|
|
||||||||
Animal: DNA Viruses |
Division of Viral Oncology and AIDS Reference Center, National Cancer Institute Fondazione Pascale, Mariano Semmola 1, I-80131 Naples, Italy1
Author for correspondence: Gaetano Giraldo. Fax +39 081 545 1276. e-mail ggiraldo{at}libero.it
| Abstract |
|---|
|
|
|---|
| Introduction |
|---|
|
|
|---|
Prevalence of HPV infection in men may be similar to that observed among women. The natural evolution of genital HPV infection in men, however, is less well understood. Up to 70% of male partners of women with cervical HPV infections and intraepithelial neoplasia are diagnosed with subclinical HPV infections or HPV-associated diseases (Barrasso et al., 1987
; Schneider, 1994
). The incidence of HPV-associated penile cancer, however, is much lower, suggesting that additional events and/or cofactors are involved in the malignant evolution of HPV infection in men.
HPV-transforming activity seems to be mainly associated with E6 and E7 expression (Schwarz et al., 1985
; Smotkin & Wettstein, 1986
; Hsu et al., 1993
). These oncogenes are transcribed at high levels in tumour tissues and in tumour-derived cell lines (Higgins et al., 1992
) and are also required for the maintenance of the transformed phenotype (von Knebel Doeberitz et al., 1992
). The E6 and E7 oncoproteins of high-risk HPVs contribute to cell immortalization by association with oncosuppressors, such as p53 and pRb family members (p110 Rb, p107 and p130), which play a central role in signal transduction pathways and mediate G1 arrest after DNA damage (Dyson et al., 1989
; Werness et al., 1990
; Davies et al., 1993
; Scheffner et al., 1993
). The p53 oncosuppressor has been shown to induce the cyclin-associated protein p21cip1, which in turn inhibits the in vitro cyclin complex-mediated phosphorylation of pRb (Slebos et al., 1994
). During HPV infection, the HPV E6 and E7 oncoproteins may undermine this cell-cycle checkpoint, contributing to the accumulation of the genetic alterations observed in the progression of malignancy (Demers et al., 1994
; Morozov et al., 1997
; Jones & Munger, 1997
; Martin et al., 1998
).
Virus replication and E6/E7 gene transcription are regulated by the long control region (LCR), which contains a large number of cis-responsive elements. The LCR sequence can be divided into three functionally distinct regions, namely the 5', the central and the 3' segment. The 5' segment of the LCR, with an extraordinarily high A+T content (up to 85%), contains a negative regulatory element acting at the level of late mRNA stability (Mittal et al., 1993
) and a nuclear matrix attachment region that represses the oncoprotein expression (Tan et al., 1998
; Stunkel & Bernard, 1999
). The central segment (ca. 400 bp) seems to function as an epithelial-specific transcriptional enhancer (Cripe et al., 1987
; Gloss et al., 1989
; Sibbet et al., 1995
). Multiple cellular transcription factors have been shown to bind in vitro to more than 20 sites within the HPV-16 enhancer sequence, including NF-1, NF-IL6, AP-1, AP-2, TEF-1, Oct-1, glucocorticoid receptor, YY1 and papillomavirus silencing motifs (Gloss et al., 1989
; Chan et al., 1990
; Ishiji et al., 1992
; Apt et al., 1994
; OConnor & Bernard, 1995
; OConnor et al., 1996
, 1998
; Khare et al., 1997
). The 3' segment of the LCR contains the origin of replication and the E6 and E7 promoter, P97 (Smotkin & Wettstein, 1986
; Dürst et al., 1992
). Thus the regulation of P97 is a complex process involving the equilibrium of many transcription factors that exert either positive or negative effects.
An important biological question that arises is which events modify the natural progression of HPV infection, where the final outcome is genital cancer along with increased E6 and E7 transcription levels. Several events could be involved, for example, nucleotide changes/rearrangements of viral and cellular regulatory genes or mutations of virus sites within the enhancer/promoter regions that bind nuclear transcription factors. One such event is the disruption of the E2 gene during integration of HPV into the host genome, an event observed in cervical and penile carcinomas (PCs) but not in pre-malignant lesions (Schwarz et al., 1985
; Cullen et al., 1991
; Tornesello et al., 1997
). The E2 protein in its truncated form is unable to displace either Sp1 or TFIID from their cognate sites, resulting in an increased expression of the E6 and E7 genes (Tan et al., 1994
). Mutations of cellular genes following HPV integration have also been described. In ME180 tumour cells carrying an integrated HPV-68 DNA, the recently described human gene APM-1, which encodes a protein with a BTB/POZ domain and four zinc fingers, is cotranscribed with the HPV-68 E6 and E7 genes as the 3' sequence of the ME180 viralcellular fusion transcripts (Reuter et al., 1998
). Recently, elevated levels of E6/E7 transcription, observed in a small number of independent primary tumours or metastases carrying only HPV-16 episomes, have been due to deletions or point mutations affecting one or more binding sites of the negative transcription factor YY1 (Dong et al., 1994
; May et al., 1994
).
The aims of the present study were to analyse the HPV-16 variants and their mutants in penile cancer biopsies of patients from one of the countries with the highest incidence of PC (Uganda), to evaluate the functional activity of the LCR with Af-1 mutations and/or rearrangements in a transient expression system (CAT assay) and to characterize the biological properties of these viruses in a morphological transformation assay.
| Methods |
|---|
|
|
|---|
Tumour biopsies and cell cultures.
DNA isolation and Southern blot analysis.
