J Gen Virol Try Microbiology Online
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via CrossRef
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Merits, A.
Right arrow Articles by Morozov, S. Yu.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Merits, A.
Right arrow Articles by Morozov, S. Yu.
Agricola
Right arrow Articles by Merits, A.
Right arrow Articles by Morozov, S. Yu.
Journal of General Virology (2000), 81, 3099-3106.
© 2000 Society for General Microbiology


Plant

Activities associated with the putative replication initiation protein of Coconut foliar decay virus, a tentative member of the genus Nanovirus

Andres Merits1,2, Oleg N. Fedorkin2,3, Deyin Guo2, Natalia O. Kalinina3 and Sergey Yu. Morozov3

National Institute of Chemical Physics and Biophysics, Akadeemia tee 23, EE12618 Tallinn, Estonia1
Institute of Biotechnology, Viikki Biocenter, University of Helsinki, PO Box 56, FIN-00014 Helsinki, Finland2
Department of Virology and A. N. Belozersky Institute of Physico-Chemical Biology, Moscow State University, Moscow 119899, Russia3

Author for correspondence: Andres Merits (at the Viikki Biocenter). Fax +358 9 191959366. e-mail Merits{at}operoni.helsinki.fi


   Abstract
TOP
Abstract
Introduction
Methods
Results and Discussion
References
 
The putative replication initiation protein (Rep) of Coconut foliar decay virus (CFDV) was expressed as a 6x His recombinant protein in E. coli and in recombinant baculovirus. Purified 6x His–Rep protein was demonstrated to possess sequence non-specific RNA- and ssDNA-binding activities as well as magnesium-dependent ATPase/GTPase activity. The yeast two-hybrid system revealed that CFDV Rep could interact with itself. Subcellular distribution of the CFDV Rep was studied by fractionation of insect cells infected with recombinant baculovirus expressing the 6x His–Rep protein and by laser scanning confocal microscopy of Nicotiana benthamiana epidermal cells bombarded with a construct encoding CFDV Rep fused to GFP. It was shown that CFDV Rep associated predominantly with nuclei and membranes of infected/transfected cells. These activities of CFDV-encoded Rep are very similar to those reported for Reps of geminiviruses.


   Introduction
TOP
Abstract
Introduction
Methods
Results and Discussion
References
 
Coconut foliar decay virus (CFDV) is a small isometric plant virus with a single-stranded DNA genome (Randles et al., 1986Down ). The only known genomic component of CFDV consists of 1291 nucleotides and has been proposed to contain up to six open reading frames in both orientations (Rohde et al., 1990Down ). The largest, called ORF1, potentially encodes a 33 kDa protein possessing motifs typical for the replication initiation protein (Rep) of gemini- and nanoviruses (Gorbalenya et al., 1990Down ; Boevink et al., 1995Down ; Katul et al., 1997Down ). This gene is expressed from a CFDV promoter which has been shown to be phloem-specific (Rohde et al., 1995Down ) and to include the cis-acting elements involved in phloem-specificity (Hehn & Rohde, 1998Down ). RNA transcript(s) which correspond to the entire coding sequence of CFDV Rep are polyadenylated at a position six bases downstream of the termination codon of this gene (Merits et al., 1995Down ). The nucleotide sequence of CFDV DNA is most closely related to the Rep-encoding components of the nanoviruses Subterranean clover stunt virus (SCSV) (Boevink et al., 1995Down ), Banana bunchy top virus (BBTV) (Burns et al., 1995Down ), Milk vetch dwarf virus (MDV) (Sano et al., 1998Down ) and Faba bean necrotic yellows virus (FBNYV) (Katul et al., 1997Down , 1998Down ). The five principal DNA components of nanoviruses code for five or six proteins which have homologues present in all nanoviruses studied so far. One particular DNA component encodes the ‘master’ Rep that is responsible for replication of all other non-Rep DNAs – the conserved genes for coat protein, putative hydrophobic movement protein, potential nuclear shuttle protein, a cell cycle-linked protein (Clink) and several as yet unidentified genes (Aronson et al., 1999Down ; Wanitchakorn et al., 2000Down ). In total, up to 11 genomic components have been found in some nanoviruses where several additional Rep components are capable of independent replication but cannot support replication of non-Rep DNAs (Katul et al., 1997Down , 1998Down ; Sano et al., 1998Down ; Beetham et al., 1999Down ; Timchenko et al., 1999Down ). CFDV DNA differs from the Rep components of nanoviruses in its slightly larger size (common DNA size for nanoviruses is about 1 kb). In addition, CFDV is transmitted by the planthopper Myndus taffani, whereas typical nanoviruses are persistently transmitted by aphids (Randles et al., 1986Down ; Franz et al., 1999Down ).

