|
|
||||||||
Plant |
National Institute of Chemical Physics and Biophysics, Akadeemia tee 23, EE12618 Tallinn, Estonia1
Institute of Biotechnology, Viikki Biocenter, University of Helsinki, PO Box 56, FIN-00014 Helsinki, Finland2
Department of Virology and A. N. Belozersky Institute of Physico-Chemical Biology, Moscow State University, Moscow 119899, Russia3
Author for correspondence: Andres Merits (at the Viikki Biocenter). Fax +358 9 191959366. e-mail Merits{at}operoni.helsinki.fi
| Abstract |
|---|
|
|
|---|
| Introduction |
|---|
|
|
|---|
Rep of CFDV and nanoviruses contains several sequence motifs similar to those in Reps of plant ssDNA viruses belonging to the family Geminiviridae (Boevink et al., 1995
), which are essential for DNA replication (Laufs et al., 1995
; Palmer & Rybicki, 1998
). Rep catalyses multiple reactions during the replicative cycle of the virus. So far, for nanoviruses only in vitro DNA nicking and joining activity of the BBTV Rep have been described (Hafner et al., 1997
). In contrast, much more is known about Reps of geminiviruses [for recent review, see Palmer & Rybicki (1998)
]. Geminivirus Rep is a sequence-specific DNA-binding protein (Fontes et al., 1992
; Behjatnia et al., 1998
; Castellano et al., 1999
) and has an ATPase activity which is required for its helicase function and for viral DNA replication (Desbiez et al., 1995
). Geminivirus Rep catalyses DNA cleavage and ligation of ssDNA during rolling circle replication. In solution, Rep forms oligomeric complexes and the self-association capability of geminivirus Reps is regulated by ATP (Jupin et al., 1995
; Settlage et al., 1996
; Orozco et al., 1997
, 2000
; Orozco & Hanley-Bowdoin, 1998
; Horvath et al., 1998
). In addition, it has been demonstrated that Reps of geminiviruses form complexes with other geminivirus-encoded proteins and proteins from host plants (Xie et al., 1995
, 1999
; Settlage et al., 1996
; Ach et al., 1997
; Horvath et al., 1998
; Liu et al., 1999
).
In this paper we report that the CFDV-encoded putative Rep has nucleic acid-binding and ATPase/GTPase activities in vitro and forms di- or oligomers in yeast cells. It was also found that CFDV Rep associated predominantly with nuclei and membrane fractions of plant and insect cells. These findings indicate that the putative Rep of CFDV shares several characteristic features with Reps of geminiviruses.
| Methods |
|---|
|
|
|---|
Cloning of the 6x His-fused CFDV ORF1.
Expression of 6x HisRep in recombinant baculovirus.
To obtain recombinant baculovirus expressing the 6x His fusion protein of CFDV Rep, the EcoRISal fragment from pQE.Rep was cloned into EcoRI/SalI-digested vector pFastBac1 (Gibco BRL) to obtain clone pFastBac.6xHisRep. This clone was used for obtaining recombinant baculovirus, named 6x HisRep-Bac, using the Bac-to-Bac system (Gibco BRL) according to the manufacturers protocols. Recombinant baculovirus was amplified and titrated in Sf9 cells. For recombinant 6x HisRep expression 1x108 High Five cells (Invitrogen) were infected with 6xHisRep-Bac at an m.o.i. of 5 for 48 h at 27 °C. Cells were collected by centrifugation and recombinant protein purification was carried out as described for E. coli-expressed recombinant protein. To obtain the nuclear fraction (N), harvested cells were treated as described by Patterson et al. (1996)
. Post-mitochondrial pellet (P15, membrane fraction) and supernatant (S15, soluble fraction) were obtained as described by Laakkonen et al. (1994)
. All protein fractions from E. coli and recombinant baculovirus-infected insect cells were analysed by SDSPAGE (12% gels) and Western blotting, using monoclonal antibody against the RGS(H)3 epitope (Qiagen).
ATPase/GTPase assay.
This was done as described previously (Kalinina et al., 1996
). Reactions were incubated for 1 h at 37 °C and stopped by addition of EDTA to a final concentration of 20 mM. Unreacted ATP was precipitated by addition of activated charcoal and radioactivity in the supernatant was determined by liquid scintillation counting of Cerenkov radiation.
