J Gen Virol Email Content Delivery
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via CrossRef
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Boldogköi, Z.
Right arrow Articles by Fodor, I.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Boldogköi, Z.
Right arrow Articles by Fodor, I.
Agricola
Right arrow Articles by Boldogköi, Z.
Right arrow Articles by Fodor, I.
Journal of General Virology (2000), 81, 415-420.
© 2000 Society for General Microbiology


Animal: DNA Viruses

A putative latency promoter/enhancer (PLAT2) region of pseudorabies virus contains a virulence determinant

Zsolt Boldogköi1, Ferenc Erdélyi2 and István Fodor1,3

Institute for Biochemistry and Protein Research1 and Laboratory of Gene Technology2, Agricultural Biotechnology Center, PO Box 411, H-2101 Gödöllö, Hungary
Center for Molecular Biology and Gene Therapy, Loma Linda University School of Medicine, Loma Linda, CA 92354, USA3

Author for correspondence: István Fodor at Center for Molecular Biology and Gene Therapy.Fax +1 909 478 4177. e-mail ifodor{at}som.llu.edu


   Abstract
TOP
Abstract
Main text
References
 
Contradictory data have recently been reported on the role of the unique long–internal repeat junction area of pseudorabies (Aujeszky’s disease) virus (PrV) genome in the virulence of the virus. To investigate the basis of the difference, four recombinant PrVs mutated at the outer region of inverted repeats that involved a putative latency promoter (PLAT2) were constructed in this study. Propagation characteristics of mutant viruses in cultured cells were similar to those of the wild-type virus. However, a 757 bp deletion at this location caused significant reduction in the virulence of PrV after intraperitoneal inoculation of mice and a moderate decrease in the virulence after intracranial inoculation. These results indicate that the PLAT2 region is an important virulence determinant that may be implicated in the neuroinvasive capability of the virus.


   Main text
TOP
Abstract
Main text
References
 
The unique short region of pseudorabies virus (PrV) is bracketed by internal (Ir) and terminal (Tr) repeats. The outer segment of PrV inverted repeats (IRs) is a multifunctional region containing among others the a sequences, a putative latency promoter (PLAT2; Vlcek et al., 1993Down ) and a part of the long latency transcript (LLT; Cheung, 1991Down ). Recently, Dean & Cheung (1995)Down constructed a mutant PrV (LLT{beta}{Delta}2) with a deleted genomic junction and adjacent viral sequences. They found that intranasal (i.n.) inoculation of pigs with LLT{beta}{Delta}2 did not induce neurological signs of PrV infection, which led them to the conclusion that the deleted DNA segment contained a neurovirulence determinant. In the following article (Dean et al., 1996Down ), they reported that intracranial (i.c.) inoculation of pigs with the same virus led to the death of infected animals. The authors revised their view and suggested that the deleted region was responsible for the ability of PrV to spread from the peripheral neurons to the central nervous system (CNS). However, the deleted segment also included a short sequence from the IE175 gene of the Ir that confers general virulence. Therefore, mutant LLT{beta}{Delta}2 may not be an appropriate model for revealing a neurotropism determinant at the DNA segment under examination.

Previously, we constructed a recombinant PrV (designated as vE16lac) containing a single deletion similar to that of LLT{beta}{Delta}2 with the exception that both IE175 genes remained intact (Boldogköi et al., 1998bDown ). This mutant retained the ability to infect both pigs and mice and exhibited no significant decrease in virulence. Based on these results, we concluded that deletion of one copy of the analysed DNA segment did not alter the neuroinvasive capability of the virus after i.n. or intraperitoneal (i.p.) inoculation of pigs or mice, respectively. In this study, using a mouse model, we examined the virulence of four PrV strains possessing various modifications at both copies of PLAT2 located at the IR of the virus.