Rep of CFDV and nanoviruses contains several sequence motifs similar to those in Reps of plant ssDNA viruses belonging to the family Geminiviridae (Boevink et al., 1995Down ), which are essential for DNA replication (Laufs et al., 1995Down ; Palmer & Rybicki, 1998Down ). Rep catalyses multiple reactions during the replicative cycle of the virus. So far, for nanoviruses only in vitro DNA nicking and joining activity of the BBTV Rep have been described (Hafner et al., 1997Down ). In contrast, much more is known about Reps of geminiviruses [for recent review, see Palmer & Rybicki (1998)Down ]. Geminivirus Rep is a sequence-specific DNA-binding protein (Fontes et al., 1992Down ; Behjatnia et al., 1998Down ; Castellano et al., 1999Down ) and has an ATPase activity which is required for its helicase function and for viral DNA replication (Desbiez et al., 1995Down ). Geminivirus Rep catalyses DNA cleavage and ligation of ssDNA during rolling circle replication. In solution, Rep forms oligomeric complexes and the self-association capability of geminivirus Reps is regulated by ATP (Jupin et al., 1995Down ; Settlage et al., 1996Down ; Orozco et al., 1997Down , 2000Down ; Orozco & Hanley-Bowdoin, 1998Down ; Horvath et al., 1998Down ). In addition, it has been demonstrated that Reps of geminiviruses form complexes with other geminivirus-encoded proteins and proteins from host plants (Xie et al., 1995Down , 1999Down ; Settlage et al., 1996Down ; Ach et al., 1997Down ; Horvath et al., 1998Down ; Liu et al., 1999Down ).

In this paper we report that the CFDV-encoded putative Rep has nucleic acid-binding and ATPase/GTPase activities in vitro and forms di- or oligomers in yeast cells. It was also found that CFDV Rep associated predominantly with nuclei and membrane fractions of plant and insect cells. These findings indicate that the putative Rep of CFDV shares several characteristic features with Reps of geminiviruses.


   Methods
TOP
Abstract
Introduction
Methods
Results and Discussion
References
 
{blacksquare} Cloning of the 6x His-fused CFDV ORF1.
The region of the CFDV genome corresponding to the Rep gene was amplified by PCR using P.f.u.-Turbo DNA polymerase (Stratagene) with oligonucleotides 5' GCGGATCCAAATGGGTTCCTCCATTCGCCG 3' and 5' GCGTCGACTTAAAATATTCCACAGTTTTATTCTGTCCC 3' (restriction sites for BamHI and SalI are underlined) as primers, and a cloned tandem dimer of the full-length CFDV DNA as a template (Chernov et al., 1992Down ). The resulting PCR product was cloned into BamHI/SalI-digested plasmid pSK(+) (Stratagene) to give pSK.Rep, and sequenced. To obtain a clone for expression of the 6x His fusion Rep (6x His–Rep) in E. coli, the BamHI–SalI fragment from pSK.Rep was cloned into BamHI/SalI-digested vector pQE32 (Qiagen) to obtain clone pQE.Rep. This plasmid was used to transform E. coli strain M15 (Stratagene). Expression, purification and refolding of the 6x His–Rep protein was carried out according to the Stratagene protocol.

{blacksquare} Expression of 6x His–Rep in recombinant baculovirus.
To obtain recombinant baculovirus expressing the 6x His fusion protein of CFDV Rep, the EcoRI–Sal fragment from pQE.Rep was cloned into EcoRI/SalI-digested vector pFastBac1 (Gibco BRL) to obtain clone pFastBac.6xHisRep. This clone was used for obtaining recombinant baculovirus, named 6x HisRep-Bac, using the Bac-to-Bac system (Gibco BRL) according to the manufacturer’s protocols. Recombinant baculovirus was amplified and titrated in Sf9 cells. For recombinant 6x His–Rep expression 1x108 High Five cells (Invitrogen) were infected with 6xHisRep-Bac at an m.o.i. of 5 for 48 h at 27 °C. Cells were collected by centrifugation and recombinant protein purification was carried out as described for E. coli-expressed recombinant protein. To obtain the nuclear fraction (N), harvested cells were treated as described by Patterson et al. (1996)Down . Post-mitochondrial pellet (P15, membrane fraction) and supernatant (S15, soluble fraction) were obtained as described by Laakkonen et al. (1994)Down . All protein fractions from E. coli and recombinant baculovirus-infected insect cells were analysed by SDS–PAGE (12% gels) and Western blotting, using monoclonal antibody against the RGS(H)3 epitope (Qiagen).

{blacksquare} ATPase/GTPase assay.
This was done as described previously (Kalinina et al., 1996Down ). Reactions were incubated for 1 h at 37 °C and stopped by addition of EDTA to a final concentration of 20 mM. Unreacted ATP was precipitated by addition of activated charcoal and radioactivity in the supernatant was determined by liquid scintillation counting of Cerenkov radiation.

{blacksquare} Synthesis of radiolabelled RNA and DNA probes.
Labelled RNA transcript was transcribed with T7 RNA polymerase from a cDNA clone of Potato virus A as described by Merits et al. (1998)Down . To obtain labelled dsDNA probes, two fragments of the CFDV genome were used: fragment ApaI–XhoI from the cloned full-length CFDV DNA (570 bp, containing the conserved stem–loop region of CFDV) and the XhoI–SalI fragment from pSK.Rep (580 bp). These fragments were purified from agarose gels, treated with calf intestinal phosphatase and purified using the QIAquick PCR purification kit (Qiagen). One µg of each purified fragment was treated with 10 units of T4 polynucleotide kinase in the presence of 25 µCi [{gamma}-32P]ATP for 1 h at 37 °C. Labelled DNA was purified using the QIAquick nucleotide removal kit (Qiagen).

