J Gen Virol
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Corrigendum (v81,p1629)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via CrossRef
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Sibbet, G.
Right arrow Articles by Campo, M. S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Sibbet, G.
Right arrow Articles by Campo, M. S.
Agricola
Right arrow Articles by Sibbet, G.
Right arrow Articles by Campo, M. S.
Journal of General Virology (2000), 81, 327-334.
© 2000 Society for General Microbiology


Animal: DNA Viruses

{alpha}6 integrin is not the obligatory cell receptor for bovine papillomavirus type 4

Gary Sibbet1, Christine Romero-Graillet2, Guerrino Meneguzzi2 and M. Saveria Campob,1

Beatson Institute for Cancer Research, Garscube Estate, Glasgow G61 1QH, UK1
INSERM U385, Faculty of Medicine, University of Nice, Nice, France2

Author for correspondence: Gary Sibbet. Fax +44 141 942 6521. e-mail g.sibbet{at}beatson.gla.ac.uk


   Abstract
TOP
Abstract
Introduction
Methods
Results
Discussion
References
 
Recently, {alpha}6 integrin has been proposed as the epithelial cell receptor for papillomavirus. This study investigated whether {alpha}6 integrin is the cellular receptor for bovine papillomavirus type 4 (BPV-4), which is strictly epitheliotropic and infects the mucous epithelium of the upper digestive tract. Primary bovine mucosal keratinocytes from the palate of a foetus (PalK) displayed high levels of {alpha}6 integrin; matched primary fibroblasts from the same biopsy (PalF) expressed almost no {alpha}6 integrin. However, BPV-4 bound both PalK and PalF to similar, saturable levels. Native BPV-4 virions infected PalK in vitro, as detected by RT–PCR of E7 RNA. Infection could be blocked by excess virus-like particles (VLPs) and by neutralizing antisera against L1–L2 and L1 VLPs or by denaturation of the virions, supporting the view that infection in vitro mimics the process in vivo. {alpha}6 integrin-negative human keratinocyte cell lines were derived from patients affected by junctional epidermolysis bullosa presenting genetic lesions in their hemidesmosomes. The level of {alpha}6 integrin expression was determined in these cell lines by in situ immunofluorescence and FACS. Despite the absence of {alpha}6 integrin expression by BO-SV cells, they were bound by BPV-4 to similar, saturable levels as normal keratinocytes, KH-SV. Furthermore, BO-SV and KH-SV cells were both infected by BPV-4 to apparently the same extent as PalK cells. These results are consistent with the conclusion that {alpha}6 integrin is not the obligatory receptor for a bovine mucosotropic papillomavirus.


   Introduction
TOP
Abstract
Introduction
Methods
Results
Discussion
References
 
Papillomaviruses are the aetiological infectious agents of a number of cancers (Beutner & Tyring, 1997Down ; Campo, 1997Down ; Zur Hausen & Rosl, 1994Down ). Many are exquisitely epitheliotropic, but the basis of this cell specificity is not understood (de Villiers, 1998Down ; Lowy & Schiller, 1998Down ). Not much is known about the initial step of infection, but it is believed to be docking of the virus with a receptor on the host-cell surface. Whilst papillomavirus tropism may be due in part to the requirements of the virus for transcription and replication, cell specificity may also be conferred by the cellular receptor. Virus receptors are extremely diverse, including sialyloligosaccharides for influenza virus (Suzuki, 1997Down ), ICAM-1 for rhinoviruses (Ohrui et al., 1996Down ), glycosaminoglycan chains of proteoglycans mediated by members of the TNF receptor family for herpes simplex virus (Montgomery et al., 1996Down ; Whitbeck et al., 1997Down ) and various integrins for coxsackievirus B ({alpha}v{beta}5/{beta}6) (Agrez et al., 1997Down ; Shafren et al., 1997Down ), echovirus ({alpha}2{beta}1), rotavirus ({alpha}2{beta}1 and {alpha}4{beta}1) (Coulson et al., 1997Down ; Huttunen et al., 1997Down ) and adenovirus ({alpha}v/{alpha}5{beta}3) (Wickham et al., 1993Down ).

The difficulty in propagating papillomavirus in vitrohas made the identification of the receptor for papillomavirus problematic; most studies of infection have been conducted with artificial virions or virus-like particles (VLPs) rather than with infectious virions (Kirnbauer et al., 1993Down ; Schiller & Lowy, 1996Down ; Volpers et al., 1995Down ; Zhou et al., 1992Down , 1993Down ). Whilst VLPs share many structural aspects with real virions, as judged by immunology studies and the presence of conformational epitopes (Christensen et al., 1994Down , 1996Down ; Kirnbauer, 1996Down ; Kirnbauer et al., 1996Down ; Lowy & Schiller, 1998Down ; Rose et al., 1994Down ), care should be taken with such studies, as VLPs may not accurately reproduce all aspects of papillomavirus infection. It has been shown that correctly assembled and normally folded VLPs can lack conformational epitopes (Chen et al., 1998Down ), and conversely morphologically normal virions presenting conformational epitopes can be non-infectious (P. O’Brien, personal communication).

Although most papillomaviruses are extremely tissue and species specific, it has been proposed that the papillomavirus receptor is widely expressed, as both virions and VLPs bind to a variety of cell lines (Muller et al., 1995Down ; Qi et al., 1996Down ). Bovine papillomavirus type 1 (BPV-1) is not strictly epitheliotropic: it infects both epidermal keratinocytes and dermal fibroblasts in vivo giving rise to fibropapillomas (Campo, 1987Down ) and it infects and transforms murine fibroblast C127 cells in vitro. The infection in vitro can be blocked by competition with VLPs of the strictly epitheliotropic human papillomavirus type 16 (HPV-16), indicating that the two viruses share the same receptor (Roden et al., 1994Down ). Recently, however, using VLPs for HPV-6b, a candidate receptor has been proposed, the integrin {alpha}6 partnered by either {beta}1 or {beta}4 integrin (Evander et al., 1997Down ).