Strain Ka (Kaplan & Watter, 1959Down ) of PrV was used as a parental virus for the construction of mutant viruses. Propagation of the virus in porcine kidney (PK-15) cells and preparation of viral DNA for the transfection and construction of recombinant viruses were carried out as previously described (Boldogköi et al., 1998aDown ). The transfer plasmids used for the construction of recombinant viruses contained a lacZ gene expression cassette, pCMVRI-lac, based on the pCMV{beta} vector (Clontech) and the flanking sequences derived from the target region of the PrV genome. The PrV BamHI-8' fragment extending from -3218 to +1680 (Fig. 1aDown) and containing PLAT2 was subcloned into pRL425 and pRL525 (Elhai & Wolk, 1988Down ), resulting in pB8'-425 and pB8'-525, respectively. Use of these two vectors containing different polylinker regions facilitated our subsequent cloning procedures. Transfer plasmid pIRlac was constructed by converting the DraI recognition site at the putative TATAA box of PLAT2 to EcoRI via linker insertion in pB8'-525, followed by ligation with the EcoRI fragment of pCMVRI. Transfer plasmid pdIRlac was constructed from B8'-425 by deleting the 757 bp DraI–SmaI DNA fragment in multiple steps and replacing it with an EcoRI site. Recombinant virusesvIR-lac and vdIR-lac were generated by co-transfection of viral DNA to PK-15 cells with pIRlac or pIRdlac, respectively. As a result of homologous recombination and the equalization process (Rall et al., 1992Down ), the constructed recombinant viruses contained two copies of the lacZ cassette. Viruses expressing {beta}-galactosidase (lacZ) were screened on the basis of their blue plaque appearance in the presence of X-Gal. For the construction of vIR-RI and vdIR-RI, the DNAs of vIR-lac and vdIR-lac were first cleaved by EcoRI restriction endonuclease, resulting in the release of the lacZ cassette, and the fragmented viral DNAs were used for cell transfection. The intact viral genome was reconstituted from the viral DNA fragments by cellular DNA ligases. Viruses containing an EcoRI linker, but missing the lacZ gene, appeared as white plaques. Mutations of both vIR-RI and vdIR-RI were rescued by co-transfection of cloned BamHI-8' fragment with the viral DNAs treated with EcoRI and calf intestinal phosphatase as described (Boldogköi et al., 1998aDown ). In this system, we exploited the stimulatory effect of double-strand breaks on recombination (Ryan & Shankly, 1996Down ). The structure of constructed viruses shown in Fig. 1(a)Down was confirmed by Southern blotting experiments (Fig. 1bDown). To determine the possible impact of mutations on virus growth in vitro, PK-15 cells were infected with viruses at an m.o.i. of 0·1 or 10 p.f.u., and the kinetics of virus growth were investigated. The curves shown in Fig. 2Down indicate that the growth rates of both mutant and wild-type viruses are similar (Fig. 2Down).



View larger version (22K):
[in this window]
[in a new window]
 
Fig. 1. (a) Comparison of the genetic structure of mutant viruses. The BamHI-8' (labelled as B8') and BamHI-8 (B8) restriction fragments of PrV DNA are enlarged. In vIR-lac and vIR-RI, a lacZ gene or an 8 bp EcoRI linker was inserted into both copies of PLAT2, respectively. In vdIR-lac and vdIR-RI, a 757 bp DNA segment derived from PLAT2 was replaced with a lacZ gene or an EcoRI linker, respectively. In LLT{beta}{Delta}2, the internal cleavage/packaging (pac-1) signal with adjacent sequences and a small sequence from the IE175 gene were deleted. In vE16lac, only the pac-1 signal and adjacent sequences, but not the IE175 gene, were deleted. Abbreviations: epo, early protein 0; ie, IE175 gene (white ie locus represents a non-functional IE175 gene); PLAT1, a real latency promoter; PLAT2, a putative latency promoter; LAT, latency-associated transcript; LLT, long latency transcript; LRT, latency-related transcript; J, the genomic junction of PrV representing the zero point on the genomic map. Restriction cleavage sites: b, BamHI; sm, SmaI; st, StuI; d, DraI. (b) Southern-blot analysis of DNA of mutant viruses. Each viral DNA was cut with BamHI and EcoRI, and digestion products were resolved by electrophoresis through 0·8% agarose gels. DNA fragments then were denatured, neutralized and transferred to Hybond-N membranes (Amersham), followed by UV-cross-linking of DNA to the membrane using UV Stratalinker (Stratagene). A 906 bp SmaI subfragment of BamHI-8' fragment including PLAT2 was used as a probe (represented as a black bar in a) and was labelled with [{alpha}-32P]dCTP by random priming. Hybridizations were performed according to the standard protocol (Sambrook et al., 1989Down ). The sizes of BamHI-8' and its shorter derivative BamHI-13 in the mutant viruses (designated B13) were decreased due to the insertion of an EcoRI linker to these regions, indicating that the mutation was correctly introduced to the PrV DNA. In vIR-lac and vIR-RI, both BamH fragments (BamHI-8' and -13) were separated into two smaller fragments (the 1403 bp BamHI fragment is doubled in molarity compared to the 368 and 3586 bp fragments). Although in vdIR-lac and vdIR-RI both BamHI fragments were also separated into two smaller fragments (3686, 646 and 368 bp), the 646 bp fragment showed no hybridization signal since the probe was located within the deleted sequences. Lanes (i) and (ii) represent virus DNAs used for i.p. inoculation or isolated from the brain, respectively. Lanes (ii) represent DNA from a mixture of ten different virus isolates.

