by BLAST searching of the GenBank database (Altschul et al., 1997
). Based upon comparison of the genetic maps of EppoMNPV (Hyink et al., 1998
) and OpMNPV (Ahrens et al., 1997
), the presence of an iap-1 gene and an iap-3 gene was predicted on HindIII fragment A. The HindIII-A fragment was subcloned in pBluescriptII SK+ and screened by sequencing for the presence of iap homologues. All four iap-containing clones were fully sequenced using an ABI 377 automated sequencer at the Centre for Gene Research, University of Otago. Analysis of derived sequences was performed using the Lasergene suite of DNA analysis programs (DNAStar). Alignment of IAP sequences was performed using the Clustal V algorithm (Higgins & Sharp, 1988
) and the phylogeny was determined using PHYLIP (Felsenstein, 1995
). The reliability of the phylogeny was estimated by BOOTSTRAP analysis using 100 datasets.
Induction of apoptosis.
Sf-21 cells were treated with actinomycin D at a final concentration of 2 µg/ml, anisomycin (50 µg/ml), cycloheximide (100 µg/ml), tumour necrosis factor-
(TNF
; 0·1 µg/ml) plus cycloheximide (5 µg/ml), or 5,6-dichloro-1-
-D-ribofuranosylbenzimidazole (DRB; 50 µg/ml) for 18 h at 28 °C. Apoptosis induction by cycloheximide was also performed in Sf900-II medium that had been supplemented with 10% foetal calf serum (GIBCO BRL Life Technologies). All chemicals were obtained from Sigma. Apoptosis was induced by exposure of Sf-21 cells to UV irradiation by inverting 6-well tissue culture plates, from which the medium had been removed, onto a standard laboratory transilluminator (Ultra Violet Products) for 15 s. The medium was then replaced.
Analysis of apoptosis.
Sf-21 cell monolayers in 35 mm dishes were treated with 200 µl of lysis buffer (10 mM Tris pH 7·5, 25 mM EDTA, 0·2% Triton X-100) (Cartier et al., 1994
) for 1 h at room temperature. The lysate was extracted once with phenol, once with phenol/chloroform, twice with chloroform, then alcohol-precipitated. The precipitate was centrifuged at 14000 r.p.m. for 5 min then washed with 70% alcohol and dried at 37 °C. The DNA was redissolved in 20 µl RNase A (50 µg/ml in water) and the total volume was electrophoresed on 1% agarose LE (Roche) gels in TAE buffer. DNA was visualized by ethidium bromide staining and UV illumination. To quantify the anti-apoptotic effect of anti-apoptotic genes, cell monolayers were stained with 0·04% trypan blue and cell viability was scored using an inverted light microscope. For each treatment, five fields of view were scored.
Inhibition of chemical- and UV-induced apoptosis.
The iap genes were obtained as clones in the plasmid pBluescriptII SK+ as shown in Fig. 1
. Plasmid DNA was prepared for transfection using anion resin-exchange columns (Qiagen). Sf-21 cells (1·5x106 cells per 35 mm diameter well) were transfected with 2 µg of plasmid DNA using Cellfectin (GIBCO BRL Life Technologies) or FuGENE 6 (Roche) following the manufacturers protocols and the plates were incubated for 1824 h at 28 °C. The inducing chemical was then added to each well, or the cells were UV-irradiated to induce apoptosis, and the plates were incubated for 18 h or 30 h. Total cytoplasmic DNA was then extracted as described above and tested for oligonucleosome ladder formation by electrophoresis in 1% agarose.
|
Confirmation of iap-2 as an apoptosis inhibitor gene.A further construct, designated orf69(RF-), was made in which the 3' end of clone 898iap-2 was removed to eliminate the RING finger motif from the iap-2 gene, leaving the orf69 homologue as the only complete gene in the clone. Clone 898iap-2 was digested with BglII, which has a recognition site 223 bp inside the 3' end of the iap-2 gene, and BamHI, which cuts in the multiple cloning site of pBluescriptII SK+. The plasmid was recircularized by ligation with T4 DNA ligase.