ssDNA probes of the indicated polarity were obtained using the primer extension reaction on linearized templates. To obtain three different ssDNAs, named ssDNA(+), ssDNA(-) and ssDNA(z), three different templates with corresponding primers were used. For ssDNA(+), representing positive-polarity ssDNA containing the stem–loop region of the CFDV genome, XhoI-linearized plasmid, containing full-length CFDV DNA (Chernov et al., 1992Down ), and primer 5' CAATATGAATCGAGTTATGGGCGGGCCC 3' were used (the ApaI site from the CFDV genome is underlined). To obtain ssDNA(-), complementary to the same sequence, CFDV was linearized by ApaI cleavage and primer 5' CAGGACGAGTCGGGACTCCGTGCTCGAG 3' was used (the XhoI site from the CFDV genome is underlined). To obtain the control, ssDNA(z), plasmid pGEM-3Z (Promega) was linearized by AatII cleavage and primer 5' ATTTAGGTGACACTATAGAATAC 3' (corresponding to the SP6 promoter sequence in the plasmid) was used. ssDNA was synthesized in a reaction mixture consisting of 1 µg of linearized plasmid and 50 pmol of the corresponding primer, 0·25 mM of each dNTP and 5 units of DyNAzyme DNA polymerase (Finnzymes) in DyNAzyme reaction buffer. PCR reactions (25 cycles: 95 °C 30 s, 51 °C 30 s, 72 °C 60 s) were carried out in a thermal cycler, reaction products purified using the QIAquick PCR purification kit (Qiagen), and labelled and purified as described above.

{blacksquare} Nucleic acid binding assay.
The purified recombinant CFDV 6x His–Rep and control proteins [BSA and maltose-binding protein fusion with the {alpha}-fragment of {beta}-galactosidase (MBP)] were electroblotted onto an Immobilon-P (Millipore) membrane after SDS–PAGE in 12% gels. Membranes were blocked and membrane-bound proteins denatured and renatured as described previously (Merits et al., 1998Down ). Membranes were incubated for 2 h at room temperature with 32P-labelled DNA or RNA (1x105 c.p.m./ml) in 10 ml of nucleic acid-binding buffer (20 mM HEPES, 6 mM Tris–HCl, 5 mM MgCl2, 1 mM EDTA, 1 mM DTT, pH 7·0) with or without addition of NaCl. NaCl concentrations of 25, 100, 300 and 500 mM were used to estimate the strength of protein–nucleic acid interactions. Membranes were washed with nucleic acid-binding buffer (with or without addition of NaCl) four times for 30 min, dried, and autoradiographed.

{blacksquare} Yeast two-hybrid system (YTHS).
This was used essentially as described by Vojtek et al. (1993)Down and Hollenberg et al. (1995)Down with modifications described by Guo et al. (1999)Down . To obtain the yeast expression constructs pLexA.Rep and pVP16.Rep, the BamHI–SalI fragment from pSK.Rep was cloned into vectors pLexA and pVP16 (Hollenberg et al., 1995Down ). pLexA encodes the DNA-binding protein LexA and contains a selection marker for tryptophan auxotrophy, whereas pVP16 encodes transcription activation domains and contains a selection marker for leucine auxotrophy. Yeast strain L40 [MATa his3{Delta}200 trp1-901 leu2-3,112 ade2 lys2-801am URA3::(lexAop)8-lacZ] was used for hybrid protein expression. Yeast transformation was performed by the lithium acetate method (Schiestl & Gietz, 1989Down ). Transformants were selected by plating on minimal media lacking leucine and tryptophan. Expression of the {beta}-galactosidase reporter gene was evaluated by freezing colony filter lifts in liquid nitrogen and subsequently staining the filter with X-Gal in Z buffer (60 mM Na2HPO4, 40 mM NaH2PO4, pH 7·0, 10 mM KCl, 1 mM MgSO4, 50 mM {beta}-mercaptoethanol and 0·3 mg/ml X-Gal). Quantitative {beta}-galactosidase activity assays were performed as described by Trawick et al. (1989)Down .

{blacksquare} Transient expression of CFDV Rep in Nicotiana benthamiana cells.
For transient expression in N. benthamiana cells the BamHI–SalI fragment from pSK.Rep was cloned as an N-terminal fusion with the green fluorescent protein gene GFP5 (Haseloff et al., 1997Down ) placed under control of the CaMV 35S RNA promoter. The resulting construct, named p35S.GFP5.Rep, was used in particle bombardment experiments. Particle bombardment was performed using the flying disk method with a high-pressure helium-based apparatus PDS-1000 (Bio-Rad) as described in Morozov et al. (1997)Down . GFP fluorescence was detected by a Zeiss-Axiovert Bio-Rad MRC 1024 confocal laser scanning microscope using a 15 mW krypton–argon excitation laser with excitation light of 488 nm.


   Results and Discussion
TOP
Abstract
Introduction
Methods
Results and Discussion
References
 
Expression and purification of recombinant Rep protein of CFDV
Repeated attempts to express 6x His–Rep in E. coli resulted in the purification of approximately equal amounts of two proteins with apparent molecular masses of 33 and 29 kDa (Fig. 1Down). The 33 kDa protein had the expected molecular mass of 6x His–Rep and represented the full-length product of pQE.REP. Since both proteins bound to Ni–NTA resin and reacted with a monoclonal antibody against the N-terminal epitope of the recombinant protein [RGS(H)3 epitope], we suggest that the 29 kDa protein represents a product of premature termination, possibly due to unfavourable codon usage in E. coli at the C-terminal region of CFDV Rep (Fig. 1Down).



