|
|
||||||||
Animal: RNA Viruses |
Department of Virology, Haartman Institute, University of Helsinki, FIN-00014 Helsinki, Finland1
Department of Forest Ecology, Finnish Forest Research Institute, FIN-01301 Vantaa, Finland2
Department of Anatomy, Faculty of Veterinary Medicine, University of Helsinki, FIN-00581, Helsinki, Finland3
Department of Clinical Microbiology, Aarhus University Hospital, 8000 Aarhus, Denmark4
Danish Pest Infestation Laboratory, 2800 Lyngby, Copenhagen, Denmark5
Author for correspondence: Alexander Plyusnin. Fax +358 9 1912 6491. e-mail Alexander.Plyusnin{at}Helsinki.Fi
| Abstract |
|---|
|
|
|---|
| Introduction |
|---|
|
|
|---|
The bank vole is found in central Europe and most parts of Fennoscandia (this collective term is used for Finland and Scandinavia) and western Russia, excluding the northern-most parts of Lapland (Mitchell-Jones et al., 1999
). Two types of bank voles, northern and southern, can be distinguished in Fennoscandia; the mtDNA of the northern population originated from a different species, the red vole (Clethrionomys rutilus). It is assumed that the mtDNA transfer took place 800013000 years ago during the post-glacial recolonization of Fennoscandia by a plethora of plant and animal species (Tegelström, 1987
). While retreating from Fennoscandia, the Late Weichselian continental glacier left two potential immigration routes for animals and plants to recolonize the uncovered land. The southern route was via present Denmark and southern Sweden (when there was a land connection between them), while the eastern route was via present Russia and Finland. The northern and the southern populations of bank voles met in central Sweden, forming a contact zone, which is still approximately 50 km wide; similar contact zones for the field vole (Microtus agrestis)and common shrew (Sorex araneus) were found in the same area (for a review, see Jaarola et al., 1999
). Notably, PUUV strains carried by bank voles north and south of the contact zone form two distinct phylogenetic lineages (Hörling et al., 1996
; Lundkvist et al., 1998
), thus supporting the hypothesis of a hantavirushost co-evolution (Plyusnin et al., 1996
; Morzunov et al., 1998
; Vapalahti et al., 1999
).
In this study, we have analysed wild-type (wt) PUUV strains originating from Russian Karelia and Denmark, locations along the two postulated recolonization routes to Fennoscandia after the last ice age. Our aim was to learn about the relationships of these strains and known phylogenetic lineages of PUUV from Europe.
| Methods |
|---|
|
|
|---|
Rodents.
|
RTPCR, cloning and sequencing.
RNA isolation, RTPCR and cloning were done as described previously (Plyusnin et al., 1994
). Briefly, total RNA was isolated from the tissue samples by the acid guanidinium thiocyanatephenolchloroform method of Chomczynski & Sacchi (1987)
. Full-length S segment cDNAs were synthesized with Superscript (Bethesda Research Laboratories) or AMV (Boehringer Mannheim) reverse transcriptase in the presence of primer 5' TAGTAGTA(G/T)(A/G)C 3' and random hexamers. PCR was done with a single primer 5' TTCTGCAGTAGTAGTAGACTCCTTGAAAAG 3' and the PCR products corresponding to the full-length S segment (
1830 nt) were cloned into the pGEM-T plasmid vector with a TA cloning kit (Promega) using the procedure recommended by the manufacturer. Plasmids were purified with a Wizard Mini-preps kit (Promega) or a QIAprep kit (QIAGEN) and sequenced with either Sequenase version 2.0 (Amersham Life Science) or automatically. In the latter case, sequencing was performed using either ABI PRISM Dye Terminator or ABI PRISM M13F and M13R Dye Primer sequencing kits (Perkin Elmer).