In the skin and mucosae, integrin {alpha}6 exclusively binds to integrin {beta}4 to form an heterodimeric cell receptor critical for hemidesmosome formation and cell adhesion. Genetic mutations affecting expression of integrin {alpha}6{beta}4 result in junctional epidermolysis bullosa with pyloric atresia (PA-JEB), a severe genodermatosis characterized by extensive epithelial disadhesion (Vidal et al., 1995Down ; Ruzzi et al., 1997Down ).

By using bovine epithelial cells and PA-JEB keratinocytes, we have investigated whether {alpha}6 integrin is the cellular receptor for the strictly epitheliotropic papillomavirus BPV-4. Our results suggest strongly that {alpha}6 integrin is not the obligatory receptor for BPV-4.


   Methods
TOP
Abstract
Introduction
Methods
Results
Discussion
References
 
{blacksquare} Cells and cell lines.
Primary PalK and PalF cells were derived from foetal bovine oral palate and grown as described previously (Sibbet et al., 1995Down ). SV40-immortalized human keratinocyte lines were derived from a healthy control (KH-SV cells) and from patients with PA-JEB carrying a homozygous mutation in the integrin {alpha}6 gene (BO-SV cells). These cell lines were immortalized by using infectious SV40 virions as described previously (Miquel et al., 1996Down ) and were maintained in keratinocyte growth medium (Clonetics/BioWhittaker) supplemented with bovine pituitary extract in the presence of 0·09 mM Ca2+.

{blacksquare} Monoclonal antibodies.
The following rat monoclonal antibodies were used for both in situ immunofluorescence and FACS analysis as primary antibodies: GoH3, anti-CD49f, specific for {alpha}6 integrin, and 439-9B, anti-CD104, specific for {beta}4 integrin (PharMingen) (Kennel et al., 1989Down ; Sonnenberg et al., 1987Down ). The secondary antibody was FITC-conjugated anti-rat IgG (whole molecule) (Sigma).

{blacksquare} In situ immunofluorescence.
Cells were plated at 1·2x103 per well and grown in 0·4 ml lots on 8-well glass chamber slides (Labtek). Cells were washed with PBS and then fixed with formaldehyde (3·7%) and permeabilized (0·5% Triton X-100) and the nuclei were counter-stained with 1 µg/ml propidium iodide. Primary antibodies were typically used at 10–100-fold dilution and secondary FITC-labelled antibodies were used 75-fold diluted. Cells were well washed (PBS plus 0·025% Tween 80) prior to mounting with Vectashield (Vector Labs).

{blacksquare} FACS analysis.
Cells were detached, washed on ice and resuspended at 4x106 cells/ml. Aliquots (50 µl) of cells were placed in round-bottomed 96-well plates on ice and treated with the relevant monoclonal antibodies. After excess primary and secondary antibodies had been washed off, cells were fixed overnight with formaldehyde (3·7%) and analysed by FACS the following day. The number of fluorescent cells was plotted against the level of fluorescence on a log scale. The background levels of fluorescence (secondary antibody alone) were subtracted before determining the levels of integrins on the cell surface. The net levels of fluorescence for each cell line were plotted in a bar chart.

{blacksquare} BPV-4 virus binding.
The concentration of virions was determined by electron microscopy (Gaukroger et al., 1996Down ). Cells were plated at 5x105 per 3 cm dish in 2 ml medium. BPV-4 virus was added at an estimated 100 virus particles per cell and allowed to bind for up to 2 h at 4 or 37 °C. After extensive washing in DMEM and PBS, cells with bound virus were drained and harvested in 250 µl ProtK mix (0·1 mg/ml proteinase K, 50 mM KCl, 0·5% NP40, 0·5% Tween). Cell protein was digested for over 2 h at 56 °C and then for 15 min at 95 °C to inactivate the proteinase K. Viral DNA was detected by PCR. To quantify virus binding, aliquots of cell lysate or cell culture medium supernatant were subjected to PCR in a volume of 50 µl with a 5 min 95 °C hot start and 30 rounds of amplification, annealing at 60 °C (Perkin Elmer Taq polymerase and reagents). Amplified products were separated on 1·2% agarose gels and stained with ethidium bromide. Bands were quantified by image capture by using the Bio-Rad GelDoc 1000 system followed by scanning with the Bio-Rad Molecular Analyst (version 1.5) software. These conditions enabled quantification of PCR products within a linear range of almost two orders of magnitude, as determined by serial dilution of template prior to PCR.

{blacksquare} BPV-4 virus ‘infection’.
Cells were plated at 5x106 and allowed to grow to 107 cells per T175 flask, and infected with purified BPV-4 virions at an estimated number of virus particles per cell of 50–100. Infected cells were extensively washed and harvested and RNA was extracted (RNAzol) at early time-points and up to 7 days after infection (Chomczynski & Sacchi, 1987Down ). Residual DNA was removed by RNase-free DNase I digestion followed by purification on SNAP columns (Invitrogen). Viral RNA was detected by reverse transcription (RT) followed by two rounds of PCR, as described below.

{blacksquare} PCR and primer pairs.
Primers for actin were derived from the sequence of bovine actin-1 cDNA: 5' ATCCAGGCTGTGCTGTCTCT 3' (nt 178–197) and 3' ATCTCCTGCTCGAAGTCCAA 5' (nt 433–452). Primers for bovine myc were derived by sequence comparison of mouse, cat and human c-myc sequences and correspond to bases 1020–1037 and 1288–1307 of the human sequence: 5' AAGCAGATCAGCAACAAC 3' and 3' TTGTGTTTCAACTGTTCTCG 5'. The BPV-4 outer primer pair was 5' TGAGGCAGTAGCTCTCAT (nt 313–330) and 3' TATAACCCGTCAAGAGCCCC 5' (nt 3957–3976). The BPV-4 inner primer pair was 5' GCTGACCTTCCAGTCTTAAT 3' (nt 642–661) and 3' TGAAGAGGAGATTGAAACTG 5' (nt 793–812). These primers amplify a 170 bp fragment from RNA transcribed from the E7 ORF.