View larger version (78K):
[in this window]
[in a new window]
 
Fig. 1. Expression, purification and immunological detection of CFDV 6x His–Rep. CFDV Reps, expressed in E. coli and in recombinant baculovirus-infected High Five cells, were purified with Ni–NTA resin and analysed by SDS–PAGE in 12% gels. Promega mid-range molecular mass standards in kDa are indicated on the left. The gel was stained with Coomassie brilliant blue. Additionally, 100 ng of purified proteins expressed by E. coli and baculovirus were subjected to SDS–PAGE in 12% gels, Western blotted and probed with monoclonal antibody against the RGS(H)3 epitope. The blot was developed by the ECL procedure (Amersham).

 
When CFDV 6x His–Rep was expressed and purified from recombinant baculovirus, only one main protein band with an apparent molecular mass of 36 kDa was obtained (Fig. 1Up). This molecular mass is bigger than that calculated for 6x His–Rep or observed for the protein expressed in E. coli. Similar to the proteins expressed in E. coli, this recombinant baculovirus-expressed protein also reacted with a monoclonal antibody against the RGS(H)3 epitope (Fig. 1Up). Reasons for the observed mass increase remain to be determined, but one possible reason might be post-translational modification of the protein in insect cells, but not in E. coli cells. Both E. coli- and baculovirus-expressed proteins were used for further in vitro experiments.

Localization of CFDV Rep in insect cells and in N. benthamiana cells
The processing and subcellular localization of recombinant eukaryotic proteins in baculovirus-infected insect cells can be very similar to their localization in the original (or host) cells (Pascal et al., 1994Down ; Patterson et al., 1996Down ). The use of different monoclonal antibodies against N-terminal epitopes of recombinant protein [(H)4, (H)5, (H)6 and RGS(H)3] to immunostain 6x His–Rep expressed in infected Sf9 or High Five cells did not produce consistent results. Typically, fluorescence was close to background levels and showed no specific distribution in the cells (not shown). It is possible that the N-terminal 6x His tag epitope is hidden inside the protein and/or between different subunits of oligomerized protein. In attempts to overcome these difficulties, the infected High Five cells (48 h post-infection) were fractionated and analysed by SDS–PAGE and Western blotting. In these experiments most of the expressed recombinant protein (about 70%) was found in the nuclear fraction of infected cells (Fig. 2Down). Considerable amounts of 6x His–Rep protein were also found in the post-mitochondrial pellet fraction (membrane fraction, about 25% of the recombinant protein) and only small quantities (less than 5% of the recombinant protein) were found in the soluble protein fraction (Fig. 2Down). An alternative method, based on particle bombardment of plant leaves, was also used to study the subcellular distribution of CFDV Rep. When GFP–Rep fusion protein was transiently expressed in the epidermal cells of N. benthamiana leaves, fluorescence was detected predominantly in nuclei and at the cell periphery (Fig. 3ADown–DDown). Free GFP is known to be associated partially with the plant cell nucleus (Reichel et al., 1996Down ). In control experiments with plants expressing non-fused GFP5 gene from the 35S promoter, the distribution of the fluorescence differed from that of GFP–Rep fluorescence (Fig. 3EDown). No specific targeting of fluorescence was observed and the distribution of fluorescence was typical for free GFP in plant cells (Reichel et al., 1996Down ; Morozov et al., 1999Down ). This allowed us to conclude that the distribution of GFP fluorescence, presented in Fig. 3Down(ADown–DDown), reflected the distribution of Rep in the plant cell. Thus, the putative Rep of CFDV is largely associated with the nucleus, the cell compartment where Reps normally exert their functions (Palmer & Rybicki, 1998Down ).



View larger version (36K):
[in this window]
[in a new window]
 
Fig. 2. Distribution of CFDV 6x His–Rep in recombinant baculovirus-infected High Five cell fractions. Each lane corresponds to 15 µg of total protein, subjected to SDS–PAGE in 12% gels and Western blotted. Proteins were detected using monoclonal antibody against the RGS(H)3 epitope and the ECL procedure. Lane 1 contains the nuclear fraction, lane 2 contains the post-mitochondrial pellet fraction and lane 3 contains the post-mitochondrial supernatant fraction. New England Biolabs prestained molecular mass standards were used (mol. mass in kDa is indicated on the left).

 


View larger version (116K):
[in this window]
[in a new window]
 
Fig. 3. Fluorescence microscopy of transformed N. benthamiana epidermal cells transiently expressing GFP fusion of CFDV Rep. (A)–(D), association of fluorescence with the nucleus and elements of the cell endomembrane system including the nuclear envelope in cells expressing the GFP–Rep protein. (A, C), cell images reconstructed by superimposition of a series of confocal optical sections. (B), the central confocal optical section of the same cell as in (A). (D), the central confocal optical section of the same cell as in (C). (E), image of a cell expressing free GFP. Scale bar in (B), (D) and (E) represents 50 µm.