The iap-2 gene was subcloned into the expression vector pCMV·SPORT (GIBCO BRL Life Technologies). The gene was amplified by PCR using the universal forward primer and a primer complementary to the 5' end of the iap-2 gene (5' GAATGGATCCCTAAGCATGGATTTGCAAAAGT 3'). This primer contained a BamHI restriction site (underlined) and the ATG start codon (bold). The PCR product was digested with BamHI and HindIII and then ligated into BamHI- and HindIII-digested pCMV·SPORT.
All clones were transformed into E. coli strain DH5
and screened by standard protocols. All PCR-derived clones were sequenced to ensure that no PCR errors had occurred. The ability of each construct to inhibit apoptosis was determined as described above using 2 µg of plasmid per transfection.
Confirmation of iap-1 as an apoptosis inhibitor gene.
An analogous approach was taken with the iap-1-containing clone iap-1/42, which contained a homologue of OpMNPV orf42. Primer TM59 (5' TTCAACTCGGTCAAATGCGCG 3') was paired with the universal reverse primer to generate the iap-1 gene plus 302 bp of upstream sequence from the clone iap-1/42 by PCR. The PCR product was cloned into pBluescript SK- and designated as 302iap-1. The clone contained the iap-1 gene as the only complete gene and was tested as described above.
Nucleotide sequence accession numbers.
The GenBank accession numbers are: iap-1,AF119227; iap-2,AF037358; iap-3, AF180757; iap-4, AF119228.
| Results |
|---|
|
|
|---|
The HindIII-T clone contained the iap-2 gene and three other open reading frames (ORFs; Fig. 1a
). A partial homologue of lef3 was identified, as was a complete ORF with 69% amino acid identity to OpMNPV orf73 (61% identity to AcMNPV orf68). A complete gene with 57% identity to AcMNPV orf69 was also present. There is no homologue of AcMNPV orf69 in OpMNPV. The gene order in this region of the genome was identical to AcMNPV but not to OpMNPV.
The 2·1 kb XbaIKpnI subclone (clone iap-1/42) contained three ORFs in addition to the iap-1 gene (Fig. 1b
). A homologue to baculovirus lef6 genes was located downstream of the iap-1 gene. BLAST analysis of the 70 amino acids present in the clone showed the closest similarity to the first 70 amino acids of the OpMNPV lef6 gene. A complete ORF of 127 amino acids located upstream of the iap-1 gene showed 62% and 52% identity to orf42 of OpMNPV and orf26 of AcMNPV respectively. A partial gene sequence representing 237 amino acids of a homologue of OpMNPV orf43 (AcMNPV orf25) was present upstream of the orf42 homologue. The order of the genes surrounding iap-1 is identical to that found in OpMNPV (Ahrens et al., 1997
).
The iap-3 ORF was the only complete ORF on the 1·787 kb MluI subclone (Fig. 1c
). Flanking the iap-3 gene were two partial ORFs with similarity to OpMNPV fgf (119 amino acids) and OpMNPV orf36 (155 amino acids). The gene content and arrangement of this region of the EppoMNPV genome is different to that of OpMNPV (Ahrens et al., 1997
).
The iap-4 gene was the only complete ORF on the EcoRI-N clone. A 168 amino acid partial ORF upstream of the iap-4 gene was similar to OpMNPV orf107.
IAPs fall into distinct homology groups
The IAP-1 protein of EppoMNPV is a 284 amino acid protein that has a predicted molecular mass of 32550 Da, with 71% and 59% identity to OpMNPV IAP-1 and AcMNPV IAP-1 respectively. The IAP-2 protein contains 239 amino acids (27363 Da), with 63% and 57% identity to OpMNPV IAP-2 and AcMNPV IAP-2 respectively. The IAP-3 protein is a 261 amino acid protein (29981 Da) with a sequence identity of 56% to OpMNPV IAP-3. IAP-4 is a 141 amino acid protein (15932 Da) with 51% identity to the IAP-4 of OpMNPV. An alignment and phylogenetic analysis of the IAP-1, IAP-2 and IAP-3 proteins of baculoviruses is presented in Fig. 2
. The IAPs fall into distinct groups (Fig. 2b
). The only exception to the clustering of IAP types is Buzura suppressaria NPV IAP-1, which was named by order on the viral genome rather than sequence homology (Hu et al., 1998
). IAP-4s were not included because none have been shown to be active, so there is no evidence, other than sequence homology, that these are indeed inhibitors of apoptosis. Two BIRs are present in the IAP-1, IAP-2 and IAP-3 proteins (Fig. 2a
). Comparison with other IAPs showed a conserved BIR motif of GX911CX2CX810E/DX5HX36C. A characteristic C3HC4 RING finger motif is also present in the IAP-1, IAP-2 and IAP-3 proteins (Fig. 2a
). Analysis of the IAP-4 protein showed only one BIR region and the RING finger motif.