DNA from frozen biopsies and cell lines was digested with proteinase K, extracted once with phenol, once with phenolchloroformisoamyl alcohol (1:1:40) and ethanol-precipitated. Genomic DNA (10 µg aliquots) was cleaved with the appropriate restriction enzyme, separated on a 0·7% agarose gel and transferred onto Hybond-N nylon membranes (Amersham Pharmacia Biotech). Following pre-hybridization at 65 °C for 1 h, filters were hybridized with
-32P-labelled HPV-16 probes (Church & Gilbert, 1984
).
LCR amplification by PCR.
DNA samples were subjected to single-round PCR amplification of the LCR region (nt 7289114). HPV DNA was amplified by PCR using the following set of oligonucleotides: 16-LCR-1, 5' GCTTGTGTAACTATTGTGTCA 3' (nt 72897310), and 16-LCR-2, 5' GTCCAGAAACATTGCAGTTCT 3' (nt 93114). HPV-16 DNA nucleotide positions are numbered according to the published sequence of the reference clone (Seedorf et al., 1985
), revised as described by Icenogle et al. (1991)
, Chan et al. (1992)
, Eschle et al. (1992)
and Ho et al. (1993)
. The reaction mixture (50 µl) contained 200 ng target DNA, 20 pmol of each primer, 50 mM KCl, 2·5 mM MgCl2, 100 mM TrisHCl pH 8·3, 0·1% Triton X-100, 50 mM of each dNTP and 1·8 U thermostable DNA polymerase (Perkin Elmer). DNA was amplified in a GenAmp PCR System 9600 thermal cycler (Perkin Elmer) with the following steps: an initial 5 min denaturation at 94 °C, 30 cycles of 55 °C for 45 s, 72 °C for 60 s, 94 °C for 15 s and a final annealing at 55 °C for 45 s with 5 min elongation at 72 °C. PCR amplification products, extracted with phenol and chloroformisoamyl alcohol and purified by precipitation with 10% polyethylene glycol (PEG 6000) in 1·25 M NaCl, were subjected to direct nucleotide sequencing and sequence analysis after cloning into SmaI-dephosphorylated pBS (Stratagene).
Sequence analysis.
Recombinant plasmids containing LCR inserts were prepared from minicultures (5 ml Luria broth) using the Wizard minipreps DNA purification system (Promega). Sequencing reactions were performed using the dideoxynucleotide chain termination method (Sanger et al., 1973
) using the Sequenase 2.0 kit according to the manufacturers instructions (Amersham Pharmacia Biotech). Several primers have been used: the 17-mer universal (-20) sequencing primer, the 16-mer reverse M13 sequencing primer, 16-LCR-1, 16-LCR-2 and 16-LCR-3 (5' CAAGCCAAAAATATGTGCCTAAC 3', nt 76957717). Direct sequencing of the amplified and PEG-purified DNA was performed using a rapid method modified from Winship (1989)
. Briefly, DNA samples were denatured at 95 °C, in the presence of 10% DMSO, immediately cooled in liquid nitrogen and subsequently sequenced with the Sequenase protocol modified in the labelling step (3 min on ice). Amplification primers were also used in direct sequencing reactions. All samples were amplified and analysed in duplicate to identify possible point mutations originating from the PCR reaction. Sequences were analysed on a 6% polyacrylamide wedge sequencing gel.
Plasmid constructs.
All constructs used in functional assays consisted of PCR-generated LCR fragments cloned into pCAT-based vectors (Promega). The complete LCR, containing both the HPV-16 promoter and enhancer (nt 7289114), was cloned into the pCAT-Basic vector, which lacks eukaryotic promoter and enhancer sequences. The P97 promoter was removed from the LCR region by digestion with HpaII, which removes the fragment from nt 57114 prior to cloning into the enhancer-less pCAT-Promoter; this plasmid contains only the SV40 promoter upstream of the CAT gene. HPV-16 LCR sequences of the original isolate (Dürst et al., 1983
) were also amplified from the HPV-16 clone pBR322/HPV-16 (kindly provided by Harold zur Hausen, Deutsches Krebsforschungszentrum, Heidelberg, Germany) and will be referred to as the prototype (solely to indicate that it is the first HPV-16 isolate). The plasmids pCAT-Control (Promega) and pSV-
gal (Promega), both containing the SV40 early promoter and enhancer upstream of CAT and lacZ genes, respectively, were used to monitor transfection efficiencies.
All constructs used in the NIH3T3 transformation assays consisted of the LCR/E6/E7 sequence (nt 7289875), released with PstI digestion from the HPV-16 Af-1 variants described in Tornesello et al. (1992
, 1997
) and from the HPV-16 prototype. Sequences were then cloned into the pRc/CMV eukaryotic expression plasmid (Invitrogen), which is depleted of the CMV promoter. The LCR/E6/E7 region isolated from PC8 was also digested with EcoRI in order to remove the entire rearranged sequence and to obtain the pRc/PC8
construct. This construct is depleted of the PC8 duplicated sequence and represents our Af-1 reference clone with only three point mutations from the Af-1 consensus sequence (Human Papillomaviruses Compendium, 1996
).
Cell transfection and CAT assay.
HeLa, SiHa, HT3 and NTERA-2 cells were cultured in MEM supplemented with 10% FCS using standard procedures. The cell lines were transiently transfected with 3 µg pSV-
gal and 5 µg of test DNA constructs using the Gene Pulser apparatus (BioRad Laboratories) and harvested 3648 h after treatment.