 


View larger version (16K):
[in this window]
[in a new window]
 
Fig. 2. Growth curves of mutant viruses. Subconfluent PK-15 cells were infected with each virus at an m.o.i. of either 10 p.f.u. per cell (a, single-step growth analysis) or 0·1 p.f.u. per cell (b, multiple-cycle growth experiments). After 1 h of incubation, cells were washed and covered with culture medium. Cells were harvested and viruses were released from the cells by three cycles of freezing and thawing. The titre of viruses was calculated as described previously (Boldogköi et al., 1998aDown ).

 
Swine is the natural host of the virus, but several other animal models, like rodents, chicken, cat, etc., have also been used for analyses of PrV pathogenicity (Field & Hill, 1975Down ; Lomniczi et al., 1984Down , Card et al., 1992Down , 1997Down ; Banfield et al., 1998Down ). Although data obtained using the mouse model cannot be directly applied to the pig, we chose the mouse model because using more and less expensive laboratory animals we were able to determine statistically significant differences in lethal dose (LD50) values of PrV strains. Results presented in Table 1(a)Down indicate that: (1) insertion of the lacZ gene (in vIR-lac) or an EcoRI linker (in vIR-RI) to the TATA box of PLAT2 resulted in an approximately one order of magnitude increase in LD50 values for mutant virus i.p.-inoculated into mice. (2) A 757 bp deletion in PLAT2 resulted in an increase in LD50 values with approximately three orders of magnitude, as well as a significant increase of the survival time upon infection with mutant viruses vdIR-lac and vdIR-RI. (3) The presence of a lacZ cassette did not exert a significant effect on the virulence of PrV. (4) The differences in LD50 values between i.c.-inoculated wild-type and mutant viruses are smaller compared with those after i.p. inoculation. (5) Both rescuant viruses exhibited LD50 values similar to that of the wild-type virus, confirming the expected genomic structure of mutant viruses and their rescuant derivatives. The identity of the virus strain used in this experiment for i.p. inoculation (in lethal dose) and the virus recovered from the brain has been proved by Southern blot analysis of virus DNAs isolated from the brain (Fig. 1bUp).


View this table:
[in this window]
[in a new window]
 
Table 1. Virulence of virus strains

 
To determine if mutant viruses are able to reach the peripheral organs (liver, lung, spleen) via descending pathways from the brain, animals were infected via the i.c. route. After injection of various doses of vdIR-RI and using strain Ka as a control (Table 1bUp), infection of organs was analysed using PCR. The primers for PCR were derived from a region located downstream of the IE175 gene (forward primer, CCACTCGAGTCTCTGAGATTT; backward primer, CAAGACCCTCTACTTCTTCC). We found that a low, but lethal dose of i.c.-inoculated vdIR-RI and Ka in the range of 102–104 p.f.u. can reach the periphery, infecting practically all analysed organs. However, inoculation with high virus titres (105 and 106 p.f.u.) leads to a decrease in effectiveness of infection of different organs, especially in the case of less virulent virus strain vdIR-RI. We interpret this result as showing that a high dose of virus kills the animal before the virus reaches the periphery.