|
was not expected. Supplementation of the serum-free Sf900-II medium with 10% foetal calf serum prevented the induction of apoptosis by cycloheximide. The induction of apoptosis by TNF
required the presence of a low level of cycloheximide; however, the dose of 5 µg/ml cycloheximide used to potentiate the TNF
response did not cause apoptosis in the absence of TNF
(data not shown).
|
-galactosidase and staining of the cells with X-Gal (data not shown). The activity of the promoter in Sf-21 cells was also confirmed with the manufacturer (Life Technologies) of pCMV·SPORT.
|
|
EppoMNPV IAP-3 and IAP-4 are not functional
IAP-3 and IAP-4 were not found to block apoptosis induced by actinomycin D (Fig. 4d
, e
). The use of a CMV promoter, which had been shown to work for the iap-2 gene (see above), did not produce an active iap-3 gene. The iap-4 gene was not tested with a CMV promoter. Subsequent analysis showed no inhibition of apoptosis for any of the inducing agents used in this study for either the iap-3 gene or the iap-4 gene (Table 1
).
| Discussion |
|---|
|
|
|---|
When only 330 bp of sequence was present upstream of the iap-2 gene, the iap-2 gene was not functional. The iap-2 gene was functional when the orf69 gene homologue and a possible promoter region were located upstream. Removal of the RING finger motif from iap-2 abolished anti-apoptotic activity, confirming both the role of EppoMNPV iap-2 and the essential requirement for a RING finger motif in baculoviral IAPs. The use of a CMV promoter to express the iap-2 gene confirmed the functionality of IAP-2 and suggests that the orf69 homologue has a role in expression of iap-2. A recent study by Li et al. (1999
) has shown that orf69 of AcMNPV can function as an activator of gene expression. An alternative explanation is that iap-2 promoter sequences lie in the region between 898 and 330 bp upstream of the iap-2 gene, within orf69.
Comparison of the iap-1, iap-2 and iap-3 genes showed that they fall into distinct homology classes and that the naming of new IAPs should be based upon gene homologies rather than order within a viral genome. The homology groupings and the presence of multiple iaps on NPV genomes suggest a requirement for different iaps. As far as the authors know, this is the first report of anti-apoptosis activity for iap-1 and iap-2 genes. That these genes do possess anti-apoptosis activity suggests that this is likely to be their primary function. Given the broad range of anti-apoptotic activity demonstrated in this paper, the different iaps are more likely to be needed for different cells, tissues and hosts than for the inhibition of different stimuli. The iap genes that have been demonstrated as active from baculoviruses other than EppoMNPV cluster in the iap-3 group of iap genes. It is likely that the apparent lack of an active iap-3 gene in EppoMNPV is compensated by the activity of the iap-1 and iap-2 genes. EppoMNPV does not grow in Sf-21 cells (K. Caradoc-Davies, personal communication) and this study indicates that an active iap is unlikely to be a host range determinant for EppoMNPV infection of Sf-21 cells.