To determine CAT activity, assays were performed using essentially the same procedure described by Seed & Sheen (1988)
. Protein (200 µg) was incubated in 100 mM TrisHCl pH 7·0, 100 µM [14C]chloramphenicol and 250 µM butyryl coenzyme A. After 1 h incubation at 37 °C, the reaction was terminated by extracting with 2 vol. mixed xylenes and counted in scintillation liquid. CAT activity was determined as pmoles chloramphenicol converted per min per mg protein (pmol/min/mg protein). Each reported value represents the average result, obtained in four to six independent transfections (in duplicate) using at least two different DNA preparations, normalized by the
-galactosidase activity.
The
-galactosidase activity of the control plasmid pSV-
gal was evaluated spectrophotometrically using the
-galactosidase enzyme assay system according to the manufacturers instructions (Promega) and by in situ staining as described by Harper et al. (1988)
.
Focus formation assay.
Long-term transfections were achieved by a modified calcium phosphate co-precipitation method. NIH3T3 cells (1x105 cells per 60 mm dish) were exposed to 5 µg of test DNA. After a 12 h incubation, the transfected cells were subcultured 1:3 and fed every 3 days. After 46 weeks, the cell culture dishes were fixed and stained with 50% ethanol, 10% Giemsas stain and 40% H2O. Each recombinant construct has been tested in triplicate with two different DNA preparations for a total of six independent transfections.
| Results |
|---|
|
|
|---|
-32P-labelled HPV-16 LCR fragment showed that amplified products from samples PC8 and PC17, although larger than the expected size, are homologous to LCR sequences, suggesting that rearrangements within the LCR region could have occurred. These results indicate that PC8 contains two different LCR sequences, the rearranged LCR and the unit length region, while PC17 contains only a rearranged LCR region.
|
|
|
A) reported in 80% of the isolates sampled throughout the world and mutations at nt 7489 (G
A), 7764 (C
T) and 7786 (C
T) that are distinctive to the Ax group (Af-1, Af-2 and Asian lineages). Four out of five isolates contain mutations at nt 7833 (G
T), specific to Af-1 and Af-2, and at nt 7714 (T
A), observed only in Af-1. In addition, the C
G transversion was observed in four out of five samples at nt 7461, which falls within an E2-binding site. The E6 gene of all five samples, as previously described (Tornesello et al., 1997
C), 143 (C
G) and 145 (G
T). Only sample PC8, also containing mutations at nt 286 (T
A), 289 (A
G) and 335 (C
T, H
Y), shows all six nucleotide changes consistently detected by Yamada et al. (1997)
C) and 795 (T
G) in all five PC samples (Tornesello et al., 1997
Functional activity of mutated HPV-16 LCRs
The expression of HPV early genes, including the E6 and E7 genes, at the transcriptional level is mainly regulated through the LCR region upstream of the E6 gene. The DNA fragment covering the whole LCR region of HPV-16 isolates from samples PC4, PC8, PC17 and the HPV-16 prototype were cloned either (i) upstream of the CAT reporter gene into the pCAT-Basic vector, under expression control of their own P97 promoter or (ii) digested with HpaII restriction enzyme in order to remove the HPV-16 promoter (nt 58114) and cloned downstream of the CAT expressing gene into the pCAT-Promoter plasmid, which contains the SV40 promoter (Fig. 4
). The pCAT-Control plasmid, which contains the supposedly ubiquitously active SV40 enhancer and the SV40 promoter, was used as positive control.
|
Data from the outcome of these experiments are summarized in Table 1
and Fig. 5
. All three constructs (pCAT-Basic, pCAT-Promoter and pCAT-Control) have been tested in all four cell lines to evaluate, under our experimental conditions, the expression activity of the SV40 promoter/enhancer, which has been described as cell type-dependent. The promoter/enhancer-less pCAT-Basic shows a low basal CAT activity in all tested cell lines; the enhancer-less pCAT-Promoter shows a higher CAT activity (510-fold increment) in all four cell lines, with maximum activity in the HT3 cell line. pCAT-Control shows CAT activity in all cervical carcinoma-derived cell lines with maximum activity in the NTERA-2 cell line.
|
|
In contrast, the HPV-16 Af-1 class point mutations present in the HPV-16 PC4 isolate do not significantly increase the expression efficacy of the HPV-16 LCR, which shows a maximum 1·75-fold increase of CAT activity, in comparison with the prototype sequence in HT3 cells.
Biological properties of rearranged LCRs
The whole E6/E7 region of HPV-16 isolated from PC8 and PC17, under expression control of their own LCR regulatory region, has been cloned into the pRc/CMV vector, which is depleted of the CMV early promoter (Fig. 6
) and carries neomycin resistance. The PC8 E6/E7 and PC17 E6/E7 transforming activity has been examined in NIH3T3 cells by DNA-mediated gene transfer technology. Morphologically transformed foci were detected 46 weeks after transfection. No foci were observed in control cultures transfected with pRc/CMV DNA vector alone. The pRc/Prot16 construct induced 21 foci/µg DNA; the pRc/PC8
, pRc/PC8 and pRc/PC17 constructs induced an average of 31·3, 64·6 and 51·6 foci/µg DNA, respectively. Thus the pRc/PC8
, pRc/PC8 and pRc/PC17 transformation efficiency of 156·5 (P<0·005), 323 (P<0·001) and 258 (P<0·005) foci per 1x105 treated cells was 1·49-, 3·07- and 2·45-fold higher than the number of foci (105 per 1x105 treated cells) induced by pRc/R16 DNA (Table 2
). To estimate the transfection efficiency, transfected NIH3T3 cells were selected with G418 (400 µg/ml) and observed for 21 days for focus formation. The average number of G418-resistant colonies was 552±12·28 colonies/µg pRc/CMV-based constructs, indicating that the transformation efficiency ranged from 11·9 to 3·8% of the cells expressing genes transfected with Af-1 typical, rearranged or prototype HPV-16 LCR, respectively. The 3-fold increase in transformation efficiency seems compatible with the enhancer/promoter strength of each construct presented in the CAT assay.