Synthesis of radiolabelled RNA and DNA probes.
Labelled RNA transcript was transcribed with T7 RNA polymerase from a cDNA clone of Potato virus A as described by Merits et al. (1998)
. To obtain labelled dsDNA probes, two fragments of the CFDV genome were used: fragment ApaIXhoI from the cloned full-length CFDV DNA (570 bp, containing the conserved stemloop region of CFDV) and the XhoISalI fragment from pSK.Rep (580 bp). These fragments were purified from agarose gels, treated with calf intestinal phosphatase and purified using the QIAquick PCR purification kit (Qiagen). One µg of each purified fragment was treated with 10 units of T4 polynucleotide kinase in the presence of 25 µCi [
-32P]ATP for 1 h at 37 °C. Labelled DNA was purified using the QIAquick nucleotide removal kit (Qiagen).
ssDNA probes of the indicated polarity were obtained using the primer extension reaction on linearized templates. To obtain three different ssDNAs, named ssDNA(+), ssDNA(-) and ssDNA(z), three different templates with corresponding primers were used. For ssDNA(+), representing positive-polarity ssDNA containing the stemloop region of the CFDV genome, XhoI-linearized plasmid, containing full-length CFDV DNA (Chernov et al., 1992
), and primer 5' CAATATGAATCGAGTTATGGGCGGGCCC 3' were used (the ApaI site from the CFDV genome is underlined). To obtain ssDNA(-), complementary to the same sequence, CFDV was linearized by ApaI cleavage and primer 5' CAGGACGAGTCGGGACTCCGTGCTCGAG 3' was used (the XhoI site from the CFDV genome is underlined). To obtain the control, ssDNA(z), plasmid pGEM-3Z (Promega) was linearized by AatII cleavage and primer 5' ATTTAGGTGACACTATAGAATAC 3' (corresponding to the SP6 promoter sequence in the plasmid) was used. ssDNA was synthesized in a reaction mixture consisting of 1 µg of linearized plasmid and 50 pmol of the corresponding primer, 0·25 mM of each dNTP and 5 units of DyNAzyme DNA polymerase (Finnzymes) in DyNAzyme reaction buffer. PCR reactions (25 cycles: 95 °C 30 s, 51 °C 30 s, 72 °C 60 s) were carried out in a thermal cycler, reaction products purified using the QIAquick PCR purification kit (Qiagen), and labelled and purified as described above.
Nucleic acid binding assay.
The purified recombinant CFDV 6x HisRep and control proteins [BSA and maltose-binding protein fusion with the
-fragment of
-galactosidase (MBP)] were electroblotted onto an Immobilon-P (Millipore) membrane after SDSPAGE in 12% gels. Membranes were blocked and membrane-bound proteins denatured and renatured as described previously (Merits et al., 1998
). Membranes were incubated for 2 h at room temperature with 32P-labelled DNA or RNA (1x105 c.p.m./ml) in 10 ml of nucleic acid-binding buffer (20 mM HEPES, 6 mM TrisHCl, 5 mM MgCl2, 1 mM EDTA, 1 mM DTT, pH 7·0) with or without addition of NaCl. NaCl concentrations of 25, 100, 300 and 500 mM were used to estimate the strength of proteinnucleic acid interactions. Membranes were washed with nucleic acid-binding buffer (with or without addition of NaCl) four times for 30 min, dried, and autoradiographed.
Yeast two-hybrid system (YTHS).
This was used essentially as described by Vojtek et al. (1993)
and Hollenberg et al. (1995)
with modifications described by Guo et al. (1999)
. To obtain the yeast expression constructs pLexA.Rep and pVP16.Rep, the BamHISalI fragment from pSK.Rep was cloned into vectors pLexA and pVP16 (Hollenberg et al., 1995
). pLexA encodes the DNA-binding protein LexA and contains a selection marker for tryptophan auxotrophy, whereas pVP16 encodes transcription activation domains and contains a selection marker for leucine auxotrophy. Yeast strain L40 [MATa his3
200 trp1-901 leu2-3,112 ade2 lys2-801am URA3::(lexAop)8-lacZ] was used for hybrid protein expression. Yeast transformation was performed by the lithium acetate method (Schiestl & Gietz, 1989
). Transformants were selected by plating on minimal media lacking leucine and tryptophan. Expression of the
-galactosidase reporter gene was evaluated by freezing colony filter lifts in liquid nitrogen and subsequently staining the filter with X-Gal in Z buffer (60 mM Na2HPO4, 40 mM NaH2PO4, pH 7·0, 10 mM KCl, 1 mM MgSO4, 50 mM
-mercaptoethanol and 0·3 mg/ml X-Gal). Quantitative
-galactosidase activity assays were performed as described by Trawick et al. (1989)
.