RT of the partial M segment was performed as described previously (Plyusnin et al., 1997
) with MMLV reverse transcriptase (Amersham) in the presence of primers A1 (5' AATCCATCTGAGGCTACACCGTCT 3', nt 17931816) and C2 (5' CCAACTCCTGAACCCCATGC 3', nt 30113030). PCR was done with the same primers, A1 and C2, and nested PCR was done using primers B1 (5' AACCCGGCAAATGAACAAGAA 3', nt 21472167) and B2 (5' TTGGTTGGAGAGGACCGAGGAAT 3', nt 26112632) for the Karelian samples and B3 [5' CA(A/G)TTACA(A/G)AA(T/C)CCIGC(C/A)AATGA 3', nt 21382160] and B4 (5' TGAAATTTTGAAACAGTTCCAA 3', nt 25712592) for the Danish samples. Amplified products were gel-purified using QIAquick Gel Extraction kit (QIAGEN) and sequenced automatically.
Multiple sequence alignments.
Alignments were prepared with ClustalX (Thompson et al., 1997
). The following options were used: gap opening, 15; gap extension, 6·66; delay divergent sequences, 40%; DNA transition weight, 0·50; no negative matrix. Minor corrections to the alignment were introduced manually using the SeqApp 1.9a169 sequence editing program (Gilbert, 1992
). Alignment of the partial M segment was done manually using SeqApp.
Phylogenetic analyses.
The GCG software package was used for sequence entry and analysis (version 10.1). The PHYLIP program package (Felsenstein, 1993
) was used to analyse the sequence data: 500 bootstrap replicates (Seqboot program) were fed to the distance matrix algorithm (Dnadist program, with Kimuras two-parameter option); distance matrices were analysed with either the FitchMargoliash or the Neighbour-joining tree fitting algorithms; the bootstrap support for the trees were calculated with the Consense program. The nucleotide sequence data were also analysed with maximum likelihood (DNAml) and maximum parsimony (DNApars) algorithms from the PHYLIP program (Felsenstein, 1993
).
The trees for deduced protein sequences were calculated by first translating the nucleotide sequences into amino acid (aa) sequences with SeqApp 1.9a169 (Gilbert, 1992
). Then the PHYLIP package (Felsenstein, 1993
) was used to make 500 bootstrap replicates which were fed to the distance matrix (Protdist) and maximum parsimony (Protpars) algorithms. Distance matrix data were analysed with a Neighbour-joining tree fitting algorithm. The bootstrap support was calculated with the Consense program.
For comparison, the following hantavirus sequences were used. (i) S segment/N protein: Puumala virus, strain Sotkamo (GenBank accession no. X61035), Evo/12Cg/93 (Z30702), Evo/13Cg/93 (Z30703), Evo/14Cg/93 (Z30704), Evo/15Cg/93 (Z30705), Virrat/25Cg/95 (Z69985), Puumala/1324Cg/79 (Z46942), Eidsvoll/1124v (AJ223368), Eidsvoll/Cg1138/87 (AJ223369), Sollefte
/Cg3/95 (AJ223376), Sollefte
/Cg6/95 (AJ223377), Hundberget/Cg36/95 (AJ223371), Mellansel/Cg47/94 (AJ223374), Mellansel/Cg49/95 (AJ223375), Tavelsjö/Cg81/94 (AJ223380), Vindeln/L20Cg/83 (Z48586), Vindeln/Cg4/94 (AJ223381), Vranica/Hällnäss (U14137), Udmurtia/338Cg/92 (Z30708), Udmurtia/444Cg/88 (Z30706), Udmurtia/458Cg/88 (Z30707), Udmurtia/894Cg/91 (Z21497), Kazan (Z84204), Cg1820 (M32750), P360 (L11347), Cg13891 (U22423), Tobetsu-60Cr-93 (AB010731) and Kamiiso-8Cr-95 (AB010730). Other hantaviruses: Tula virus strain Moravia02v (Z69991); Hantaan virus, strain 76-118 (M14626); Dobrava virus, strain Dobrava (L41916); Dobrava virus, strain Saaremaa/160V (AJ009773); Seoul virus, strain SR-11 (M34881); El Moro Canyon virus, strain RM-97 (U11427); New York virus, strain RI-1 (U11427); Sin Nombre virus, strain NM H10 (L25784); Bayou virus, strain Louisiana (L36929); Black Creek Canal virus (L39949); Laguna Negra virus, strain 510B (AF005727); Topografov virus, strain Ls136V (AJ011646); Khabarovsk virus, strain MF-43 (U35255); and Prospect Hill virus, strain PH-1 (Z49098). (ii) M segment/G2 protein: Puumala virus, strain Sotkamo (GenBank accession no. X61034), Virrat (Z70201), NE9/95 (Z69988), NE97-1 (AJ238141), NE97-2 (AJ238142), NE97-3 (AJ238143), NE97-6 (AJ238144), NE97-9 (AJ238145), NE10/95 (Z69990), Längemäki/126Cg/97 (AJ238139), Aitoo/84Cg/97 (AJ238140), Vranica/Hällnäs (U14136), VindelnL20 (Z49214), Kazan (Z84205), Bashkiria-Cg1820 (M29979), Cg 13891 (U22418), Cg-Erft (AJ238778). Other hantaviruses: Bayou virus, strain Louisiana (L36930); Black Creek Canal virus (L39950); El Moro Canyon virus, strain RM-97 (U26828); Laguna Negra virus, strain 510B (AF005728); Sin Nombre virus, strain NM H10 (L25783); New York virus, strain RI-1 (U36801); Blue River virus, strain Indiana (AF030551); Seoul virus, strain SR-11 (M34881); Dobrava virus, strain Saaremaa/160V (AJ009774); Dobrava virus, strain Dobrava (L33685); Hantaan virus, strain 76-118 (M14267); Thailand virus, strain 749 (L08756); Prospect Hill virus, strain PH-1 (Z55129); Tula virus, strain Moravia/5302v/95 (Z69993); Topografov virus, strain Topografov/Ls136V (AJ011646); and Khabarovsk virus, strain MF-43 (U35255).
Similarity plots.
These were created using Stuart Rays Simplot 2.5 (Lole et al., 1999
). The window size was 200 bp and the step size 20 bp. JukesCantor corrections were applied. S segment sequences of different PUUV strains were used as reference sequences or alternatively, consensus sequences of PUUV lineages were used. The query sequence was either one of the Danish sequences or a consensus query of the three Danish S segment sequences. Phylogenetic trees with 500 bootstrap replicates were calculated on regions showing highest similarities using programs from the PHYLIP package (Seqboot, Dnadist, Neighbour-joining and Consense).
| Results |
|---|
|
|
|---|
|
|
Pairwise comparison of PUUV sequences
These studies revealed that the Karelian strains showed highest similarity to Finnish strains (for supplementary data see http://vir.sgmjournals.org). For the S segment nt and N protein aa sequences the corresponding values were 9193% and 9699%. Other groups/lineages of PUUV strains showed nt identity of 7584% and aa identity of 9297%, the strains from Russia being most closely related to the Finnish and Karelian groups. The same was true for the M segment nt and G2 aa sequences, similarities between Karelian and Finnish strains were 8994% and 97100%. Similarly, other groups/lineages had lower identities to Karelian strains than to Finnish strains, and again, the Russian strains were most closely related. This is in line with observations on common sequence markers shared by the Karelian and Finnish groups of strains.
The Danish strains did not show a particularly close relatedness to any of the other PUUV groups: the highest nt identity observed with the Russian group was 78·2% (S segment) or 84·3% (M segment), suggesting a weaker evolutionary connection of the Fyn strains to other PUUV strains.