|
|
| Discussion |
|---|
|
|
|---|
In order to identify virus mutations involved in the transformation process we have analysed penile cancers from the Kyadondo County in Uganda, where this cancer represented the most frequently diagnosed cancer in men in the 1950s and 1960s (Kyalwazi, 1966
; Dodge et al., 1973
). The annual crude rate of penile cancer has been declining from the 2·2 cases per 100000 observed in the period 19641968, with a peak of 10·6 in the Nyoro tribe of the Bunyoro District (Schmauz & Jain, 1971
), to 0·9 per 100000; penile cancer in the Kyadondo County, however, still shows one of the highest incidence rates in the world, with a 2·8 age standarized rate (World) per 100000 per year in comparison to <1·0 age standarized rate (World) in Western countries (IARC, 1997). In this region Af-1 is the prevalent HPV-16 class in male (Tornesello et al., 1997
) as well as female (Buonaguro et al., 2000
) genital lesions; 22·7% of all female cancers are represented as genital lesions (IARC, 1997). However, there is no evidence on the different oncogenic activity of Af-1 HPV-16 in comparison to HPV-16 variants of the E class and on the type of genetic alterations present in such lesions. In particular, it would be relevant to discriminate between an increased Af-1 oncogenic activity (i.e. E6/E7 with higher binding affinity to oncosuppressors) and a spectrum of genetic mutations/rearrangements that would increase the expression of the HPV-16 oncogenes in a population which could be more susceptible to HPVs for socio-economic reasons.
HPV-16 DNA from PC biopsies of five Ugandan patients has been characterized by gene sequencing. Three of these samples were characterized by biological assays, targeted to evaluate the LCR promoter activity in a CAT expression system and the transforming activity of E6/E7 driven by their own LCRs in an NIH3T3 morphological transformation assay. Nucleotide sequence analysis of the LCR region, amplified by PCR, identified all HPVs as members of the Af-1 class (Tornesello et al., 1997
). Further nucleotide mutations have not been observed. Only the PC8 and PC17 samples have shown an unusual LCR region, characterized by a duplication of 495 bp and 190 bp fragments, respectively, which starts in a co-linear region between 73407350, with the resultant doubling of several nuclear factor binding sites.
Functional analysis of the typical Af-1 LCR and rearranged Af-1 LCR has been performed in CAT assay experiments following cloning of the LCR regions upstream of the reporter gene. Both typical and rearranged Af-1 LCR regions showed enhancer activity higher than HPV-16 class E prototype in epithelial cells, irrespective of the presence of endogenous HPV viral genomes. In the HT3 cells, in particular, the typical Af-1 LCR shows a 1·75-fold increase in enhancing activity and the rearranged LCR shows a 4·23-fold higher activity than that seen with the HPV-16 E prototype. Thus the rearranged LCR regions present a significantly higher activity than the typical Af-1 LCR. The enhancer activity of HPV-16 and HPV-18 LCRs, containing point mutations upstream from and within the enhancer region, was reported to be an average 2-fold higher than the prototype LCR in HPV-positive oral cancer cell lines (Chen et al., 1997
). All these results would suggest that point mutations in the LCR are able to induce a modest increment of enhancer activity, while rearrangements can be involved in major expression modifications.
The modulation of the oncogenic activity of HPV-16 variants by LCR modifications has been tested in NIH3T3 cells, which being immortalized can be used to analyse, in a single hit fashion, the transforming activity correlated to alterations of cell-cycle checkpoints of direct dominant oncogenes and/or indirect oncogenic genes that inhibit oncosuppressors. The in vitro transforming assay, cloning the whole LCR/E6/E7 region from prototype and mutated isolates in the pRc/CMV
expression vector, has been used to examine whether differences in the strength of enhancer/promoter activity of HPV-16 variants result in an increased E6/E7-dependent transforming activity. A significantly higher number of transformed foci were obtained with E6 and E7 genes expressed by rearranged LCRs. In particular, constructs of the Af-1 variant with duplications within the enhancer region showed a transforming efficiency 2·06- and 1·65-fold higher than the prototype LCR. Although the LCR CAT-driving activity in NIH3T3 is modest in the transient CAT assay on a pooled cell population, the expression of E6/E7 driven by the LCR enhancerpromoter has been detected in morphologically transformed foci (Yasumoto et al., 1986
; Buonaguro et al., 1994
). In our experimental conditions we cannot verify a significantly higher transforming activity of the Af-1 variant as compared to the E prototype; on the other hand the LCR-rearranged Af-1 isolate is associated with a significantly higher frequency of transformation events. This may be because the LCR-rearranged Af-1 isolate shows a higher probability of expressing sufficient levels of transforming genes due to an increased susceptibility to nuclear factors.
The role of rearrangements in HPV-transforming activity has been also suggested by several in vitro studies showing changes of the oncogenic potential following genetic alterations of the LCR region. Rosen et al. (1991)
reported that low-risk HPV-11 DNA, which does not normally transform cells in vitro, is able to transform baby rat kidney cells in a ras-dependent focus assay when two copies of the LCR were present (Rosen & Auborn, 1991
). Furthermore, Romanczuk et al. (1991)
reported that the major determinant of the differential immortalization of HPV-16 and HPV-18 lies within the LCR/E6/E7 region. In particular, the HPV-18 LCR/E6/E7 is more efficient in this immortalization function than the analogous region of the HPV-16 genome. The E6 and E7 genes of either HPV-16 or HPV-18, when regulated by the same heterologous promoter, immortalized primary human keratinocytes with the same efficiency, suggesting that the difference in immortalization activities was not due to the different E6 or E7 genes themselves but rather to a difference in the transcriptional regulatory regions upstream of these genes.