Transient expression of CFDV Rep in Nicotiana benthamiana cells.
For transient expression in N. benthamiana cells the BamHISalI fragment from pSK.Rep was cloned as an N-terminal fusion with the green fluorescent protein gene GFP5 (Haseloff et al., 1997
) placed under control of the CaMV 35S RNA promoter. The resulting construct, named p35S.GFP5.Rep, was used in particle bombardment experiments. Particle bombardment was performed using the flying disk method with a high-pressure helium-based apparatus PDS-1000 (Bio-Rad) as described in Morozov et al. (1997)
. GFP fluorescence was detected by a Zeiss-Axiovert Bio-Rad MRC 1024 confocal laser scanning microscope using a 15 mW kryptonargon excitation laser with excitation light of 488 nm.
| Results and Discussion |
|---|
|
|
|---|
|
Localization of CFDV Rep in insect cells and in N. benthamiana cells
The processing and subcellular localization of recombinant eukaryotic proteins in baculovirus-infected insect cells can be very similar to their localization in the original (or host) cells (Pascal et al., 1994
; Patterson et al., 1996
). The use of different monoclonal antibodies against N-terminal epitopes of recombinant protein [(H)4, (H)5, (H)6 and RGS(H)3] to immunostain 6x HisRep expressed in infected Sf9 or High Five cells did not produce consistent results. Typically, fluorescence was close to background levels and showed no specific distribution in the cells (not shown). It is possible that the N-terminal 6x His tag epitope is hidden inside the protein and/or between different subunits of oligomerized protein. In attempts to overcome these difficulties, the infected High Five cells (48 h post-infection) were fractionated and analysed by SDSPAGE and Western blotting. In these experiments most of the expressed recombinant protein (about 70%) was found in the nuclear fraction of infected cells (Fig. 2
). Considerable amounts of 6x HisRep protein were also found in the post-mitochondrial pellet fraction (membrane fraction, about 25% of the recombinant protein) and only small quantities (less than 5% of the recombinant protein) were found in the soluble protein fraction (Fig. 2
). An alternative method, based on particle bombardment of plant leaves, was also used to study the subcellular distribution of CFDV Rep. When GFPRep fusion protein was transiently expressed in the epidermal cells of N. benthamiana leaves, fluorescence was detected predominantly in nuclei and at the cell periphery (Fig. 3A
D
). Free GFP is known to be associated partially with the plant cell nucleus (Reichel et al., 1996
). In control experiments with plants expressing non-fused GFP5 gene from the 35S promoter, the distribution of the fluorescence differed from that of GFPRep fluorescence (Fig. 3E
). No specific targeting of fluorescence was observed and the distribution of fluorescence was typical for free GFP in plant cells (Reichel et al., 1996
; Morozov et al., 1999
). This allowed us to conclude that the distribution of GFP fluorescence, presented in Fig. 3
(A
D
), reflected the distribution of Rep in the plant cell. Thus, the putative Rep of CFDV is largely associated with the nucleus, the cell compartment where Reps normally exert their functions (Palmer & Rybicki, 1998
).
|
|
-galactosidase activity present in yeast transformants was used as an indicator of interactions between fusion protein partners. When both plasmids carrying CDFV Rep (pLexA and pVP16) were co-transformed into yeast cells, double transformants showed high
-galactosidase activity as indicated by the appearance of blue colonies. The colonies turned blue after staining for less than 2 h, indicating a strong interaction between the proteins. The strength of the CFDV Rep:Rep interaction was confirmed by quantitative
-galactosidase activity assay. No
-galactosidase activity was detected in yeast transformed with one plasmid only or with a plasmid containing CFDV Rep and an empty vector (Table 1
|
|
|
| Acknowledgments |
|---|
| References |
|---|
|
|
|---|
Aronson, M., Meyer, A. D., Györgyey, J., Katul, L., Vetten, H. J., Gronenborn, B. & Timchenko, T.(1999). Clink, a nanovirus-encoded protein, binds both pRB and SKP1.Journal of Virology74, 2967-2772.