Phylogenetic analysis
The phylogenetic trees calculated for the complete coding region of the S segment (Fig. 3A
) and partial M segment sequences (Fig. 3B
) showed that PUUV strains form seven lineages: Finnish (FIN), S-SCA, N-SCA, Russian (RUS), Belgian (BEL), Japanese (JPN) and Danish (DAN), overall showing a typical geographical clustering of genetic variants. In agreement with the sequence comparison data (for supplementary data see http://vir.sgmjournals.org), Karelian strains were placed within the FIN lineage with high bootstrap support while Danish strains formed a distinct genetic lineage whatever algorithm [distant matrix (Fig. 3
), parsimony or maximum likelihood (not shown)] was used to infer phylogenies from the nucleotide sequences. The same was seen for the phylogenetic trees calculated on the basis of N or G2 aa sequences (not shown).
|
. Furthermore, the corresponding phylogenetic tree placing strain Fyn19 together with the Eidsvoll strain received higher bootstrap support (60%, Fig. 4D
|
| Discussion |
|---|
|
|
|---|
The Danish PUUV strains showed no particularly close similarity to any of the known PUUV strains and formed a distinct phylogenetic lineage on trees calculated for both S and M segment sequences. Thus, no direct link between the Danish PUUV strains and those of the S-SCA lineage was found, suggesting that in this case, too, ancestor(s) of the lineage may have been extirpated from the migration route by more successful variant(s).
Interestingly, within the S segment of Danish PUUV strains we have found two regions with higher than average similarity to members of N-SCA or, to a lesser extent, S-SCA genetic lineages (Fig. 4
). An earlier study (Hörling et al., 1996
) has clearly shown that the N-SCA and S-SCA lineages of PUUV are associated with two distinct bank vole populations. This supports a bi-directional scenario of PUUV spreading into Fennoscandia with bank voles from different glacial refugia populations that had met in central Sweden to form a narrow contact zone. However, some recent findings indicate that the phylogeographical pattern of the bank vole is perhaps not that simple, the Danish population belonging to the north-eastern lineage and not to the southern lineage (Jaarola et al., 1999
). The issue has been complicated even more by the finding of southern and reassortant types of PUUV in the north-east lineage of bank voles in Russia (Morzunov et al., 1999
). Taking into consideration these new data, one can hypothesize that the sequence similarities observed between the Danish PUUV strains on the one side, and N-SCA or S-SCA strains on the other, reflect the evolutionary relationships of their direct precursor(s). Our findings of a mosaic-like structure of the S segment of the Danish lineage may be interpreted as an indication of recombination event(s) that occurred between precursors of these three lineages. Another possible reason for these dissimilarities might be that different portions of the genome of a common ancestor have been selectively preserved, depending on a different genetic background (created via genetic drift of the virus), in such a way that one portion of the genome had happened to be preserved better in lineages A and B, another in lineages B and C, etc.
In general, the phylogeny of known PUUV genetic lineages from Fennoscandia, as well as those from Russia, Belgium and Japan, looks star-like (all lineages are radiated from the single spot); thus their more intimate evolutionary relationships still remain obscure and await further investigation. Analyses of PUUV strains in postulated areas of glacial refugia in southern Europe will be crucial in further understanding these evolutionary relationships.
| Acknowledgments |
|---|
| Footnotes |
|---|
b Present address: Department of Biology, University of California, San Diego, La Jolla, CA 92093-0116, USA. ![]()
| References |
|---|
|
|
|---|
Chomczynski, P. & Sacchi, N.(1987). Single-step method of RNA isolation by acid guanidinium thiocyanatephenolchloroform extraction.Analytical Biochemistry162, 156-159.[Medline]
Elliott, R. M., Schmaljohn, C. S. & Collett, M. S.(1991). Bunyaviridae genome structure and gene expression.Current Topics in Microbiology169, 91-141.
Felsenstein, J. (1993). PHYLIP: Phylogeny inference package, version 3.5c. University of Washington, Seattle, WA, USA. Available at http://www.ibb.waw.pl/docs/PHYLIPdoc/.