{blacksquare} RT–PCR.
The method was derived from the Perkin Elmer RNA PCR core kit. Typically, 1–2 µg RNA was reverse-transcribed after annealing to oligo(dT) for 10 min at room temperature by reverse transcription at 42 °C for 60 min followed by 5 min in boiling water to denature the RT activity. The composition of the RT reaction mixture was then adjusted to suit Taq polymerase and two rounds of PCR were performed: 5 µl of the first PCR was used as the template for the second PCR. Both BPV-4 outer and inner primer pairs went through 30 rounds of amplification, with a 95 °C hot start and annealing at 60 °C. Contamination with DNA was avoided by RNase-free DNase I digestion and purification by SNAP columns (Invitrogen). Control reactions lacking RT were always included.


   Results
TOP
Abstract
Introduction
Methods
Results
Discussion
References
 
BPV-4 binding to keratinocytes and fibroblasts
BPV-4, unlike BPV-1, is highly mucosotropic and infects only the keratinocytes of the upper gastrointestinal tract. To examine whether the virus tropism was conferred by binding to specific cell surface receptors, we have derived matched primary keratinocytes (PalK) and fibroblasts (PalF) from the same biopsy of bovine foetal palate tissue. PalK and PalF cells were plated out in monolayer culture in DMEM and were examined by immunofluorescence for expression of the candidate papillomavirus receptor, {alpha}6 integrin. Only PalK cells expressed {alpha}6 integrin; PalF cells expressed almost no {alpha}6 integrin, as judged by the binding of GoH3 antibody (Fig. 1aDown). This agrees with the published pattern of {alpha}6 integrin expression in tissue sections, where normal fibroblasts do not express {alpha}6 integrin; its expression becomes activated upon cell immortalization and transformation (Aplin et al., 1996Down ; Terpe et al., 1994Down ). To test whether the distribution of the putative receptor reflects virus binding to these cells, PalF and PalK cells were plated out in subconfluent monolayers, in 3 cm dishes as for the immunofluorescence studies, and incubated with more than 107 purified infectious BPV-4 virions derived from a palate papilloma. Virions were tested for infectivity by inoculating the palate of a cow (Chandrachud et al., 1995Down ). Despite the differential expression of {alpha}6 integrin, the extent of specific, saturable virion binding to PalK and PalF cells was very similar over a 2 h time-course (Fig. 1bDown).



View larger version (41K):
[in this window]
[in a new window]
 
Fig. 1. (a) In situ immunofluorescence of primary bovine oral palate fibroblasts and keratinocytes, PalF and PalK. Primary antibodies (GoH3 and 439–9B) were used at 100-fold dilution. The rat antibody GoH3, anti-CD49f, is specific for {alpha}6 integrin and 439–9B, anti-CD104, is specific for {beta}4 integrin. The secondary antibody was FITC-conjugated anti-rat IgG (whole molecule) and was used at a 75-fold dilution. The white bar in the PalK {alpha}6 panel represents 18 µm. Images were collected on a Bio-Rad MRC600 confocal microscope. (b) Time-course of BPV-4 virion binding to PalF ({circ}, dashed line) and PalK ({square}, solid line) cells at 4 °C. The points represent the mean±SEM from four estimations of virus binding. Viral DNA from bound virus was detected by PCR and quantified by using the Bio-Rad GelDoc 1000 system and Molecular Analyst (version 1.5) software.

 
BPV-4 infection of keratinocytes
The advantage of using virions rather than VLPs to determine the specificity of virus binding and uptake is that infection can be detected by assaying for transcription of the viral genes. However, as BPV-4 transcription is cell specific, being approximately 40-fold more active in PalK cells than in PalF cells (Morgan et al., 1999Down ), only PalK cells were used for BPV-4 infection experiments.

PalK cells were plated and infected with purified BPV-4 virions at a high ratio of virus particles per cell. Infected cells were harvested and RNA was extracted at early time-points and up to 7 days after infection. RNA samples were digested with DNase I and purified. An RT–PCR protocol was developed to detect viral transcripts. Oligo(dT) was used to generate cDNA from the RNA and two rounds of PCR with nested primers specific for the viral E7 sequences were used to amplify BPV-4 transcripts. To exclude the possibility of contamination by viral DNA in the PCR step, controls included no RT and, to exclude non-specific uptake of virus, denatured virions were used in parallel. Fig. 2(a)Down shows that a specific viral transcript could be detected within 2 h of infection and remained for up to 7 days. The PCR product was sequenced and was confirmed to be E7. The same preparations of cDNA were amplified by one round of PCR with actin primers or c-myc primers (Fig. 2cDown), showing that PCR amplification of cellular RNA was simply dependent upon RT and was unaffected by the presence or absence of infectious or denatured virus.



View larger version (48K):
[in this window]
[in a new window]
 
Fig. 2. Detection of E7 RNA after in vitro infection of PalK cells with BPV-4 virions. (a) Lanes: M, {phi}X-HaeIII markers; +/-; presence or absence of virus; D, heat-denatured virus; -RT, control without reverse transcriptase. The 170 bp amplicon produced by the BPV-4 (nt 642–661) and (nt 793–812) primer pair is indicated by an arrow labelled E7. (b) Lanes are labelled as above. PI, pre-immune serum. Lanes {alpha}-L2, {alpha}-L1L2 and {alpha}-L1 contain bovine sera raised against BPV-4 GST–L2 (#259), L1–L2 VLP (#267) and L1 VLP (#274), respectively. VLP, competition of BPV-4 virion infection with a 500-fold excess of L1–L2 VLP over virus. (c) Lanes are labelled as above: myc and actin refer to their respective amplicons.