Beetham, P. R., Harding, R. M. & Dale, J. L.(1999). Banana bunchy top virus DNA-2 to 6 are monocistronic.Archives of Virology144, 89-105.[Medline]
Behjatnia, S. A. A., Dry, I. B. & Rezaian, M. A.(1998). Identification of the replication-associated protein binding domain within the intergenic region of tomato leaf curl geminivirus.Nucleic Acids Research26, 925-931.
Boevink, P., Chu, P. W. & Keese, P.(1995). Sequence of the subterranean clover stunt virus DNA: affinities with the geminiviruses.Virology207, 354-361.[Medline]
Burns, T. M., Harding, R. M. & Dale, J. D.(1995). The genome organization of banana bunchy top virus: analysis of six ssDNA components. Journal of General Virology76, 1471-1482.
Castellano, M. M., Sanz-Burgos, A. P. & Gutierrez, C.(1999). Initiation of DNA replication in a eukaryotic rolling-circle replicon: identification of multiple DNAprotein complexes at the geminivirus origin.Journal of Molecular Biology290, 639-652.[Medline]
Chernov, B. K., Merits. A., Mizenina, O. A. & Morozov, S. Yu. (1992). Chemical-enzymatic synthesis and cloning of the full-length genome of a DNA-containing plant virus. Bioorganicheskaja Khimija 12, 14871495 (in Russian).
Desbiez, C., David, C., Mettouchi, A., Laufs, J. & Gronenborn, B.(1995). Rep protein of tomato yellow leaf curl geminivirus has an ATPase activity required for viral DNA replication.Proceedings of the National Academy of Sciences, USA92, 5640-5644.
Fontes, E. P., Luckow, V. A. & Hanley-Bowdoin, L.(1992). A geminivirus replication protein is a sequence-specific DNA binding protein.Plant Cell5, 597-608.
Franz, A. W. E., van der Wilk, F., Verbeek, M., Dullemans, A. M. & van den Heuvel, J. F. J. M.(1999). Faba bean necrotic yellows virus (genus Nanovirus) requires a helper factor for its aphid transmission. Virology262, 210-219.[Medline]
Gorbalenya, A. E., Koonin, E. V. & Wolf, Y. I.(1990). A new superfamily of putative NTP-binding domains encoded by genomes of small DNA and RNA viruses.FEBS Letters262, 145-148.[Medline]
Guo, D., Merits, A. & Saarma, M.(1999). Self-association and mapping of the interaction domains of helper component-proteinase of potato A potyvirus.Journal of General Virology80, 1127-1131.[Abstract]
Hafner, G. J., Stafford, M. R., Wolter, L. C., Harding, R. M. & Dale, J. L.(1997). Nicking and joining activity of banana bunchy top virus replication protein in vitro.Journal of General Virology79, 1795-1799.
Haseloff, J., Siemering, K. R., Prasher, D. C. & Hodge, S.(1997). Removal of a cryptic intron and subcellular localization of green fluorescent protein are required to mark transgenic Arabidopsis plants brightly.Proceedings of the National Academy of Sciences, USA94, 2122-2127.