Gilbert, D. G. (1992). SeqApp: a biosequence editor and analysis application. Available at http://iubio.bio.indiana.edu/IUBio-Software+Data/molbio/seqapp/.
Hörling, J., Lundkvist,
., Jaarola, M., Plyusnin, A., Tegelström, H., Persson, K., Lehväslaiho, H., Hörnfeldt, B., Vaheri, A. & Niklasson, B.(1996). Distribution and genetic heterogeneity of Puumala virus in Sweden.Journal of General Virology77, 2555-2562.
Ignatius, H., Axberg, S., Niemistö, L. & Winterhalter, B. (1981). Quaternary geology of the Baltic Sea. In The Baltic Sea,pp. 54105. Edited by A. Voipio. New York: Elsevier Scientific Publishing Company.
Jaarola, M., Tegelström, H. & Fredga, K.(1999). Colonization history in Fennoscandian rodents. In Molecular Genetics in Animal Ecology.Biological Journal of the Linnean Society 68, 113-127.
Laemmli, U. K.(1970). Cleavage of structural proteins during assembly of the head of bacteriophage T4. Nature227, 680-685.[Medline]
Lole, K. S., Bollinger, R. C., Paranjape, R. S., Gadkari, D., Kulkarni, S. S., Novak, N. G., Ingersoll, R., Sheppard, H. W. & Ray, S. C.(1999). Full-length human immunodeficiency virus type 1 genomes from subtype c-infected seroconverters in India, with evidence of intersubtype recombination. Journal of Virology73, 152-160.
Lundkvist,
., Wiger, D., Hörling, J., Brus-Sjölander, K., Plyusnina, A., Mehl, R., Vaheri, A. & Plyusnin, A.(1998). Isolation and characterization of Puumala hantavirus from Norway: evidence for a distinct phylogenetic sublineage.Journal of General Virology79, 2603-2614.[Abstract]
Mitchell-Jones, A. J., Amori, G., Bogdanowicz, W., Krystufek, B., Reijnders, P. J. H., Spitzenberger, F., Stubbe, M., Thissen, J. B. M., Vohralik, V. & Zima, J. (1999). The Atlas of European Mammals. London: T & AD Poyser Natural History.
Morzunov, S., Rowe, J., Ksiazek, T., Peters, C., St Jeor, S. & Nichol, S.(1998). Genetic analysis of the diversity and origin of hantaviruses in Peromyscus leucopus mice in North America.Journal of Virology72, 57-64.
Morzunov, S., Khaiboullina, S. F., St Jeor, S., Khasanova, S. S., Lundkvist,
. & Plyusnin, A. (1999). Co-evolution of distinct lineages of the Puumala virus with phylogenetically distinct forms of the bank vole. XIth International Congress of Virology Abstracts (913 August 1999).
Niklasson, B. & LeDuc, J. W.(1987). Epidemiology of Nephropathia epidemica in Sweden.Journal of Infectious Diseases155, 269-276.[Medline]
Plyusnin, A., Vapalahti, O., Ulfves, K., Lehväslaiho, H., Apekina, N., Gavrilovskaya, I., Blinov, V. & Vaheri, A.(1994). Sequences of wild Puumala virus genes show a correlation of genetic variation with geographic origin of the strains.Journal of General Virology75, 405-409.
Plyusnin, A., Cheng, Y., Vapalahti, O., Pejcoch, M., Unar, J., Jelinkova, Z., Lehväslaiho, H., Lundkvist,
. & Vaheri, A.(1995). Genetic variation in Tula hantaviruses: sequence analysis of the S and M segments of strains from Central Europe.Virus Research39, 237-250.[Medline]
Plyusnin, A., Vapalahti, O. & Vaheri, A.(1996). Hantaviruses: genome structure, expression and evolution.Journal of General Virology77, 2677-2687.