Analysing all HPV-16 LCR duplication regions identified to date in our laboratory and reported by other groups (Schwartzman Fang et al., 1993
; Chan et al., 1992
), it becomes evident that the regions of rearrangements are not random, particularly at the 5' end where the region lying between nt 7340 and 7346 is constantly involved (Fig. 3
). Furthermore, at the 5' end as well as the 3' end, TAAACTT and GTTTC direct repeats are present, suggesting that these motifs are involved in homologous recombination events and are eventually facilitating rearrangements of the intervening sequences.
The identification of rearrangements in two out of the five samples analysed suggests that such genetic alterations within the LCR seem not to be a rare event in PC, in constrast to the situation reported for cervical carcinoma. The frequency of rearrangements in HPV-16 isolated from female genital lesions, on the other hand, could have been underestimated, considering that the genetic patterns we have described fall in a nucleotide region previously not well characterized as shown by the modest number of sequences of that region (Human Papillomaviruses Compendium, 1996
). The etiopathogenesis of these genetic alterations and the molecular mechanisms involved in the transformation events are not well understood. In particular, it would be relevant to determine whether the HPV LCR rearrangements represent a consequence of accumulating genetic alterations during the transformation process or whether they precede the frequently detected cellular genetic aberrations identified as a chromosomal imbalance in the E6/E7-dependent immortalization/transformation (Solinas-Toldo et al., 1997
; Havre et al., 1995
; White et al., 1994
; Reznikoff et al., 1994
). In the latter case, the genetic alterations of the LCR would increase the expression of E6 and E7, with the consequent decrease of p53 and pRb. E7 binding to pRb with the release of the transcription activator E2F, whose function is important for G1S transition, would be relevant for the immortalization of the HPV-infected cells. The E6-dependent reduction of p53 would have as a consequence the decrease of p21cip1 (the major cyclin-dependent kinase inhibitor) and the resulting abrogation of the p53-dependent growth arrest following DNA damage with accumulation of chromosomal instability. The chromosomal imbalances observed in HPV-infected cells are prevalently represented by additional copies of chromosomes (3, 5, 19 and 20) or by the loss of chromosomes (1, 2, 4, 11, 14, 15 and 22). Numerous structural aberrations, however, consist of imbalances of only a portion of chromosome arms, particularly amplification of chromosome regions (Solinas-Toldo et al., 1997
).
Moreover, rearrangements of the integrated HPV E6/E7 regulatory sequences would further activate the expression of the viral oncoproteins. Those cells characterized by such abnormalities would then have a growth advantage above normal and HPV-infected cells and could progress to malignant transformation.
In conclusion, although the Af-1 HPV-16 variants prevalently present in the Ugandan population in both men and women have been suggested to confer along with Ax variants a 6·5-fold higher risk of developing cervical intraepithelial neoplasia (CIN) 23 than the prototype-like HPV-16 variant (Xi et al., 1997
), no clinical/epidemiological data are available on the oncogenic risk associated with rearranged LCR. This study represents one of the first reports on the biological efficacy and in vitro transforming activity of rearranged LCR of the HPV-16 Af-1 class.
| Acknowledgments |
|---|
| References |
|---|
|
|
|---|
Barbosa, M. S. & Schlegel, R.(1989). The E6 and E7 genes of HPV-18 are sufficient for inducing two-stage in vitro transformation of human keratinocytes.Oncogene4, 1529-1532.[Medline]
Barbosa, M. S., Vass, W. C., Lowy, D. R. & Schiller, J. T.(1991). In vitro biological activities of the E6 and E7 genes vary among human papillomavirus of different oncogenic potential.Journal of Virology65, 292-298.
Barrasso, R., de Brux, J., Croissant, O. & Orth, G.(1987). High prevalence of papillomavirus-associated penile intraepithelial neoplasia in sexual partners of women with cervical intraepithelial neoplasia.New England Journal of Medicine317, 916-923.[Abstract]
Bedell, M. A., Jones, K. H., Grossman, S. R. & Lalmins, L. A.(1989). Identification of human papillomavirus type 18 transforming genes in immortalized and primary cell.Journal of Virology63, 1247-1255.
Buonaguro, F. M., Tornesello, M. L., Buonaguro, L., Del Gaudio, E., Beth-Giraldo, E. & Giraldo, G.(1994). Role of HIV as cofactor in HPV oncogenesis: in vitro evidences of virus interactions. In Advanced Technologies in Research, Diagnosis and Treatment of AIDS and in Oncology, pp. 102-109. Edited by G. Giraldo, M. Salvatore, L. Chieco-Bianchi & E. Beth-Giraldo. Basel:Karger.
Buonaguro, F. M., Tornesello, M. L., Salatiello, I., Okong, P., Buonaguro, L., Beth-Giraldo, E., Biryahwaho, B., Sempala, S. K. D. & Giraldo, G. (2000). The Uganda study on HPV variants and genital cancers. Journal of Clinical Virology (in press).
Chan, W. K., Chong, T., Bernard, H. U. & Klock, G.(1990). Transcription of the transforming genes of the oncogenic human papillomavirus type 16 is stimulated by tumor promoters through AP1 binding sites.Nucleic Acids Research18, 763-769.
Chan, S.-Y., Ho, L., Ong, C.-K., Chow, V., Drescher, B., Dürst, M., ter Meulen, J., Villa, L., Luande, J., Mgaya, H. N. & Bernard, H.-U.(1992). Molecular variants of human papillomavirus type 16 from four continents suggest ancient pandemic spread of the virus and its co-evolution with humankind. Journal of Virology66, 2057-2066.