Hehn, A. & Rohde, W.(1998). Characterization of cis-acting elements affecting strength and phloem specificity of the coconut foliar decay virus promoter.Journal of General Virology79, 1495-1499.[Abstract]
Hollenberg, S. M., Sternglanz, R., Cheng, P. F. & Weintraub, H.(1995). Identification of a new family of tissue-specific basic helix-loop-helix proteins with a two-hybrid system.Molecular and Cellular Biology15, 3813-3822.[Abstract]
Horvath, G. V., Pettko-Szabdtner, A., Nikovics, K., Bilgin, M., Boulton, M., Davies, J. W., Gutierrez, C. & Dudits, D.(1998). Prediction of functional regions of the maize streak virus replication associated proteins by proteinprotein interaction analysis.Plant Molecular Biology38, 699-712.[Medline]
Jupin, I., Hericourt, F., Benz, B. & Gronenborn, B.(1995). DNA replication specificity of TYLCV geminivirus is mediated by the amino-terminal 116 amino acids of the Rep protein.FEBS Letters362, 116-120.[Medline]
Kalinina, N. A., Fedorkin, O. N., Samuilova, O. V., Maiss, E., Korpela, T., Morozov, S. Yu. & Atabekov, J. G.(1996). Expression and biochemical analysis of the recombinant potato virus X 25K movement protein.FEBS Letters397, 75-78.[Medline]
Katul, L., Maiss, E., Morozov, S. Yu. & Vetten, H. J.(1997). Analysis of six DNA components of the faba bean necrotic yellows virus genome and their structural affinity to related plant virus genomes.Virology233, 247-259.[Medline]
Katul, L., Timchenko, T., Gronenborn, B. & Vetten, H. J.(1998). Ten distinct circular ssDNA components, four of which encode putative replication-associated proteins, are associated with the faba bean necrotic yellows virus genome.Journal of General Virology79, 3101-3109.[Abstract]
Laakkonen, P., Hyvönen, M., Peränen, J. & Kääriäinen, L.(1994). Expression of Semliki Forest virus nsP1-specific methyltransferase in insect cells and in Escherichia coli.Journal of Virology68, 7418-7425.
Laufs, J., Traut, W., Heyraud, F., Matzeit, V., Rogers, S. G., Schell, J. & Gronenborn, B.(1995). In vitro cleavage and joining at the viral origin of replication by the replication initiator protein of tomato yellow leaf curl virus.Proceedings of the National Academy of Sciences, USA92, 3879-3883.
Liu, L., Saunders, K., Thomas, C. L., Davies, J. W. & Stanley, J.(1999). Bean yellow dwarf virus RepA, but not Rep, binds to maize retinoblastoma protein, and the virus tolerates mutations in the consensus binding motif.Virology256, 270-279.[Medline]
Mansoor, S., Khan, S. H., Bashir, A., Saeed, M., Zafar, Y., Malik, K. A., Briddon, R., Stanley, J. & Markham, P. G.(1999). Identification of a novel circular single-stranded DNA associated with cotton leaf curl disease in Pakistan.Virology259, 190-199.[Medline]
Merits, A., Zelenina, D. A., Mizenina, O. A., Chernov, B. K. & Morozov, S. Yu.(1995). Poly(A) addition site mapping and polyadenylation signal analysis in a plant circovirus replication related gene.Virology211, 345-349.[Medline]
Merits, A., Guo, D. & Saarma, M(1998). VPg, coat protein and five non-structural proteins of potato A potyvirus bind RNA in a sequence-unspecific manner.Journal of General Virology79, 3123-3127.[Abstract]
Morozov, S. Yu., Fedorkin, O. N., Jüttner, G., Schiemann, J., Baulcombe, D. & Atabekov, J. G.(1997). Complementation of a potato virus X mutant mediated by bombardment of plant tissues with cloned viral movement protein genes.Journal of General Virology78, 2077-2083.[Abstract]
Morozov, S. Yu., Solovyev, A. G., Kalinina, N. O., Fedorkin, O. N., Samuilova, O. V., Schiemann, J. & Atabekov, J. G.(1999). Evidence for two nonoverlapping functional domains in the potato virus X 25K movement protein.Virology260, 55-63.[Medline]
Orozco, B. M. & Hanley-Bowdoin, L.(1998). Conserved sequence and structural motifs contribute to the DNA binding and cleavage activities of geminivirus replication protein.Journal of Biological Chemistry273, 24448-24456.
Orozco, B. M., Miller, A. B., Settlage, S. B. & Hanley-Bowdoin, L.(1997). Functional domains of a geminivirus replication protein.Journal of Biological Chemistry272, 9840-9846.
Orozco, B. M., Kong, L. J., Batts, L. A., Elledge, S. & Hanley-Bowdoin, L.(2000). The multifunctional character of a geminivirus replication protein is reflected by its complex oligomerization properties.Journal of Biological Chemistry275, 614-6122.