Plyusnin, A., Hörling, J., Kanerva, M., Mustonen, J., Cheng, Y., Partanen, J., Vapalahti, O., Kukkonen, S. K. J., Niemimaa, J., Henttonen, H., Niklasson, B., Lundkvist,
. & Vaheri, A.(1997). Puumala hantavirus genome in patients with nephropathia epidemica: correlation of PCR positivity with HLA haplotype and link to viral sequences in local rodents. Journal of Clinical Microbiology35, 1090-1096.[Abstract]
Tegelström, H.(1987). Transfer of mitochondrial DNA from the Northern red-backed vole (Clethrionomys rutilus) to the bank vole (C. glareolus).Journal of Molecular Evolution124, 218-227.
Thompson, J. D., Gibson, T. J., Plewniak, F., Jeanmougin, F. & Higgins, D. G.(1997). The CLUSTAL_X windows interface: flexible strategies for multiple sequence alignment aided by quality analysis tools. Nucleic Acids Research25, 4876-4882.
Vapalahti, O., Kallio-Kokko, H., Närvänen, A., Julkunen, I., Lundkvist,
., Pyusnin, A., Lehväslaiho, H., Brummer-Korvenkontio, M., Vaheri, A. & Lankinen, H.(1995). Human B-cell epitopes of Puumala virus nucleocapsid protein, the major antigen in early serological response.Journal of Medical Virology46, 293-303.[Medline]
Vapalahti, O., Lundkvist,
., Fedorov, V., Conroy, C., Hirvonen, S., Plyusnina, A., Nemirov, K., Fredga, K., Cook, J., Niemimaa, J., Kaikusalo, A., Henttonen, H., Vaheri, A. & Plyusnin, A.(1999). Isolation and characterization of a hantavirus from Lemmus sibiricus: evidence for host-switch during hantavirus evolution.Journal of Virology73, 5586-5592.
Received 5 June 2000;
accepted 15 August 2000.
This article has been cited by other articles:
![]() |
M. Razzauti, A. Plyusnina, T. Sironen, H. Henttonen, and A. Plyusnin Analysis of Puumala hantavirus in a bank vole population in northern Finland: evidence for co-circulation of two genetic lineages and frequent reassortment between strains J. Gen. Virol., August 1, 2009; 90(8): 1923 - 1931. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Razzauti, A. Plyusnina, H. Henttonen, and A. Plyusnin Accumulation of point mutations and reassortment of genomic RNA segments are involved in the microevolution of Puumala hantavirus in a bank vole (Myodes glareolus) population J. Gen. Virol., July 1, 2008; 89(7): 1649 - 1660. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. W. Dragoo, J. A. Lackey, K. E. Moore, E. P. Lessa, J. A. Cook, and T. L. Yates Phylogeography of the deer mouse (Peromyscus maniculatus) provides a predictive framework for research on hantaviruses J. Gen. Virol., July 1, 2006; 87(7): 1997 - 2003. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Hanada, Y. Suzuki, and T. Gojobori A Large Variation in the Rates of Synonymous Substitution for RNA Viruses and Its Relationship to a Diversity of Viral Infection and Transmission Modes Mol. Biol. Evol., June 1, 2004; 21(6): 1074 - 1080. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. R. Chare, E. A. Gould, and E. C. Holmes Phylogenetic analysis reveals a low rate of homologous recombination in negative-sense RNA viruses J. Gen. Virol., October 1, 2003; 84(10): 2691 - 2703. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Sironen, A. Vaheri, and A. Plyusnin Molecular Evolution of Puumala Hantavirus J. Virol., December 1, 2001; 75(23): 11803 - 11810. [Abstract] [Full Text] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| INT J SYST EVOL MICROBIOL | MICROBIOLOGY | J GEN VIROL |
| J MED MICROBIOL | ALL SGM JOURNALS | |