Chen, Z., Storthz, K. A. & Shillitoe, E. J.(1997). Mutations in the long control region of human papillomavirus DNA in oral cancer cells, and their functional consequences.Cancer Research57, 1614-1619.
Church, G. M. & Gilbert, W.(1984). Genomic sequencing. Proceedings of the National Academy of Sciences, USA81, 1991-1995.
Cripe, T. P., Haugen, T. H., Turk, J. P., Tabatabai, F., Schmid, P. G., Dürst, M., Gissmann, L., Roman, A. & Turek, L. P.(1987). Transcriptional regulation of the human papillomavirus-16 E6/E7 promoter by a keratinocyte-dependent enhancer, and by viral E2 trans-activator and repressor gene products: implications for cervical carcinogenesis.EMBO Journal6, 3745-3753.[Medline]
Cullen, A. P., Reid, R., Campion, M. & Lorincz, A. T.(1991). Analysis of the physical state of different human papillomavirus DNAs in intraepithelial and invasive cervical neoplasms.Journal of Virology65, 606-612.
Davies, R., Hicks, R., Crook, J., Morris, J. & Vousden, K.(1993). Human papillomavirus type 16 E7 associates with a histone H1 kinase and with p107 through sequences necessary for transformation.Journal of Virology67, 2521-2528.
Demers, G. W., Foster, S. A., Halbert, C. L. & Galloway, D. A.(1994). Growth arrest by induction of p53 in DNA damaged keratinocytes is bypassed by human papillomavirus 16 E7.Proceedings of the National Academy of Sciences, USA91, 4382-4386.
Dodge, O. G., Owor, R. & Templeton, A. C.(1973). Tumours of the male genitalia. In Tumours in a Tropical Country. Recent Results in Cancer Control, pp. 132-144. Edited by A. C. Templeton. Berlin:Springer.
Dong, X. P., Stubenrauch, F., Beyer-Finkler, E. & Pfister, H.(1994). Prevalence of deletions of YY1-binding sites in episomal HPV 16 DNA from cervical cancers. International Journal of Cancer58, 803-808.
Dürst, M., Gissman, H., Ikenberg, H. & zur Hausen, H.(1983). A papillomavirus DNA from a cervical carcinoma and its prevalence in cancer biopsy samples from different geographic regions.Proceedings of the National Academy of Sciences, USA80, 3812-3815.
Dürst, M., Glitz, D., Schneider, A. & zur Hausen, H.(1992). Human papillomavirus type 16 (HPV-16) gene expression and DNA replication in cervical neoplasia: analysis by in situ hybridization.Virology189, 132-140.[Medline]
Dyson, N., Howley, P. M., Munger, K. & Harlow, E.(1989). The human papillomavirus-16 E7 oncoprotein is able to bind the retinoblastoma gene product. Science243, 934-937.
Eschle, D., Dürst, M., ter Meulen, J., Luande, J., Eberhardt, H. C., Pawlita, M. & Gissmann, L.(1992). Geographical dependence of sequence variation in the E7 gene of human papillomavirus type 16.Journal of General Virology73, 1829-1832.
Gentile, G., Giraldo, G., Stabile, M., Beth-Giraldo, E., Lonardo, F., Kyalwazi, S. K., Perone, L. & Ventruto, V.(1987). Cytogenetic study of a cell line of human penile cancer.Annales de Genetique30, 164-169.[Medline]
Gloss, B., Chong, T. & Bernard, H.-U.(1989). Numerous nuclear proteins bind the long control region of human papillomavirus type 16: a subset of 6 of 23 DNase I-protected segments coincides with the location of the cell-type-specific enhancer.Journal of Virology63, 1142-1152.
Harper, J. R., Greenhalgh, D. A. & Yuspa, S. H.(1988). Expression of transfected DNA by primary murine keratinocytes.Journal of Investigative Dermatology 91, 150-153.[Medline]
Havre, P. A., Yuan, J., Hedrick, L., Cho, K. R. & Glazer, P. M.(1995). p53 inactivation by HPV-16 E6 results in increased mutagenesis in human cells. Cancer Research55, 4420-4424.
Higgins, G. D., Phillips, G. E., Smith, L. A., Uzelin, D. M. & Burrel, C. J.(1992). High prevalence of human papillomavirus transcripts in all grades of cervical intraepithelial glandular neoplasia.Cancer70, 136-146.[Medline]
Ho, L., Chan, S.-Y., Burk, R. D., Das, B. C., Fujinaga, K., Icenogle, J. P., Kahn, T., Kiviat, N., Lancaster, W., Mavromara-Nazos, P., Labropoulou, V., Mitrani-Rosenbaum, S., Norrild, B., Pillai, M. R., Tay, S.-K., Villa, L., Wheeler, C. M., Williamson, A.-L. & Bernard, H.-U.(1993). The genetic drift of human papillomavirus type 16 is a means of reconstructing prehistoric viral spread and movement of ancient human populations.Journal of Virology67, 6413-6423.
Hsu, E. M., McNicol, P. J., Guijon, F. B. & Paraskevas, M.(1993). Quantification of HPV-16 E6/E7 transcription in cervical intraepithelial neoplasia by reverse transcriptase polymerase chain reaction.International Journal of Cancer55, 397-401.
Human Papillomaviruses Compendium (1996). Edited by G. Myers, S. Sverdrup, C. Baker, A. McBride, K. Munger, H. U. Bernard & J. Meissner. Los Alamos, NM, USA: Los Alamos National Laboratory.