 
To test the specificity of virus infection of PalK cells further, before infection in vitro, virus was pre-incubated with various immune sera from cattle vaccinated with either L1–L2 VLP (#267), L1 VLP (#274) or L2 (#259), or competed for with excess BPV-4 VLP (Chandrachud et al., 1995Down ; Kirnbauer et al., 1996Down ) (Fig. 2bUp). Pre-immune serum had no effect on virus infectivity but immune sera #267 and #274 both blocked infection, as judged by the absence of a PCR product, as did VLP competition. Pre-incubation with L2 immune serum #259 (Fig. 2bUp) or with an anti-L2 hyperimmune serum (not shown; O’Brien et al., 1999Down ) did not block infection and a PCR product was generated. This agrees with our previous vaccination results, which showed that anti-L1 antisera prevent infection while anti-L2 antisera prevent disease but not infection (Gaukroger et al., 1996Down ).

The candidate receptor is not required for virus binding or infection of keratinocytes
We have shown that the candidate receptor, {alpha}6 integrin, is highly expressed in PalK cells and absent from PalF cells, but that BPV-4 binds equally to both cell types. As we cannot monitor BPV-4 transcription in PalF cells, in order to examine the role of {alpha}6 integrin in infection, we required cells in which BPV-4 DNA could be efficiently transcribed but which lacked the candidate receptor. We derived a keratinocyte cell line from a patient with a genetic lesion in the {alpha}6 integrin gene (BO-SV) (Gache et al., 1998Down ; Ruzzi et al., 1997Down ). The level of {alpha}6{beta}4 integrin expression was determined in this cell line by in situ immunofluorescence and FACS analysis and compared with the cell line KH-SV (normal human keratinocytes immortalized with SV40 large T antigen) and primary keratinocytes.

Fig. 3(a)Down shows the immunofluorescence of KH-SV cells and BO-SV cells decorated by monoclonal antibodies GoH3 and CD49e, specific for {alpha}6 and {beta}4 integrins, respectively (Sonnenberg et al., 1987Down ). Both antibodies were derived from rat and were visualized with FITC-labelled anti-rat secondary antibody. The GoH3-staining pattern of KH-SV cells was very similar to that of PalK cells, although it was less extensive. The punctate distribution of {beta}4 was also similar. In contrast, BO-SV cells showed negligible {alpha}6 integrin immunofluorescence, while the punctate {beta}4 staining was very weak. Levels of fluorescence were normalized between cell lines by counter-staining the cell nuclei with propidium iodide (Fig. 3aDown). The overall distribution of integrins over the cell surface was also quantified by FACS analysis by using the primary and secondary antibodies described above, and the results confirmed the in situ immunofluorescence results. The BO-SV cell line displayed extremely low levels of {alpha}6 integrin, while {beta}4 integrin was much reduced compared with normal KH-SV cells (Fig. 4Down).



View larger version (26K):
[in this window]
[in a new window]
 
Fig. 3. (a) In situ immunofluorescence of human keratinocyte lines with (KH-SV) or without (BO-SV) {alpha}6{beta}4 integrins. Cells were treated with GoH3 and 439–9B antibodies, as described in the legend to Fig. 1(a)Up. The white bar in the KH-SV {alpha}6 panel represents 10 µm. (b) Time-course of BPV-4 virion binding to KH-SV (solid line) and BO-SV (dashed line) cells under the conditions described in the legend to Fig. 1(b)Up. The points represent the mean and SEM of four estimates of viral binding. (c) RT–PCR after in vitro infection of KH-SV and BO-SV cells. Infection conditions and RNA purification are as described in the legend to Fig. 2Up. Lanes: M, molecular mass markers; +/- refers to presence or absence of virus or {alpha}6 integrin on the cell surface. 7d; the cells were harvested after 7 days after infection.

 


View larger version (15K):
[in this window]
[in a new window]
 
Fig. 4. FACS analysis of KH-SV and BO-SV cells. (a)–(b) Fluorescence plots of KH-SV and BO-SV cells. Antibodies GoH3 and 439–9B, for {alpha}6 integrin and {beta}4 integrin, respectively, were used at 80-fold dilutions. (c) Relative fluorescence bar charts of KH-SV and BO-SV cells from the data shown in (a) and (b). Data were normalized by cell size/surface area and background fluorescence was subtracted from the profiles for {alpha}6 and {beta}4 integrins. Error bars represent the SD of the profiles. Cells were analysed on a Becton Dickinson FACScan.

 
To assess whether the distribution of candidate virus receptor on KH-SV and BO-SV keratinocyte cell lines determines the level of binding of BPV-4 virus, the virus-binding experiments already described for PalK and PalF cells were employed. Despite the lack of {alpha}6 integrin on the surface of BO-SV cells, the time-course of saturable binding of virus was essentially equivalent in the two cell lines (Fig. 3bUp).

Furthermore, having validated the in vitro infection of PalK cells (Fig. 2Up), we infected the BO-SV cells with BPV-4 exactly as before. After RT–PCR of KH-SV and BO-SV RNA, the same RT-dependent E7 amplicon of 170 bp was detected (Fig. 3cUp). Despite the presence of a very weak band in the -RT lanes, which may represent a residual trace of viral DNA resistant to DNase I digestion, the experiment shows clearly that both cell lines had internalized and transcribed the viral genome, independently of the amount of {alpha}6 or {beta}4 integrin displayed on the cell surface.