We also analysed the fate of the viruses after sublethal i.p. inoculation into mice (Table 1cUp). Wild-type virus can be detected in the brain of the mice without causing lethal infection after inoculation with a low dose (102 p.f.u.), while vdIR-RI spreads to the brain after inoculation with a relatively higher dose (103–105 p.f.u.) of virus. Although at day 12 the viruses can still be detected in different organs, most of the animals survived the virus infection, indicating that the virus is not able to invade the body and induce lethal infection.

Taken together, we have found a significant difference between mutant and wild-type viruses in virulence and virus spread in i.p.-infected mice and a moderate difference in i.c. inoculation experiments, while the growth rates of both viruses in vitro were similar. Thus, the sequences at the outer region of IRs, including a putative latency promoter, contain a virulence determinant. Deletion of these sequences affects the capability of the virus to spread from the peripheral neurons to the CNS and, to a smaller extent, from the CNS to the peripheral organs. However, our results do not prove that PLAT2 specifically controls the neuroinvasive capability of the virus because the reduced neurotropism may be the result of impaired virulence of the virus as well.

On the basis of our previously published data and results presented here we can conclude that mutations in the PLAT2 region affect virulence only if they occur in both copies of the IRs. This result is in disagreement with those reported by Dean et al. (1995, 1996Down ). There are several possible explanations for the contradictory results obtained in these two laboratories: (1) theoretically, LLT{beta}{Delta}2 virions could have two alternative forms of genetic structure depending on the outcome of the deletion involving the 3'-end of both IE175 genes. If the mutation caused a lethal effect, in the mature viruses only the Tr segment would be intact, while the majority of viral concatemeric DNAs would contain mutations in both copies of the IE175 genes (in most cases a process termed equalization renders the IR structures identical). However, due to imperfection of equalization in each cycle of replication a small percentage of the Trs would retain their intact genotype. Since the IE175 gene is essential for the virus life-cycle, only virions containing an intact Tr could be infectious. Although, according to our unpublished results, the IE175 activity was found to be normal, a certain portion of IE175 mRNAs must have been mutated and thus, encoded non-functional protein molecules. Lower amounts of functionally active IE175 protein produced by LLT{beta}{Delta}2 could account for the reduced virulence of this virus. (2) Alternatively, if the deletion was non-lethal for the virus, all mature virions would be mutated in both copies of the IE175 gene. Therefore, the inability of LLT{beta}{Delta}2 to invade the CNS from the periphery could be explained by the reduced virulence caused by the mutation. Both scenarios presented above are based on results published by Rall et al. (1992)Down . (3) The DNA segment located between the stop codon of the IE175 gene and the SmaI restriction site at position 1125 is intact in vE16lac, but it is deleted in LLT{beta}{Delta}2. (4) For the construction of mutant viruses Chang and coworkers used parental strain Indiana-Funkhauser, while we used strain Kaplan.

A tenfold increase in the LD50 of vIR-RI after insertional inactivation of the putative TATA box of PLAT2 indicates that it may function as a promoter acting at productive infection. Most likely, it controls the expression of an antisense RNA which down-regulates IE gene activity. In this study we have not examined whether PLAT2 plays a role in the latent phase of virus infection. It is pertinent to ask whether the insertion of the intact gene into another genomic location restores the virulence of the mutant virus. We have not investigated this possibility for the following reasons: (1) it is unlikely that the DNA region located downstream of PLAT2 contains the information for a protein. Such a protein encoded on the complementary DNA strand that includes a highly extended (more than 5 kb!) antisense open reading frame (A-ORF; Cheung, 1991Down ) would be unique in genetics. The possible origin of non-functional long overlapping ORFs in GC-rich organisms, like PrV, was discussed in our previous papers (Boldogköi & Murvai, 1994Down ; Boldogköi et al., 1994, 1995Down ). (2) The A-ORF sequence is co-localized with the IE175 gene on the antisense and the sense DNA strands. Its insertion into another genomic location and thus, formation of three copies of the DNA segment, would cause genomic instability mediated by homologous recombination. In another possible experimental design, both copies of the whole A-ORF could be deleted, and then, a single copy under control of an intact PLAT2 would be reinserted into a different genomic locus. However, in this case we would face serious problems in the interpretation of the results. Indeed, the construct could not be considered as a control for our study because in our work the PLAT2, and not the entire A-ORF, was mutated. In addition, the LLT, extending from the 3'-end of the EPO gene to the 5'-end of the IE175 gene, would also be disrupted by this procedure.