 
CFDV Rep protein is self-interacting in the yeast nucleus
To study the capability of CFDV Rep to form di- and oligomers, the corresponding gene was cloned in the YTHS vectors pLexA and pVP16. The {beta}-galactosidase activity present in yeast transformants was used as an indicator of interactions between fusion protein partners. When both plasmids carrying CDFV Rep (pLexA and pVP16) were co-transformed into yeast cells, double transformants showed high {beta}-galactosidase activity as indicated by the appearance of blue colonies. The colonies turned blue after staining for less than 2 h, indicating a strong interaction between the proteins. The strength of the CFDV Rep:Rep interaction was confirmed by quantitative {beta}-galactosidase activity assay. No {beta}-galactosidase activity was detected in yeast transformed with one plasmid only or with a plasmid containing CFDV Rep and an empty vector (Table 1Down). Thus we conclude that CFDV Rep is capable of di- or oligomer formation similar to Reps of geminiviruses, homo-oligomers of which are important for carrying out different functions in the regulation of virus replication and transcription (Jupin et al., 1995Down ; Settlage et al., 1996Down ; Orozco et al., 1997Down , 2000Down ; Orozco & Hanley-Bowdoin, 1998Down ; Horvath et al., 1998Down ).


View this table:
[in this window]
[in a new window]
 
Table 1. Homotypic interactions of the CFDV Rep as detected by the yeast two-hybrid system

 
NTPase activity of CFDV Rep
ATPase activity is an intrinsic property of geminivirus Reps (Desbiez et al., 1995Down ). To examine further activities associated with CFDV Rep, an in vitro assay for NTPase activity was carried out using purified bacterially and baculovirus-expressed CFDV 6x His–Rep (Fig. 1Up). First, it was found that recombinant CFDV Rep is capable of ATP and GTP hydrolysis (Fig. 4Down). This activity was detected for both E. coli- and baculovirus-expressed proteins. These ATPase and GTPase activities were not stimulated by ssRNA, ssDNA and dsDNA (data not shown), but did require the presence of divalent cations in the reaction. Maximal stimulation of NTPase activity was observed in the presence of 5 mM Mg2+, and to a lesser extent by 5 mM Mn2+; 5 mM Ca2+ had only minor stimulatory effect (Fig. 4Down).



View larger version (27K):
[in this window]
[in a new window]
 
Fig. 4. ATPase and GTPase activities of the E. coli-expressed CFDV 6x His–Rep and their dependence on the presence of divalent cations in the reaction. Reaction products were separated by TLC and the plate was exposed to X-ray film. Positions of NTP substrates and Pi are marked by arrows at the right. Lane 1 on both panels represents the products of a control reaction (no 6x His–Rep added); lane 2 represents products of reaction with 6x His–Rep without divalent cations; lanes 3, 4 and 5 represent products of reaction in the presence of 5 mM Mg2+, Ca2+ or Mn2+, respectively.

 
Nucleic acid-binding properties of CFDV Rep
In low salt conditions (up to 150 mM NaCl) CFDV 6x His–Rep was found to bind non-specifically to ssRNA, dsDNA and ssDNA (Fig. 5ADown–HDown, left-hand panels). The dsDNA binding was observed only if the assay was carried out in low salt conditions (Fig. 5BDown, DDown, left-hand panels). CFDV Rep complexes with dsDNA were dissociated almost completely in the presence of 300 mM NaCl whether or not the dsDNA contained the conserved stem–loop region (Fig. 5BDown, DDown, right-hand panels). If the same dsDNA probes were denatured by boiling and then cooled on ice before adding to the binding reaction, the nucleic acid–protein complexes were stable in 0·3 M NaCl (Fig. 5CDown, EDown, right-hand panels) and even in 0·5 M NaCl (data not shown). These data indicate that CFDV 6x His–Rep binding to ssDNA is significantly stronger than to dsDNA. To examine, whether ssDNA binding of CFDV Rep is strand- or sequence-specific, three ssDNA probes, ssDNA(+), ssDNA(-) and ssDNA(z), were tested in the same assay. No difference in complex formation activity or complex stability was observed, indicating that CFDV 6x His–Rep behaves as a sequence non-specific ssDNA-binding protein (Fig. 5FDown, GDown, HDown). The RNA-binding ability of CFDV 6x His–Rep protein was found to be rather weak. CFDV 6x His–Rep bound unrelated RNA under low salt conditions (Fig. 5ADown, left-hand panel) but 6x His–Rep:RNA complexes were completely dissociated in the presence of 0·3 M NaCl (Fig. 5ADown, right-hand panel). Thus, CFDV 6x His–Rep binds different types of nucleic acids in a sequence non-specific manner, and complexes formed with ssDNA are much more stable than with dsDNA or RNA. No complex formation with any nucleic acid probes was detected for control proteins (BSA, MBP) or proteins from molecular mass standards under identical conditions (Fig. 5ADown–HDown). Importantly, no significant differences in DNA-binding properties between baculovirus- and E. coli-expressed proteins were observed in these assays.