   Discussion
TOP
Abstract
Introduction
Methods
Results
Discussion
References
 
The answer to the question of how papillomaviruses infect their host cells and the identity of the receptor have, until recently, proved elusive. The productive life-cycle of most papillomaviruses is exquisitely dependent on keratinocyte cell type and cellular differentiation. As the first step in keratinocyte differentiation is for cell division to cease when cells move into the suprabasal compartment, studying papillomavirus infection in regular cell culture has proved extremely difficult. Virus can be recovered from papillomas but, apart from BPV-1 and to a lesser extent BPV-4, the yield of virus is usually poor. This is particularly true for those epitheliotropic papillomaviruses with a role in cancer (HPV-16, HPV-18). Similarly, only very small quantities of papillomavirus have been produced in vitro and these depend on difficult techniques such as raft or organotypic culture, or infecting epithelial ‘chips’ and passaging them through immuno-compromised mice. The development of VLPs by Zhou et al. (1992)Down enabled the study of binding of papillomavirus to cells. By expressing the late genes in eukaryotic or prokaryotic systems, it has been shown that L1 alone can self-assemble into VLPs that apparently bind cells specifically. Because of the absence of a good assay for infection, questions remain about the specificity of the binding and whether it is the same as that of normal virions. It has been observed that some batches of purified virus display correct epitopes but are not infectious (P. O’Brien, personal communication), and the same could be true of VLPs. Normal viruses are required to test the issue of specificity. BPV-4, like HPV-16, infects mucosal epithelium and is tumorigenic, but, unlike HPV-16, it is produced at higher levels and can readily be recovered from oral papillomas, overcoming the potential drawbacks of VLPs. As well as the ability to test virions for infectivity in the host animals, the advantages over VLPs in the study of candidate receptors are that viral genomic DNA can be detected by PCR and that viral gene expression can be distinguished by RT–PCR. We therefore chose to investigate the interaction of BPV-4 with its target cells by using virions rather than VLPs.

By using HPV-6 L1 VLPs, it has recently been suggested that {alpha}6 integrin is a candidate cell receptor for papillomavirus (Evander et al., 1997Down ). However, we found that the presence of the candidate receptor is not required for BPV-4 binding, as both primary keratinocytes (which express {alpha}6 integrin) and primary fibroblasts (which do not) bind virion equally well. Likewise, human keratinocytes that do not express {alpha}6 integrin (BO-SV) bind virus to the same extent as wild-type keratinocytes (KH-SV).

Virion binding to the cell surface is one of the first steps of infection, followed by internalization, uncoating and transport of the viral genome into the nucleus (or, less often, retention in the cytoplasm for some viruses), where transcription of the viral genes takes place.

As binding of virions to the receptor is not necessarily followed by internalization, and a secondary receptor may be needed for this step (Broder & Dimitrov, 1996Down ; Montgomery et al., 1996Down ; Whitbeck et al., 1997Down ; Wu et al., 1996Down ), it is possible that {alpha}6 integrin could act as a secondary receptor and mediate papillomavirus internalization rather than binding. We therefore used transcription of the viral E7 gene as a measure of efficient virus internalization. We developed an RT–PCR assay for E7 transcripts in PalK cells; this assay proved to be very informative. The E7 amplicon was detected in PalK cells 2 h after infection and for up to 7 days, showing that infection had taken place and established itself. The amplicon was also detected when infection took place in the presence of pre-immune serum, but was not detected in the presence of competing VLPs or of virus-neutralizing anti-L1 antisera (Kirnbauer et al., 1996Down ). However, the E7 transcript was still detected in the presence of anti-L2 antisera. This is in total agreement with our results obtained in vivo showing that anti-L1 antibodies block infection whereas anti-L2 antibodies prevent disease but not infection (Gaukroger et al., 1996Down ). Although we did not detect spliced mRNA within the time-frame of these experiments (Smith et al., 1993Down ; White et al., 1998Down ), the competition with VLPs and the neutralization of virus by the immune sera show that our RT–PCR assay is robust enough to reflect genuine infection in its early stages. As infection in vitro is abortive and does not proceed, it is likely that only pre-mRNA is made and that mature spliced forms are not produced.

We next applied the assay to keratinocytes defective in {alpha}6 integrin expression (Gache et al., 1998Down ; Ruzzi et al., 1997Down ) and, consistent with the virion-binding studies, we detected the E7 amplicon independently of the presence of {alpha}6 integrin on the cell surface. This shows that bovine and human keratinocytes are infected equally well by BPV-4, that they share the same receptor and that this receptor is not {alpha}6 integrin. We therefore conclude that {alpha}6 integrin is not an obligatory receptor for BPV-4.

This conclusion does not imply that {alpha}6 integrin is not a papillomavirus receptor, and does not preclude the possibility that {alpha}6 integrin could be closely associated with another cell surface molecule that acts as a receptor. The recent finding that the expression of {alpha}6 integrin confers papillomavirus binding to receptor-negative DG75 cells (McMillan et al., 1999Down ) may be explained by {alpha}6 integrin inducing or stabilizing a receptor such as {alpha}-dystroglycan, which is closely associated with integrins, binds laminin and can be localized along the basement membrane (Cao et al., 1998Down ; Henry & Campbell, 1998Down ).

Our investigation into the binding and infection of cells by a bovine papillomavirus does not preclude the possibility that BPV-4 and HPV-6 use different receptors. Whilst this would seem unlikely, given that BPV-1 and HPV-16 VLPs can compete for binding to the same cell (Roden et al., 1994Down ), more than one receptor may well exist. Such diverse receptors could be used by the virus in different situations both in vivo and under experimental conditions. After all, BPV-1 infection forms fibropapillomas in cattle and thus infects both dermal keratinocytes, which express {alpha}6 integrin, the candidate receptor, and fibroblasts, which do not. The nature of the cell receptor used by BPV-4 to infect keratinocytes remains to be elucidated.


   Acknowledgments
 
Thanks are due to B. W. O’Neil for the isolation, purification and quantification of BPV-4 virion particles and for checking their infectivity in bovine palate, and to Professor J. A. Wyke for critically reading the manuscript. The research has been supported by grants from the Cancer Research Campaign, the Ligue National Contre le Cancer, the British Council/Ministere des Affaires Etrangeres (Alliance Programme) and the Fondation Touraine.