The induction of Sf-21 cell apoptosis by the RNA synthesis inhibitors actinomycin D, DRB and anisomycin has been reported previously (Clem & Miller, 1994
). These transcription inhibitors have distinct modes of action (White & Phillips, 1988
; Zandomeni et al., 1983
), but would be expected to initiate the same or a very similar apoptotic signalling pathway. What was surprising was the induction by cycloheximide and TNF
. Clem & Miller (1994
) reported that cycloheximide does not induce apoptosis in Sf-21 cells. The study of Clem & Miller (1994
) employed cells in serum-containing medium. The addition of 10% serum to the Sf900-II medium prevented the induction of apoptosis in Sf-21 cells by cycloheximide. Cycloheximide-induced apoptosis has also been observed for Choristoneura fumiferana (CF-203) cells (Palli et al., 1996
). The induction by TNF
suggests the presence of a TNFR-like protein on the surface of the Sf-21 cell and the presence of a signalling pathway that may be analogous to that involving the death domain proteins such as RIP, TRAFF and caspase-8 in mammalian cells. The human cellular IAPs have been reported to interact with these death domain proteins (Rothe et al., 1995
; Uren et al., 1996
); however, it appears that mammalian IAPs are distinct from invertebrate cellular and viral IAPs. In particular, mammalian IAPs do not require a RING finger motif for activity and interact directly with caspase-3 to prevent apoptosis (Deveraux et al., 1997
; Roy et al., 1997
), rather than preventing terminal caspase activation as shown for invertebrate IAPs (Huang et al., 2000
; Manji et al., 1997
; Seshagiri & Miller, 1997
; Seshagiri et al., 1999
). Despite these differences, some invertebrate IAPs are active in mammalian cells. Hawkins et al. (1996
) have shown that OpMNPV IAP-3 is active in mammalian cells and the recent study of Huang et al. (2000
) showed that invertebrate IAPs can inhibit mammalian caspase-9, which is involved in the activation of terminal caspases. Huang et al. (2000
) predicted that SfIAP and CpIAP target a caspase-9-like protease in S. frugiperda cells to prevent the activation of Sf-caspase-1. These data support the conservation that is evident between the apoptosis systems of metazoans, allowing comparison with mammalian systems for elucidating the function of baculovirus IAPs.
It has been suggested that caspases are an amplification system that accelerates the cell death response (Li et al., 1997
; Liu et al., 1996
). In mammalian cells, most apoptosis signals converge to cause the release of cytochrome c from mitochondria, which in turn contributes to apoptosome formation and the activation of caspase-9, followed by the subsequent activation of caspase-3 (Green & Kroemer, 1998
). The ability of EppoMNPV IAP-2 to block apoptosis induced by an array of induction signals that in mammalian cells converge at the mitochondrion, suggests that IAP-2 functions after the signals have converged. If an analogy is made to mammalian cells then the target of IAP-2 must be associated with the mitochondria, the apoptosome, or the direct activation of effector caspases. Seshagiri & Miller (1997
) have shown that at least one baculoviral IAP functions upstream of Sf-caspase-1 and Duckett et al. (1998
) have proposed that the human IAP-like protein regulates apoptosis downstream of the mitochondrion. The paper by Huang et al. (2000
) supports this theory.
One proposed theory of caspase amplification is that caspases interact with the mitochondrion in a cyclical amplification (Green & Kroemer, 1998
). A consequence of this theory would be that direct inhibition of caspases that interact with the mitochondrion would lead to a delay in apoptosis but not a prevention of apoptosis. The delay in apoptosis caused by IAP-1 is such a response. IAP-1 may interfere with a caspase/mitochondrion amplification loop, although care must be taken when comparing invertebrate and mammalian cells.
This paper has presented the first evidence that iap-1 and iap-2 genes of baculoviruses can function as inhibitors of apoptosis. The paper also shows that these inhibitors can function against a wide array of apoptosis inducers that can be expected to trigger multiple initiator pathways of apoptosis, and provides insights into the mode of action of IAPs.
| Acknowledgments |
|---|
| References |
|---|
|
|
|---|
Altschul, S. F., Madden, T. L., Schaffer, A. A., Zhang, J., Zhang, Z., Miller, W. & Lipman, D. J.(1997). Gapped BLAST and PSI-BLAST: a new generation of protein database search programs.Nucleic Acids Research25, 3389-3402.
Barr, P. J. & Tomei, L. D.(1994). Apoptosis and its role in human disease.Bio/technology12, 487-493.[Medline]
Birnbaum, M. J., Clem, R. J. & Miller, L. K.(1994). An apoptosis-inhibiting gene from a nuclear polyhedrosis virus encoding a polypeptide with cys/his sequence motifs.Journal of Virology68, 2521-2528.