View larger version (21K):
[in this window]
[in a new window]
 
Fig. 5. Autoradiography of the nucleic acid-binding blots of purified CFDV 6x His–Rep. The left half of each panel (A–H) represents binding in the presence of 25 mM NaCl; the right half represents binding in the presence of 300 mM NaCl. Lane 1 contains 1 µg BSA, lane 2 contains 1 µg MBP, lane 3 contains 1 µg E. coli-expressed 6x His–Rep, lane 4 contains 1 µg baculovirus-expressed 6x His–Rep and lane 5 corresponds to New England Biolabs pre-stained molecular mass markers. An identical gel, designated SDS, which was stained with Coomassie blue, is shown at the top of the figure. The following probes were used: (A) RNA transcript of Potato virus A cDNA clone; (B) dsDNA fragment (570 bp), containing the stem–loop region; (C) denatured DNA fragment (570 bp), containing the stem–loop region; (D) dsDNA fragment (580 bp), without the stem–loop region; (E) denatured DNA fragment (580 bp), without the stem–loop region; (F) ssDNA(+) of CFDV; (G) ssDNA(-) of CFDV; (H) ssDNA(z) from plasmid pGEM-3Z.

 
Recently, a novel Rep-encoding nanovirus-like DNA component, similar to CFDV in size and genetic organization, was found to be associated with plants infected with Cotton leaf curl virus (CLCuV), a member of the genus Begomovirus (Mansoor et al., 1999Down ). This Rep and CFDV Rep are phylogenetically only distantly related to the nanovirus master Reps, which form a distinct cluster (H. J. Vetten, personal communication). A dimer of CLCuV-associated DNA, introduced biolistically into tobacco plants, was shown to replicate autonomously (Mansoor et al., 1999Down ). However, in the case of tandem dimers of CFDV DNA that were cloned previously (Chernov et al., 1992Down ), we never observed replication in electroporated protoplasts or bombarded leaf cells of several non-host plants (A. Merits, unpublished data). These data suggested that the published CFDV DNA clone may contain a non-functional Rep pseudogene as was found in some BBTV Rep-related DNAs (Yeh et al., 1994Down ; Merits et al., 1995Down ). However, our findings on the subcellular distribution, oligomerization and in vitro biochemical activities allow us to conclude that CDFV ORF1 indeed encodes an enzymatically active Rep that shares some properties with to the Reps of geminiviruses and nanoviruses.


   Acknowledgments
 
The authors thank Viiu Paalme and Darya Rakitina for experimental help and Dr H. J. Vetten and Professor Mart Saarma for critical reading of the manuscript. This study was supported by grant ETF no.1516 from the Estonian Science Foundation.


   References
TOP
Abstract
Introduction
Methods
Results and Discussion
References
 
Ach, R. A., Durfee, T., Miller, A. B., Taranto, P., Hanley-Bowdoin, L., Zambryski, P. C. & Gruissem, W.(1997). RRB1 and RRB2 encode maize retinoblastoma-related proteins that interact with a plant D-type cyclin and geminivirus replication protein.Molecular and Cellular Biology17, 5077-5086.[Abstract]

Aronson, M., Meyer, A. D., Györgyey, J., Katul, L., Vetten, H. J., Gronenborn, B. & Timchenko, T.(1999). Clink, a nanovirus-encoded protein, binds both pRB and SKP1.Journal of Virology74, 2967-2772.[Abstract/Free Full Text]

Beetham, P. R., Harding, R. M. & Dale, J. L.(1999). Banana bunchy top virus DNA-2 to 6 are monocistronic.Archives of Virology144, 89-105.[Medline]

Behjatnia, S. A. A., Dry, I. B. & Rezaian, M. A.(1998). Identification of the replication-associated protein binding domain within the intergenic region of tomato leaf curl geminivirus.Nucleic Acids Research26, 925-931.[Abstract/Free Full Text]

Boevink, P., Chu, P. W. & Keese, P.(1995). Sequence of the subterranean clover stunt virus DNA: affinities with the geminiviruses.Virology207, 354-361.[Medline]

Burns, T. M., Harding, R. M. & Dale, J. D.(1995). The genome organization of banana bunchy top virus: analysis of six ssDNA components. Journal of General Virology76, 1471-1482.[Abstract/Free Full Text]

Castellano, M. M., Sanz-Burgos, A. P. & Gutierrez, C.(1999). Initiation of DNA replication in a eukaryotic rolling-circle replicon: identification of multiple DNA–protein complexes at the geminivirus origin.Journal of Molecular Biology290, 639-652.[Medline]

Chernov, B. K., Merits. A., Mizenina, O. A. & Morozov, S. Yu. (1992). Chemical-enzymatic synthesis and cloning of the full-length genome of a DNA-containing plant virus. Bioorganicheskaja Khimija 12, 1487–1495 (in Russian).

Desbiez, C., David, C., Mettouchi, A., Laufs, J. & Gronenborn, B.(1995). Rep protein of tomato yellow leaf curl geminivirus has an ATPase activity required for viral DNA replication.Proceedings of the National Academy of Sciences, USA92, 5640-5644.[Abstract/Free Full Text]

Fontes, E. P., Luckow, V. A. & Hanley-Bowdoin, L.(1992). A geminivirus replication protein is a sequence-specific DNA binding protein.Plant Cell5, 597-608.