   Footnotes
 
b Present address: Department of Veterinary Pathology, University of Glasgow, Garscube Estate, Glasgow G61 1QH, UK. Back


   References
TOP
Abstract
Introduction
Methods
Results
Discussion
References
 
Agrez, M. V., Shafren, D. R., Gu, X., Cox, K., Sheppard, D. & Barry, R. D.(1997). Integrin alpha v beta 6 enhances coxsackievirus B1 lytic infection of human colon cancer cells.Virology239, 71-77.[Medline]

Aplin, J. D., Dawson, S. & Seif, M. W.(1996). Abnormal expression of integrin alpha 6 beta 4 in cervical intraepithelial neoplasia.British Journal of Cancer74, 240-245.[Medline]

Beutner, K. R. & Tyring, S.(1997). Human papillomavirus and human disease.American Journal of Medicine102, 9-15.[Medline]

Broder, C. C. & Dimitrov, D. S.(1996). HIV and the 7-transmembrane domain receptors.Pathobiology64, 171-179.[Medline]

Campo, M. S.(1987). Papillomas and cancer in cattle.Cancer Surveys6, 39-54.[Medline]

Campo, M. S.(1997). Bovine papillomavirus and cancer.Veterinary Journal154, 175-188.[Medline]

Cao, W., Henry, M. D., Borrow, P., Yamada, H., Elder, J. H., Ravkov, E. V., Nichol, S. T., Compans, R. W., Campbell, K. P. & Oldstone, M. B.(1998). Identification of alpha-dystroglycan as a receptor for lymphocytic choriomeningitis virus and Lassa fever virus.Science282, 2079-2081.[Abstract/Free Full Text]

Chandrachud, L. M., Grindlay, G. J., McGarvie, G. M., O’Neil, B. W., Wagner, E. R., Jarrett, W. F. & Campo, M. S.(1995). Vaccination of cattle with the N-terminus of L2 is necessary and sufficient for preventing infection by bovine papillomavirus-4.Virology211, 204-208.[Medline]

Chen, Y., Ghim, S.-j., Jenson, A. B. & Schlegel, R.(1998). Mutant canine oral papillomavirus L1 capsid proteins which form virus-like particles but lack native conformational epitopes.Journal of General Virology79, 2137-2146.[Abstract]

Chomczynski, P. & Sacchi, N.(1987). Single-step method of RNA isolation by acid guanidinium thiocyanate–phenol–chloroform extraction.Analytical Biochemistry162, 156-159.[Medline]

Christensen, N. D., Höpfl, R., DiAngelo, S. L., Cladel, N. M., Patrick, S. D., Welsh, P. A., Budgeon, L. R., Reed, C. A. & Kreider, J. W.(1994). Assembled baculovirus-expressed human papillomavirus type 11 L1 capsid protein virus-like particles are recognized by neutralizing monoclonal antibodies and induce high titres of neutralizing antibodies.Journal of General Virology75, 2271-2276.[Abstract/Free Full Text]

Christensen, N. D., Reed, C. A., Cladel, N. M., Han, R. & Kreider, J. W.(1996). Immunization with viruslike particles induces long-term protection of rabbits against challenge with cottontail rabbit papillomavirus.Journal of Virology70, 960-965.[Abstract/Free Full Text]

Coulson, B. S., Londrigan, S. L. & Lee, D. J.(1997). Rotavirus contains integrin ligand sequences and a disintegrin-like domain that are implicated in virus entry into cells.Proceedings of the National Academy of Sciences, USA94, 5389-5394.[Abstract/Free Full Text]

de Villiers, E. M.(1998). Human papillomavirus infections in skin cancers.Biomedicine & Pharmacotherapy52, 26-33.

Evander, M., Frazer, I. H., Payne, E., Qi, Y. M., Hengst, K. & McMillan, N. A.(1997). Identification of the alpha6 integrin as a candidate receptor for papillomaviruses.Journal of Virology71, 2449-2456.[Abstract/Free Full Text]

Gache, Y., Romero-Graillet, C., Spadafora, A., Lepinard, C., Descamps, P., Bardon, C. B., Ortonne, J. P. & Meneguzzi, G.(1998). A novel homozygous mutation affecting integrin {alpha}6 in a case of junctional epidermolysis bullosa with pyloric atresia detected in utero by ultrasound examination.Journal of Investigative Dermatology 111, 914-916.[Medline]

Gaukroger, J. M., Chandrachud, L. M., O’Neil, B. W., Grindlay, G. J., Knowles, G. & Campo, M. S.(1996). Vaccination of cattle with bovine papillomavirus type 4 L2 elicits the production of virus-neutralizing antibodies.Journal of General Virology77, 1577-1583.[Abstract/Free Full Text]

Henry, M. D. & Campbell, K. P.(1998). A role for dystroglycan in basement membrane assembly.Cell95, 859-870.[Medline]

Huttunen, P., Heino, J. & Hyypia, T.(1997). Echovirus 1 replication, not only virus binding to its receptor, VLA-2, is required for the induction of cellular immediate-early genes.Journal of Virology71, 4176-4180.[Abstract/Free Full Text]

Kennel, S. J., Foote, L. J., Falcioni, R., Sonnenberg, A., Stringer, C. D., Crouse, C. & Hemler, M. E.(1989). Analysis of the tumor-associated antigen TSP-180. Identity with alpha 6-beta 4 in the integrin superfamily.Journal of Biological Chemistry264, 15515-15521.[Abstract/Free Full Text]

Kirnbauer, R.(1996). Papillomavirus-like particles for serology and vaccine development.Intervirology39, 54-61.[Medline]

Kirnbauer, R., Taub, J., Greenstone, H., Roden, R., Durst, M., Gissmann, L., Lowy, D. R. & Schiller, J. T.(1993). Efficient self-assembly of human papillomavirus type 16 L1 and L1-L2 into virus-like particles.Journal of Virology67, 6929-6936.[Abstract/Free Full Text]

Kirnbauer, R., Chandrachud, L. M., O’Neil, B. W., Wagner, E. R., Grindlay, G. J., Armstrong, A., McGarvie, G. M., Schiller, J. T., Lowy, D. R. & Campo, M. S.(1996). Virus-like particles of bovine papillomavirus type 4 in prophylactic and therapeutic immunization.Virology219, 37-44.[Medline]

Lowy, D. R. & Schiller, J. T. (1998). Papillomaviruses and cervical cancer: pathogenesis and vaccine development. Journal of the National Cancer Institute Monographs, 27–30.