IARC (1995). IARC Monographs on the Evaluation of the Carcinogenic Risks of Chemicals to Humans, vol. 64, Human Papillomaviruses. Lyon: International Agency for Research on Cancer, World Health Organization.
Icenogle, J. P., Sathya, P., Miller, D. L., Tucker, R. & Rawls, W. E.(1991). Nucleotide and amino acid sequence variation in the L1 and E7 open reading frames of human papillomavirus type 6 and type 16.Virology184, 101-107.[Medline]
Ishiji, T., Lace, M., Parkkinen, S., Anderson, R. D., Haugen, T. H., Cripe, T. P., Xiao, J.-H., Davidson, I., Cahmbon, P. & Turek, L. P.(1992). Transcriptional enhancer factor (TEF)-1 and its cell-specific co-activator activate human papillomavirus-16 E6 and E7 oncogene transcription in keratinocytes and cervical carcinoma cells.EMBO Journal11, 2271-2281.[Medline]
Jones, D. L. & Munger, K.(1997). Analysis of the p53-mediated G1 growth arrest pathway in cells expressing the human papillomavirus type 16 E7 oncoprotein.Journal of Virology71, 2905-2912.[Abstract]
Khare, S., Pater, M. M., Tang, S. C. & Pater, A.(1997). Effect of glucocorticoid hormones on viral gene expression, growth, and dysplastic differentiation in HPV16-immortalized ectocervical cells.Experimental Cell Research232, 353-360.[Medline]
Kyalwazi, S. K.(1966). Carcinoma of the penis: a review of 153 cases admitted to Mulago Hospital, Kampala, Uganda.East Africa Medical Journal43, 415-425.
Lorincz, A. T., Reid, R., Jenson, A. B., Greenberg, M. D., Lancaster, W. & Kurman, R. J.(1992). Human papillomavirus infection of the cervix: relative risk association of 15 common anogenital types.Obstetrics and Gynecology79, 328-337.[Abstract]
McCance, D. J., Kalache, A., Ashdown, K. X., Andrade, L., Menzes, F., Smith, P. & Doll, R.(1986). Human papillomavirus type 16 and 18 in carcinomas of the penis from Brazil.International Journal of Cancer37, 55-59.
Martin, L. G., Demers, G. W. & Galloway, D. A.(1998). Disruption of the G1/S transition in human papillomavirus type 16 E7-expressing human cells is associated with altered regulation of cyclin E. Journal of Virology72, 975-985.
May, M., Dong, X. P., Beyer-Finkler, F., Stubenrauch, F., Fuchs, P. G. & Pfister, H.(1994). The E6/E7 promoter of extrachromosomal HPV16 DNA in cervical cancers escapes from cellular repression by mutation of target sequences for YY1.EMBO Journal13, 1460-1466.[Medline]
Mittal, R., Pater, A. & Pater, M. M.(1993). Multiple human papillomavirus type 16 glucocorticoid response elements functional for transformation, transient expression, and DNA protein interactions.Journal of Virology67, 5656-5659.
Morozov, A., Shiyanov, P., Barr, E., Leiden, J. M. & Raychaudhuri, P.(1997). Accumulation of human papillomavirus type 16 E7 protein bypasses G1 arrest induced by serum deprivation and by the cell cycle inhibitor p21.Journal of Virology71, 3451-3457.[Abstract]
OConnor, M. & Bernard, H.-U.(1995). Oct-1 activates the epithelial-specific enhancer of human papillomavirus type 16 via a synergistic interaction with NFI at a conserved composite regulatory element.Virology207, 77-88.[Medline]
OConnor, M. J., Tan, S. H., Tan, C. H. & Bernard, H. U.(1996). YY1 represses human papillomavirus type 16 transcription by quenching AP-1 activity.Journal of Virology70, 6529-6539.
OConnor, M. J., Stunkel, W., Zimmermann, H., Koh, C. H. & Bernard, H. U.(1998). A novel YY1-independent silencer represses the activity of the human papillomavirus type 16 enhancer.Journal of Virology72, 10083-10092.
Peacock, J. W., Matlashewski, G. J. & Benchimoi, S.(1990). Synergism between pairs of immortalizing genes in transforming assays of rat embryo fibroblasts. Oncogene5, 1769-1774.[Medline]
Phelps, W. C., Yes, C. L., Munger, K. & Howley, P. M.(1988). The human papillomavirus type 16 E7 gene encodes transactivation and transformation functions similar to those of adenovirus E1A. Cell53, 539-547.[Medline]
Reuter, S., Bartelmann, M., Vogt, M., Geisen, C., Napierski, I., Kahn, T., Delius, H., Lichter, P., Weitz, S., Korn, B. & Schwarz, E.(1998). APM-1, a novel human gene, identified by aberrant co-transcription with papillomavirus oncogenes in a cervical carcinoma cell line, encodes a BTB/POZ-zinc finger protein with growth inhibitory activity.EMBO Journal17, 215-222.[Medline]
Reznikoff, C. A., Belair, C., Savelieva, E., Zhai, Y., Pfeifer, K., Yeager, T., Thompson, K. J., DeVries, S., Bindley, C. & Newton, M. A.(1994). Long-term genome stability and minimal genotypic and phenotypic alterations in HPV16 E7-, but not E6- immortalized human uroepithelial cells.Genes & Development8, 2227-2240.