Bump, N. J., Hackett, M., Hugunin, M., Seshagiri, S., Brady, K., Chen, P., Ferenz, C. S., Franklin, C., Ghayur, T., Li, P., Licari, P., Mankovich, J., Shi, L., Greenberg, A. H., Miller, L. K. & Wong, W. W.(1995). Inhibition of ICE family proteases by baculovirus antiapoptotic protein P35.Science269, 1885-1888.
Cartier, J. L., Hershberger, P. A. & Friesen, P. D.(1994). Suppression of apoptosis in insect cells stably transfected with baculovirus p35: dominant interference by N-terminal sequences p35176.Journal of Virology68, 7728-7737.
Clem, R. J. & Miller, L. K.(1994). Control of programmed cell death by the baculovirus genes p35 and iap.Molecular and Cellular Biology14, 5212-5222.
Clem, R. J., Fechheimer, M. & Miller, L. K.(1991). Prevention of apoptosis by a baculovirus gene during infection of insect cells.Science254, 1388-1390.
Crook, N. E., Clem, R. J. & Miller, L. K.(1993). An apoptosis-inhibiting baculovirus gene with a zinc finger-like motif.Journal of Virology67, 2168-2174.
Deveraux, Q. L., Takahashi, R., Salvesen, G. S. & Reed, J. C.(1997). X-linked IAP is a direct inhibitor of cell-death proteases.Nature388, 300-304.[Medline]
Du, Q., Lehavi, D., Faktor, O., Qi, Y. & Chejanovsky, N.(1999). Isolation of an apoptosis suppressor gene of the Spodoptera littoralis nucleopolyhedrovirus.Journal of Virology73, 1278-1285.
Duckett, C. S., Li, F., Wang, Y., Tomaselli, K. J., Thompson, C. B. & Armstrong, R. C.(1998). Human IAP-like protein regulates programmed cell death downstream of Bcl-xL and cytochrome c.Molecular and Cellular Biology18, 608-615.
Felsenstein, J. (1995). PHYLIP (Phylogeny Inference Package), version 3.5c. Distributed by the author. Department of Genetics, University of Washington, USA.
Green, D. & Kroemer, G.(1998). The central executioners of apoptosis: caspases or mitochondria?Trends in Cell Biology8, 267-271.[Medline]
Hawkins, C. J., Uren, A. G., Hacker, G., Medcalf, R. L. & Vaux, D. L.(1996). Inhibition of interleukin 1
-converting enzyme-mediated apoptosis of mammalian cells by baculovirus IAP.Proceedings of the National Academy of Sciences, USA93, 13786-13790.
Hay, B. A., Wasserman, D. A. & Rubin, G. M.(1995). Drosophila homologs of baculovirus inhibitor of apoptosis proteins function to block cell death.Cell83, 1253-1262.[Medline]
Higgins, D. G. & Sharp, P. M.(1988). CLUSTAL: a package for performing multiple sequence alignment on a microcomputer.Gene73, 237-244.[Medline]
Hu, Z. H., Arif, B. M., Jin, F., Martens, J. W. M., Chen, X. W., Sun, J. S., Zuidema, D., Goldbach, R. W. & Vlak, J. M.(1998). Distinct gene arrangement in the Buzura suppressaria single-nucleocapsid nucleopolyhedrovirus genome.Journal of General Virology79, 2841-2851.[Abstract]
Huang, Q., Deveraux, Q. L., Maeda, S., Slavesan, G. S., Stennicke, H. R., Hammock, B. D. & Reed, J. C.(2000). Evolutionary conservation of apoptosis mechanisms: lepidopteran and baculoviral inhibitor of apoptosis proteins are inhibitors of mammalian caspase-9.Proceedings of the National Academy of Sciences, USA97, 1427-1432.
Hyink, O., Graves, S., Fairbairn, F. M. & Ward, V. K.(1998). Mapping and polyhedrin gene analysis of the Epiphyas postvittana nucleopolyhedrovirus genome.Journal of General Virology79, 2853-2862.[Abstract]
Jiang, C., Baehrecke, E. H. & Thummel, C. S.(1997). Steroid regulated programmed cell death during Drosophila metamorphosis.Development124, 4673-4683.[Abstract]
Kamita, S. G., Majima, K. & Maeda, S.(1993). Identification and characterisation of the p35 gene of Bombyx mori nuclear polyhedrosis virus that prevents virus-induced apoptosis.Journal of Virology67, 455-463.