McMillan, N. A., Payne, E., Frazer, I. H. & Evander, M.(1999). Expression of the alpha6 integrin confers papillomavirus binding upon receptor-negative B-cells.Virology261, 271-279.[Medline]

Miquel, C., Gagnoux-Palacios, L., Durand-Clement, M., Marinkovich, P., Ortonne, J. P. & Meneguzzi, G.(1996). Establishment and characterization of cell line LSV5 that retains the altered adhesive properties of human junctional epidermolysis bullosa keratinocytes.Experimental Cell Research224, 279-290.[Medline]

Montgomery, R. I., Warner, M. S., Lum, B. J. & Spear, P. G.(1996). Herpes simplex virus-1 entry into cells mediated by a novel member of the TNF/NGF receptor family.Cell87, 427-436.[Medline]

Morgan, I. M., Grindlay, G. J. & Campo, M. S.(1999). The bovine papillomavirus type 4 long control region contains an epithelial specific enhancer.Journal of General Virology80, 23-27.[Abstract]

Muller, M., Gissmann, L., Cristiano, R. J., Sun, X. Y., Frazer, I. H., Jenson, A. B., Alonso, A., Zentgraf, H. & Zhou, J.(1995). Papillomavirus capsid binding and uptake by cells from different tissues and species.Journal of Virology69, 948-954.[Abstract/Free Full Text]

O’Brien, P. M., Aitken, R., O’Neil, B. W. & Campo, M. S.(1999). Generation of native bovine mAbs by phage display.Proceedings of the National Academy of Sciences, USA96, 640-645.[Abstract/Free Full Text]

Ohrui, T., Yamaya, M., Sekizawa, K., Terajima, M., Yamada, N., Suzuki, T., Okinaga, S., Hoshi, H., Suzuki, H. & Sasaki, H. (1996). [Rhinovirus infection and expression of adhesion molecules in human tracheal epithelium]. Nihon Kyobu Shikkan Gakkai Zasshi(Japanese Journal of Thoracic Diseases) 34, 121–125 (in Japanese).

Qi, Y. M., Peng, S. W., Hengst, K., Evander, M., Park, D. S., Zhou, J. & Frazer, I. H.(1996). Epithelial cells display separate receptors for papillomavirus VLPs and for soluble L1 capsid protein.Virology216, 35-45.[Medline]

Roden, R. B., Kirnbauer, R., Jenson, A. B., Lowy, D. R. & Schiller, J. T.(1994). Interaction of papillomaviruses with the cell surface.Journal of Virology68, 7260-7266.[Abstract/Free Full Text]

Rose, R. C., Reichman, R. C. & Bonnez, W.(1994). Human papillomavirus (HPV) type 11 recombinant virus-like particles induce the formation of neutralizing antibodies and detect HPV-specific antibodies in human sera.Journal of General Virology75, 2075-2079.[Abstract/Free Full Text]

Ruzzi, L., Gagnoux-Palacios, L., Pinola, M., Belli, S., Meneguzzi, G., D’Alessio, M. & Zambruno, G.(1997). A homozygous mutation in the integrin alpha6 gene in junctional epidermolysis bullosa with pyloric atresia.Journal of Clinical Investigation99, 2826-2831.[Medline]

Schiller, J. T. & Lowy, D. R.(1996). Papillomavirus-like particles and HPV vaccine development.Seminars in Cancer Biology7, 373-382.[Medline]

Shafren, D. R., Dorahy, D. J., Ingham, R. A., Burns, G. F. & Barry, R. D.(1997). Coxsackievirus A21 binds to decay-accelerating factor but requires intercellular adhesion molecule 1 for cell entry.Journal of Virology71, 4736-4743.[Abstract/Free Full Text]

Sibbet, G. J., Cuthill, S. & Campo, M. S.(1995). The enhancer in the long control region of human papillomavirus type 16 is up-regulated by PEF-1 and down-regulated by Oct-1.Journal of Virology69, 4006-4011.[Abstract/Free Full Text]

Smith, L. H., Foster, C., Hitchcock, M. E. & Isseroff, R.(1993). In vitro HPV-11 infection of human foreskin.Journal of Investigative Dermatology 101, 292-295.[Medline]

Sonnenberg, A., Janssen, H., Hogervorst, F., Calafat, J. & Hilgers, J.(1987). A complex of platelet glycoproteins Ic and IIa identified by a rat monoclonal antibody.Journal of Biological Chemistry262, 10376-10383.[Abstract/Free Full Text]

Suzuki, Y. (1997). [Host range of influenza viruses and their receptor binding specificities]. Nippon Rinsho (Japanese Journal of Clinical Medicine) 55, 2640–2647 (in Japanese).