Franz, A. W. E., van der Wilk, F., Verbeek, M., Dullemans, A. M. & van den Heuvel, J. F. J. M.(1999). Faba bean necrotic yellows virus (genus Nanovirus) requires a helper factor for its aphid transmission. Virology262, 210-219.[Medline]

Gorbalenya, A. E., Koonin, E. V. & Wolf, Y. I.(1990). A new superfamily of putative NTP-binding domains encoded by genomes of small DNA and RNA viruses.FEBS Letters262, 145-148.[Medline]

Guo, D., Merits, A. & Saarma, M.(1999). Self-association and mapping of the interaction domains of helper component-proteinase of potato A potyvirus.Journal of General Virology80, 1127-1131.[Abstract]

Hafner, G. J., Stafford, M. R., Wolter, L. C., Harding, R. M. & Dale, J. L.(1997). Nicking and joining activity of banana bunchy top virus replication protein in vitro.Journal of General Virology79, 1795-1799.

Haseloff, J., Siemering, K. R., Prasher, D. C. & Hodge, S.(1997). Removal of a cryptic intron and subcellular localization of green fluorescent protein are required to mark transgenic Arabidopsis plants brightly.Proceedings of the National Academy of Sciences, USA94, 2122-2127.[Abstract/Free Full Text]

Hehn, A. & Rohde, W.(1998). Characterization of cis-acting elements affecting strength and phloem specificity of the coconut foliar decay virus promoter.Journal of General Virology79, 1495-1499.[Abstract]

Hollenberg, S. M., Sternglanz, R., Cheng, P. F. & Weintraub, H.(1995). Identification of a new family of tissue-specific basic helix-loop-helix proteins with a two-hybrid system.Molecular and Cellular Biology15, 3813-3822.[Abstract]

Horvath, G. V., Pettko-Szabdtner, A., Nikovics, K., Bilgin, M., Boulton, M., Davies, J. W., Gutierrez, C. & Dudits, D.(1998). Prediction of functional regions of the maize streak virus replication associated proteins by protein–protein interaction analysis.Plant Molecular Biology38, 699-712.[Medline]

Jupin, I., Hericourt, F., Benz, B. & Gronenborn, B.(1995). DNA replication specificity of TYLCV geminivirus is mediated by the amino-terminal 116 amino acids of the Rep protein.FEBS Letters362, 116-120.[Medline]

Kalinina, N. A., Fedorkin, O. N., Samuilova, O. V., Maiss, E., Korpela, T., Morozov, S. Yu. & Atabekov, J. G.(1996). Expression and biochemical analysis of the recombinant potato virus X 25K movement protein.FEBS Letters397, 75-78.[Medline]

Katul, L., Maiss, E., Morozov, S. Yu. & Vetten, H. J.(1997). Analysis of six DNA components of the faba bean necrotic yellows virus genome and their structural affinity to related plant virus genomes.Virology233, 247-259.[Medline]

Katul, L., Timchenko, T., Gronenborn, B. & Vetten, H. J.(1998). Ten distinct circular ssDNA components, four of which encode putative replication-associated proteins, are associated with the faba bean necrotic yellows virus genome.Journal of General Virology79, 3101-3109.[Abstract]

Laakkonen, P., Hyvönen, M., Peränen, J. & Kääriäinen, L.(1994). Expression of Semliki Forest virus nsP1-specific methyltransferase in insect cells and in Escherichia coli.Journal of Virology68, 7418-7425.[Abstract/Free Full Text]

Laufs, J., Traut, W., Heyraud, F., Matzeit, V., Rogers, S. G., Schell, J. & Gronenborn, B.(1995). In vitro cleavage and joining at the viral origin of replication by the replication initiator protein of tomato yellow leaf curl virus.Proceedings of the National Academy of Sciences, USA92, 3879-3883.[Abstract/Free Full Text]

Liu, L., Saunders, K., Thomas, C. L., Davies, J. W. & Stanley, J.(1999). Bean yellow dwarf virus RepA, but not Rep, binds to maize retinoblastoma protein, and the virus tolerates mutations in the consensus binding motif.Virology256, 270-279.[Medline]

Mansoor, S., Khan, S. H., Bashir, A., Saeed, M., Zafar, Y., Malik, K. A., Briddon, R., Stanley, J. & Markham, P. G.(1999). Identification of a novel circular single-stranded DNA associated with cotton leaf curl disease in Pakistan.Virology259, 190-199.[Medline]

Merits, A., Zelenina, D. A., Mizenina, O. A., Chernov, B. K. & Morozov, S. Yu.(1995). Poly(A) addition site mapping and polyadenylation signal analysis in a plant circovirus replication related gene.Virology211, 345-349.[Medline]

Merits, A., Guo, D. & Saarma, M(1998). VPg, coat protein and five non-structural proteins of potato A potyvirus bind RNA in a sequence-unspecific manner.Journal of General Virology79, 3123-3127.[Abstract]

Morozov, S. Yu., Fedorkin, O. N., Jüttner, G., Schiemann, J., Baulcombe, D. & Atabekov, J. G.(1997). Complementation of a potato virus X mutant mediated by bombardment of plant tissues with cloned viral movement protein genes.Journal of General Virology78, 2077-2083.[Abstract]

Morozov, S. Yu., Solovyev, A. G., Kalinina, N. O., Fedorkin, O. N., Samuilova, O. V., Schiemann, J. & Atabekov, J. G.(1999). Evidence for two nonoverlapping functional domains in the potato virus X 25K movement protein.Virology260, 55-63.[Medline]

Orozco, B. M. & Hanley-Bowdoin, L.(1998). Conserved sequence and structural motifs contribute to the DNA binding and cleavage activities of geminivirus replication protein.Journal of Biological Chemistry273, 24448-24456.[Abstract/Free Full Text]

Orozco, B. M., Miller, A. B., Settlage, S. B. & Hanley-Bowdoin, L.(1997). Functional domains of a geminivirus replication protein.Journal of Biological Chemistry272, 9840-9846.[Abstract/Free Full Text]

Orozco, B. M., Kong, L. J., Batts, L. A., Elledge, S. & Hanley-Bowdoin, L.(2000). The multifunctional character of a geminivirus replication protein is reflected by its complex oligomerization properties.Journal of Biological Chemistry275, 614-6122.