Li, P., Nijhawan, D., Budihardjo, I., Srinivasula, S. M., Ahmad, M., Alnemri, E. S. & Wang, X.(1997). Cytochrome c and dATP-dependent formation of Apaf-1/caspase-9 complex initiates an apoptotic protease cascade.Cell91, 479-489.[Medline]
Li, L., Harwood, S. H. & Rohrmann, G. F.(1999). Identification of additional genes that influence baculovirus late gene expression.Virology255, 9-19.[Medline]
Liston, P., Roy, N., Tamal, K., Lefebvre, C., Baird, S., Cherton-Horvat, G., Farahani, R., McLean, M., Ikeda, J.-E., MacKenzie, A. & Korneluk, R. G.(1996). Suppression of apoptosis in mammalian cells by NAIP and a related family of IAP genes.Nature379, 349-353.[Medline]
Liu, X., Kim, C. N., Yang, J., Jemmerson, R. & Wang, X.(1996). Induction of apoptotic program in cell free extracts: requirement for dATP and cytochrome c.Cell86, 147-157.[Medline]
Manji, G. A., Hozak, R. R., LaCount, D. J. & Friesen, P. D.(1997). Baculovirus inhibitor of apoptosis functions at or upstream of the apoptotic suppressor P35 to prevent programmed cell death.Journal of Virology71, 4509-4516.
Miller, L. K.(1997). Baculovirus interaction with host apoptotic pathways.Journal of Cellular Physiology173, 178-182.[Medline]
OBrien, V.(1998). Viruses and apoptosis.Journal of General Virology79, 1833-1845.[Medline]
Palli, S. R., Sohi, S. S., Cook, B. J., Brownwright, A. J., Caputo, G. F. & Retnakaran, A.(1996). RNA- and protein-synthesis inhibitors induce apoptosis in a midgut cell line from the spruce budworm Choristoneura fumiferana.Journal of Insect Physiology42, 1061-1069.
Rothe, M., Pan, M.-G., Henzel, W. J., Ayres, T. M. & Goeddel, D. V.(1995). The TNFR2TRAF signalling complex contains two novel proteins related to baculoviral inhibitor of apoptosis proteins.Cell83, 1243-1252.[Medline]
Roy, N., Deveraux, Q. L., Takahashi, R., Salvesen, G. S. & Reed, J. C.(1997). The c-IAP-1 and c-IAP-2 proteins are direct inhibitors of specific caspases.EMBO Journal16, 6914-6925.[Medline]
Seshagiri, S. & Miller, L. K.(1997). Baculovirus inhibitors of apoptosis (IAPs) block activation of Sf-caspase-1.Proceedings of the National Academy of Sciences, USA94, 13606-13611.
Seshagiri, S., Vucic, D., Lee, J. & Dixit, V. M.(1999). Baculovirus-based genetic screen for antiapoptotic genes identifies a novel IAP.Journal of Biological Chemistry274, 36769-36773.
Steller, H. & Grether, M. E.(1994). Programmed cell death in Drosophila.Neuron13, 1269-1274.[Medline]
Thompson, C. B.(1995). Apoptosis in the pathogenesis and treatment of disease.Science267, 1456-1462.
Tschopp, J., Thome, M., Hofmann, K. & Meinl, E.(1998). The fight of viruses against apoptosis.Current Opinion in Genetics & Development8, 82-87.
Ucker, D. S.(1991). Death by suicide: one way to go in mammalian cellular development?New Biology3, 103-109.
Uren, A. G., Pakusch, M., Hawkins, C. J., Puls, C. J. & Vaux, D. L.(1996). Cloning and expression of apoptosis inhibitory protein homologs that function to inhibit apoptosis and/or bind tumor necrosis factor receptor-associated factors.Proceedings of the National Academy of Sciences, USA93, 4974-4978.