Terpe, H. J., Stark, H., Ruiz, P. & Imhof, B. A.(1994). Alpha 6 integrin distribution in human embryonic and adult tissues.Histochemistry101, 41-49.[Medline]

Vidal, F., Aberdam, D., Miquel, C., Christiano, A. M., Pulkkinen, L., Uitto, J., Ortonne, J. P. & Meneguzzi, G.(1995). Integrin beta-4 mutation associated with junctional epidermolysis bullosa with pyloric atresia.Nature Genetics10, 229-234.[Medline]

Volpers, C., Unckell, F., Schirmacher, P., Streeck, R. E. & Sapp, M.(1995). Binding and internalization of human papillomavirus type 33 virus-like particles by eukaryotic cells.Journal of Virology69, 3258-3264.[Abstract/Free Full Text]

Whitbeck, J. C., Peng, C., Lou, H., Xu, R., Willis, S. H., Ponce de Leon, M., Peng, T., Nicola, A. V., Montgomery, R. I., Warner, M. S., Soulika, A. M., Spruce, L. A., Moore, W. T., Lambris, J. D., Spear, P. G., Cohen, G. H. & Eisenberg, R. J.(1997). Glycoprotein D of herpes simplex virus (HSV) binds directly to HVEM, a member of the tumor necrosis factor receptor superfamily and a mediator of HSV entry.Journal of Virology71, 6083-6093.[Abstract/Free Full Text]

White, W. I., Wilson, S. D., Bonnez, W., Rose, R. C., Koenig, S. & Suzich, J. A.(1998). In vitro infection and type-restricted antibody-mediated neutralization of authentic human papillomavirus type 16.Journal of Virology72, 959-964.[Abstract/Free Full Text]

Wickham, T. J., Mathias, P., Cheresh, D. A. & Nemerow, G. R.(1993). Integrins alpha v beta 3 and alpha v beta 5 promote adenovirus internalization but not virus attachment.Cell73, 309-319.[Medline]

Wu, L., Gerard, N. P., Wyatt, R., Choe, H., Parolin, C., Ruffing, N., Borsetti, A., Cardoso, A. A., Desjardin, E., Newman, W., Gerard, C. & Sodroski, J.(1996). CD4-induced interaction of primary HIV-1 gp120 glycoproteins with the chemokine receptor CCR-5.Nature384, 179-183.[Medline]

Zhou, J., Sun, X. Y., Davies, H., Crawford, L., Park, D. & Frazer, I. H.(1992). Definition of linear antigenic regions of the HPV16 L1 capsid protein using synthetic virion-like particles.Virology189, 592-599.[Medline]

Zhou, J., Stenzel, D. J., Sun, X.-Y. & Frazer, I. H.(1993). Synthesis and assembly of infectious bovine papillomavirus particles in vitro.Journal of General Virology74, 763-768.[Abstract/Free Full Text]

Zur Hausen, H. & Rosl, F.(1994). Pathogenesis of cancer of the cervix.Cold Spring Harbor Symposia on Quantitative Biology59, 623-628.[Medline]

Received 27 July 1999; accepted 26 October 1999.


This article has been cited by other articles:


Home page
PediatricsHome page
M. E. Pichichero
Booster Vaccinations: Can Immunologic Memory Outpace Disease Pathogenesis?
Pediatrics, December 1, 2009; 124(6): 1633 - 1641.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
T. D. Culp, L. R. Budgeon, M. P. Marinkovich, G. Meneguzzi, and N. D. Christensen
Keratinocyte-Secreted Laminin 5 Can Function as a Transient Receptor for Human Papillomaviruses by Binding Virions and Transferring Them to Adjacent Cells
J. Virol., September 15, 2006; 80(18): 8940 - 8950.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
N. A. Patterson, J. L. Smith, and M. A. Ozbun
Human Papillomavirus Type 31b Infection of Human Keratinocytes Does Not Require Heparan Sulfate
J. Virol., June 1, 2005; 79(11): 6838 - 6847.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
R. Yang, P. M. Day, W. H. Yutzy IV, K.-Y. Lin, C.-F. Hung, and R. B. S. Roden
Cell Surface-Binding Motifs of L2 That Facilitate Papillomavirus Infection
J. Virol., March 15, 2003; 77(6): 3531 - 3541.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
K.-N. Zhao and I. H. Frazer
Saccharomyces cerevisiae Is Permissive for Replication of Bovine Papillomavirus Type 1
J. Virol., December 1, 2002; 76(23): 12265 - 12273.
[Abstract] [Full Text] [PDF]


Home page
Antimicrob. Agents Chemother.Home page
N. D. Christensen, C. A. Reed, T. D. Culp, P. L. Hermonat, M. K. Howett, R. A. Anderson, and L. J. D. Zaneveld
Papillomavirus Microbicidal Activities of High-Molecular-Weight Cellulose Sulfate, Dextran Sulfate, and Polystyrene Sulfonate
Antimicrob. Agents Chemother., December 1, 2001; 45(12): 3427 - 3432.
[Abstract] [Full Text] [PDF]


Home page
Int ImmunolHome page
D. M. Da Silva, M. P. Velders, J. D. Nieland, J. T. Schiller, B. J. Nickoloff, and W. M. Kast
Physical interaction of human papillomavirus virus-like particles with immune cells
Int. Immunol., May 1, 2001; 13(5): 633 - 641.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
Y. Kawana, K. Kawana, H. Yoshikawa, Y. Taketani, K. Yoshiike, and T. Kanda
Human Papillomavirus Type 16 Minor Capsid Protein L2 N-Terminal Region Containing a Common Neutralization Epitope Binds to the Cell Surface and Enters the Cytoplasm
J. Virol., March 1, 2001; 75(5): 2331 - 2336.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
T. Giroglou, L. Florin, F. Schafer, R. E. Streeck, and M. Sapp
Human Papillomavirus Infection Requires Cell Surface Heparan Sulfate
J. Virol., February 1, 2001; 75(3): 1565 - 1570.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Corrigendum (v81,p1629)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via CrossRef
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Sibbet, G.
Right arrow Articles by Campo, M. S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Sibbet, G.
Right arrow Articles by Campo, M. S.
Agricola
Right arrow Articles by Sibbet, G.
Right arrow Articles by Campo, M. S.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
INT J SYST EVOL MICROBIOL MICROBIOLOGY J GEN VIROL
J MED MICROBIOL ALL SGM JOURNALS