Riou, G., Favre, M., Jeannel, D., Bourthis, J., Le Doussal, V. & Orth, G.(1990). Association between poor prognosis in early-stage invasive cervical carcinomas and non-detection of HPV DNA. Lancet335, 1171-1174.[Medline]
Rosen, M. & Auborn, K.(1991). Duplication of upstream regulatory sequences increases the transformation potential of human papillomavirus type 11.Virology185, 484-487.[Medline]
Romanczuk, H., Villa, L. L., Schlegel, R. & Howley, P. M.(1991). The viral transcriptional regulatory region upstream of the E6 and E7 genes is the major determinant of the differential immortalization activities of human papillomavirus type 16 and 18.Journal of Virology65, 2739-2744.
Sanger, F., Donelson, J. E., Coulson, A. R., Kössel, H. & Fischer, D.(1973). Use of DNA polymerase I primed by a synthetic oligonucleotide to determine a nucleotide sequence in phage f1 DNA.Proceedings of the National Academy of Sciences, USA70, 1209-1219.
Scheffner, M., Huibregtse, J. M., Vierstra, R. D. & Howley, P. M.(1993). The HPV-16 E6 and E6AP complex functions as a ubiquitin protein ligase in the ubiquitination of p53.Cell75, 495-505.[Medline]
Schmauz, R. & Jain, D. K.(1971). Geographical variation of carcinoma of the penis in Uganda.British Journal of Cancer25, 25-32.[Medline]
Schneider, A.(1994). Natural history of genital papillomavirus infections.Intervirology37, 201-214.[Medline]
Schwartzman Fang, B., Guedes, A. C., Munoz, L. C. & Villa, L. L.(1993). Human papillomavirus type 16 variants isolated from vulvar bowenoid papulosis. Journal of Medical Virology41, 49-54.[Medline]
Schwarz, E., Freese, K., Gissmann, L., Mayer, W., Roggenbuck, B., Stremlau, A. & zur Hausen, H.(1985). Structure and transcription of human papillomavirus sequences in cervical carcinoma cells. Nature314, 111-114.[Medline]
Seed, B. & Sheen, J. Y.(1988). A simple phase extraction assay for chloramphenicol acyl transferase activity.Gene67, 271-277.[Medline]
Seedorf, K., Krämmer, G., Dürst, M., Suhai, S. & Röwekamp, W. G.(1985). Human papillomavirus type 16 DNA sequence.Virology145, 181-185.[Medline]
Sibbet, G. J., Cuthill, S. & Campo, M. S.(1995). The enhancer in the long control region of human papillomavirus type 16 is up-regulated by PEF-1 and down-regulated by Oct-1.Journal of Virology69, 4006-4011.[Abstract]
Slebos, R. J., Lee, M. H., Plunkett, B. S., Kessis, T. D., Williams, B. O., Jacks, T., Hedrick, L., Kastan, M. B. & Cho, K. R.(1994). p53-dependent G1 arrest involves pRB-related proteins and is disrupted by the human papillomavirus 16 E7 oncoprotein.Proceedings of the National Academy of Sciences, USA91, 5320-5324.
Smotkin, D. & Wettstein, F. O.(1986). Transcription of human papillomavirus type 16 early genes in cervical cancer and a cervical cancer derived cell line and identification of the E7 protein. Proceedings of the National Academy of Sciences, USA83, 4680-4684.
Solinas-Toldo, S., Dürst, M. & Lichter, P.(1997). Specific chromosomal imbalances in human papillomavirus-transfected cells during progression toward immortality.Proceedings of the National Academy of Sciences, USA94, 3854-3859.
Stunkel, W. & Bernard, H. U.(1999). The chromatin structure of the long control region of human papillomavirus type 16 represses viral oncoprotein expression.Journal of Virology73, 1918-1930.
Tan, S. H., Leong, L. E., Walker, P. A. & Bernard, H. U.(1994). The human papillomavirus type 16 E2 transcription factor binds with low cooperativity to two flanking sites and represses the E6 promoter through displacement of Sp1 and TFIID.Journal of Virology68, 6411-6420.
Tan, S. H., Bartsch, D., Schwarz, E. & Bernard, H. U.(1998). Nuclear matrix attachment regions of human papillomavirus type 16 point toward conservation of these genomic elements in all genital papillomaviruses. Journal of Virology72, 3610-3622.
Ting, Y. & Manos, M. M.(1990). Detection and typing of genital human papillomaviruses. In PCR Protocols, pp. 356-367. Edited by M. A. Innis, D. H. Gelfand, J. J. Sninsky & T. J. White. San Diego, CA:Academic Press.
Tornesello, M. L., Buonaguro, F. M., Beth-Giraldo, E., Kyalwazi, S. K. & Giraldo, G.(1992). Human papillomavirus (HPV) DNA in penile carcinomas and in two cell lines from high-incidence areas for genital cancers in Africa.International Journal Cancer51, 587-592.
Tornesello, M. L., Buonaguro, F. M., Meglio, A., Buonaguro, L., Beth-Giraldo, E. & Giraldo, G.(1997). Sequence variations and viral genomic state of human papillomavirus type 16 in penile carcinomas from Ugandan patients.Journal of General Virology78, 2199-2208.[Abstract]
Van den Brule, A. J., Walboomers, J. M., Du Maine, M., Kenemans, P. & Meijer, C. J. L. M. (1991). Difference in prevalence of human papillomavirus genotypes in cytomorphologically normal cervical smears is associated with a history of cervical intraepithelial neoplasia.International Journal of Cancer48, 404-408.
von Knebel Doeberitz, M., Rittmuller, C. & zur Hausen, H.(1992). Inhibition of tumorigenicity of cervical cancer cells in nude mice by HPV E6-E7 anti-sense RNA.International Journal of Cancer51, 831-834.
Wagatsuma, M., Hashimoto, K. & Matsukura, T.(1990). Analysis o