Palmer, K. E. & Rybicki, E. P.(1998). The molecular biology of mastreviruses.Advances in Virus Research50, 183-234.[Medline]
Pascal, E., Sanderfoot, A. A., Ward, B. M., Medville, R., Turgeon, R. & Lazarowitz, S. G.(1994). The geminivirus BR1 movement protein binds single-stranded DNA and localizes to the cell nucleus.Plant Cell7, 995-1006.
Patterson, R. M., He, C., Selkirk, J. K. & Merrick, A. B.(1996). Human p53 expressed in baculovirus-infected Sf9 cells displays a two-dimensional isoform pattern identical to wild-type p53 from human cells.Archives of Biochemistry and Biophysics 330, 71-79.[Medline]
Randles, J. W., Julia, J. F., Calvez, C. & Dollet, M.(1986). Association of single-stranded DNA with the foliar decay disease of coconut palm in Vanuatu. Phytopathology76, 889-894.
Reichel, C., Mathur, J., Eckes, P., Langenkemper, K., Koncz, C., Schell, J., Reiss, B. & Maas, C.(1996). Enhanced green fluorescence by the expression of an Aequorea victoria green fluorescent protein mutant in mono- and dicotyledonous plant cells.Proceedings of the National Academy of Sciences, USA93, 12643-12647.
Rohde, W., Randles, J. W., Langridge, P. & Hanold, D.(1990). Nucleotide sequence of a circular single-stranded DNA associated with coconut foliar decay virus.Virology176, 648-651.[Medline]
Rohde, W., Becker, D. & Randles, J. W.(1995). The promoter of coconut foliar decay-associated circular single-stranded DNA directs phloem-specific reporter gene expression in transgenic tobacco.Plant Molecular Biology27, 623-628.[Medline]
Sano, Y., Wada, M., Hasimoto, Y., Matsumoto, T. & Kojima, M.(1998). Sequences of ten circular ssDNA components associated with the milk vetch dwarf virus genome. Journal of General Virology79, 3111-3118.[Abstract]
Schiestl, R. H. & Gietz, R. D.(1989). High efficiency transformation of intact yeast cells using single stranded nucleic acids as a carrier.Current Genetics16, 339-346.[Medline]
Settlage, S. B., Miller, A. B. & Hanley-Bowdoin, L.(1996). Interactions between geminivirus replication proteins.Journal of Virology70, 6790-6795.
Timchenko, T., de Kouchkovsky, F., Katul, L., David, C., Vetten, H. J. & Gronenborn, B.(1999). A single rep protein initiates replication of multiple genome components of faba bean necrotic yellows virus, a single-stranded DNA virus of plants.Journal of Virology73, 10173-10182.
Trawick, J. D., Wright, R. M. & Poyton, R. O.(1989). Transcription of yeast COX6, the gene for cytochrome c oxidase subunit VI, is dependent on heme and on the HAP2 gene.Journal of Biological Chemistry264, 7005-7008.
Vojtek, A. B, Hollenberg, S. M. & Cooper, J. A.(1993). Mammalian Ras interacts directly with the serine/threonine kinase Raf. Cell174, 205-214.
Wanitchakorn, R., Hafner, G. J., Harding, R. M. & Dale, J. L.(2000). Functional analysis of proteins encoded by banana bunchy top virus DNA-4 to -6. Journal of General Virology81, 299-306.
Xie, Q., Suarez-Lopez, P. & Gutierrez, C.(1995). Identification and analysis of a retinoblastoma binding motif in the replication protein of a plant DNA virus: requirement for efficient viral DNA replication. EMBO Journal14, 4073-4082.[Medline]
Xie, Q., Sanz-Burgos, A. P., Guo, H., Garcia, J. A. & Gutierrez, C.(1999). GRAB proteins, novel members of the NAC domain family, isolated by their interaction with a geminivirus protein.Plant Molecular Biology39, 647-656.[Medline]
Yeh, H.-H., Su, H.-J. & Chao, Y.-C.(1994). Genome characterization and identification of viral-associated DNA component of banana bunchy top virus.Virology198, 645-652.[Medline]
Received 17 May 2000;
accepted 11 August 2000.
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| INT J SYST EVOL MICROBIOL | MICROBIOLOGY | J GEN VIROL |
| J MED MICROBIOL | ALL SGM JOURNALS | |