Vaughn, J. L., Goodwin, R. H., Tompkins, G. J. & McCawley, P.(1977). The establishment of two cell lines from the insect Spodoptera frugiperda (Lepidoptera: Noctuidae).In Vitro13, 213-217.[Medline]
White, R. J. & Phillips, D. R.(1988). Transcriptional analysis of multisite drugDNA dissociation kinetics: delayed termination of transcription by actinomycin D.Biochemistry27, 9122-9132.[Medline]
You, M. & Bose, H. R. J.(1998). Identification of v-Rel oncogene-induced inhibitor of apoptosis by differential display.Methods16, 373-385.[Medline]
Zandomeni, R., Bunick, D., Ackerman, S., Mittleman, B. & Weinmann, R.(1983). Mechanism of action of DRB. III. Effect on specific in vitro initiation of transcription.Journal of Molecular Biology167, 561-574.[Medline]
Received 17 April 2000;
accepted 27 July 2000.
This article has been cited by other articles:
![]() |
Q. Yu, T. Lin, G. Feng, K. Yang, and Y. Pang Functional analysis of the putative antiapoptotic genes, p49 and iap4, of Spodoptera litura nucleopolyhedrovirus with RNAi J. Gen. Virol., August 1, 2008; 89(8): 1873 - 1880. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. Westphal, E. C. Ledgerwood, M. H. Hibma, S. B. Fleming, E. M. Whelan, and A. A. Mercer A Novel Bcl-2-Like Inhibitor of Apoptosis Is Encoded by the Parapoxvirus Orf Virus J. Virol., July 1, 2007; 81(13): 7178 - 7188. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. J. Hartley, D. R. Greenwood, R. J. C. Gilbert, A. Masoumi, K. H. J. Gordon, T. N. Hanzlik, E. E. Fry, D. I. Stuart, and P. D. Scotti Kelp Fly Virus: a Novel Group of Insect Picorna-Like Viruses as Defined by Genome Sequence Analysis and a Distinctive Virion Structure J. Virol., November 1, 2005; 79(21): 13385 - 13398. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. G. de Jong, H. A. M. Lauzon, C. Dominy, A. Poloumienko, E. B. Carstens, B. M. Arif, and P. J. Krell Analysis of the Choristoneura fumiferana nucleopolyhedrovirus genome J. Gen. Virol., April 1, 2005; 86(4): 929 - 943. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. A. M. Lauzon, C. J. Lucarotti, P. J. Krell, Q. Feng, A. Retnakaran, and B. M. Arif Sequence and Organization of the Neodiprion lecontei Nucleopolyhedrovirus Genome J. Virol., July 1, 2004; 78(13): 7023 - 7035. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Garcia-Maruniak, J. E. Maruniak, P. M. A. Zanotto, A. E. Doumbouya, J.-C. Liu, T. M. Merritt, and J. S. Lanoie Sequence Analysis of the Genome of the Neodiprion sertifer Nucleopolyhedrovirus J. Virol., July 1, 2004; 78(13): 7036 - 7051. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. C. Means, I. Muro, and R. J. Clem Silencing of the Baculovirus Op-iap3 Gene by RNA Interference Reveals that It Is Required for Prevention of Apoptosis during Orgyia pseudotsugata M Nucleopolyhedrovirus Infection of Ld652Y Cells J. Virol., April 15, 2003; 77(8): 4481 - 4488. [Abstract] [Full Text] [PDF] |
||||
![]() |
O. Hyink, R. A. Dellow, M. J. Olsen, K. M. B. Caradoc-Davies, K. Drake, E. A. Herniou, J. S. Cory, D. R. O'Reilly, and V. K. Ward Whole genome analysis of the Epiphyas postvittana nucleopolyhedrovirus J. Gen. Virol., April 1, 2002; 83(4): 957 - 971. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Luque, R. Finch, N. Crook, D. R. O'Reilly, and D. Winstanley The complete sequence of the Cydia pomonella granulovirus genome J. Gen. Virol., October 1, 2001; 82(10): 2531 - 2547. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| INT J SYST EVOL MICROBIOL | MICROBIOLOGY | J GEN VIROL |
| J MED MICROBIOL | ALL SGM JOURNALS | |