Palmer, K. E. & Rybicki, E. P.(1998). The molecular biology of mastreviruses.Advances in Virus Research50, 183-234.[Medline]

Pascal, E., Sanderfoot, A. A., Ward, B. M., Medville, R., Turgeon, R. & Lazarowitz, S. G.(1994). The geminivirus BR1 movement protein binds single-stranded DNA and localizes to the cell nucleus.Plant Cell7, 995-1006.

Patterson, R. M., He, C., Selkirk, J. K. & Merrick, A. B.(1996). Human p53 expressed in baculovirus-infected Sf9 cells displays a two-dimensional isoform pattern identical to wild-type p53 from human cells.Archives of Biochemistry and Biophysics 330, 71-79.[Medline]

Randles, J. W., Julia, J. F., Calvez, C. & Dollet, M.(1986). Association of single-stranded DNA with the foliar decay disease of coconut palm in Vanuatu. Phytopathology76, 889-894.

Reichel, C., Mathur, J., Eckes, P., Langenkemper, K., Koncz, C., Schell, J., Reiss, B. & Maas, C.(1996). Enhanced green fluorescence by the expression of an Aequorea victoria green fluorescent protein mutant in mono- and dicotyledonous plant cells.Proceedings of the National Academy of Sciences, USA93, 12643-12647.[Abstract/Free Full Text]

Rohde, W., Randles, J. W., Langridge, P. & Hanold, D.(1990). Nucleotide sequence of a circular single-stranded DNA associated with coconut foliar decay virus.Virology176, 648-651.[Medline]

Rohde, W., Becker, D. & Randles, J. W.(1995). The promoter of coconut foliar decay-associated circular single-stranded DNA directs phloem-specific reporter gene expression in transgenic tobacco.Plant Molecular Biology27, 623-628.[Medline]

Sano, Y., Wada, M., Hasimoto, Y., Matsumoto, T. & Kojima, M.(1998). Sequences of ten circular ssDNA components associated with the milk vetch dwarf virus genome. Journal of General Virology79, 3111-3118.[Abstract]

Schiestl, R. H. & Gietz, R. D.(1989). High efficiency transformation of intact yeast cells using single stranded nucleic acids as a carrier.Current Genetics16, 339-346.[Medline]

Settlage, S. B., Miller, A. B. & Hanley-Bowdoin, L.(1996). Interactions between geminivirus replication proteins.Journal of Virology70, 6790-6795.[Abstract/Free Full Text]

Timchenko, T., de Kouchkovsky, F., Katul, L., David, C., Vetten, H. J. & Gronenborn, B.(1999). A single rep protein initiates replication of multiple genome components of faba bean necrotic yellows virus, a single-stranded DNA virus of plants.Journal of Virology73, 10173-10182.[Abstract/Free Full Text]

Trawick, J. D., Wright, R. M. & Poyton, R. O.(1989). Transcription of yeast COX6, the gene for cytochrome c oxidase subunit VI, is dependent on heme and on the HAP2 gene.Journal of Biological Chemistry264, 7005-7008.[Abstract/Free Full Text]

Vojtek, A. B, Hollenberg, S. M. & Cooper, J. A.(1993). Mammalian Ras interacts directly with the serine/threonine kinase Raf. Cell174, 205-214.

Wanitchakorn, R., Hafner, G. J., Harding, R. M. & Dale, J. L.(2000). Functional analysis of proteins encoded by banana bunchy top virus DNA-4 to -6. Journal of General Virology81, 299-306.[Abstract/Free Full Text]

Xie, Q., Suarez-Lopez, P. & Gutierrez, C.(1995). Identification and analysis of a retinoblastoma binding motif in the replication protein of a plant DNA virus: requirement for efficient viral DNA replication. EMBO Journal14, 4073-4082.[Medline]

Xie, Q., Sanz-Burgos, A. P., Guo, H., Garcia, J. A. & Gutierrez, C.(1999). GRAB proteins, novel members of the NAC domain family, isolated by their interaction with a geminivirus protein.Plant Molecular Biology39, 647-656.[Medline]

Yeh, H.-H., Su, H.-J. & Chao, Y.-C.(1994). Genome characterization and identification of viral-associated DNA component of banana bunchy top virus.Virology198, 645-652.[Medline]

Received 17 May 2000; accepted 11 August 2000.



This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via CrossRef
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Merits, A.
Right arrow Articles by Morozov, S. Yu.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Merits, A.
Right arrow Articles by Morozov, S. Yu.
Agricola
Right arrow Articles by Merits, A.
Right arrow Articles by Morozov, S. Yu.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
INT J SYST EVOL MICROBIOL MICROBIOLOGY J GEN VIROL
J MED MICROBIOL ALL SGM JOURNALS