Furthermore, in our previous study we reported that vE16lac could revert with a low frequency to wild-type Irs (Boldogköi et al., 1998bDown ), but Dean and co-workers (Dean & Cheung, 1995Down ; Dean et al., 1996Down ) did not detect LLT{beta}{Delta}2 revertants, although both viruses had similar genomic struc-tures. We also showed that a low rate of restoration of the Ir segment had little effect on the virulent phenotype of vE16lac.

Finally, we expected that insertion of a lacZ cassette into the vIR-lac would cause drastic structural changes to the promoter and completely abolish its activity. Instead, we found that the difference in LD50 values of vIR-lac and vIR-RI is not significant, but the virulence of vIR-lac is significantly greater compared with vdIR-RI and vdIR-lac. These data indicate that besides its promoter function PLAT2 may have other functions involved in the life-cycle of the virus. Further studies are needed to elucidate the precise function of this region.


   Acknowledgments
 
We thank Mrs M. Katona for technical assistance. This work was supported by the Hungarian National Research Fund grants T17095 and F019511.


   References
TOP
Abstract
Main text
References
 
Banfield, B. W., Yap, G. S., Knapp, A. C. & Enquist, L. W. (1998). A chicken embryo eye model for the analysis of alphaherpesvirus neuronal spread and virulence. Journal of Virology 72, 4580-4588.[Abstract/Free Full Text]

Boldogköi, Z. & Murvai, J. (1994). A novel explanation for the existence of open reading frames on the latency-associated transcripts of alphaherpesviruses. Virus Genes 9, 47-51.[Medline]

Boldogköi, Z., Murvai, J. & Fodor, I. (1995). G and C accumulation at silent positions of codons produces additional ORFs. Trends in Genetics 11, 125-126.

Boldogköi, Z., Braun, A., Antal, J. & Fodor, I. (1998a). A restriction cleavage and transfection system for introducing foreign DNA sequences into the unique and inverted repeat regions of a herpesvirus. Research in Virology 149, 87-97.[Medline]

Boldogköi, Z., Braun, A., Medveczky, I., Glávits, R., Gyúró, B. & Fodor, I. (1998b). Analysis of the equalization of inverted repeats and neurovirulence using a pseudorabies virus mutant strain altered at the Ul/Ir junction. Virus Genes 17, 89-98.[Medline]

Card, J. P., Whealy, M. E., Robbins, A. K. & Enquist, L. W. (1992). Pseudorabies virus envelope glycoprotein gI influences both neurotropism and virulence during infection of the rat visual system. Journal of Virology 66, 3032-3041.[Abstract/Free Full Text]

Card, J. P., Enquist, L. W., Miller, A. D. & Yates, B. J. (1997). Differential tropism of pseudorabies virus for sensory neurons in the cat. Journal of Neurovirology 3, 49-61.[Medline]

Cheung, A. K. (1991). Cloning of the latency gene and the early protein 0 gene of pseudorabies virus. Journal of Virology 65, 5260-5271.[Abstract/Free Full Text]

Dean, H. J. & Cheung, A. K. (1995). A deletion at the UL/IR junction reduces pseudorabies neurovirulence. Journal of Virology 69, 1334-1338.[Abstract]

Dean, H. J., Miller, J. M., Ackerman, M. R., Gao, X. Y., Anderson, L. L., Jacobson, C. D. & Cheung, A. K. (1996). Replication and pathogenicity after intranasal and intracranial inoculation of swine with recombinant pseudorabies virus containing a deletion at the UL/IR junction. Virology 223, 19-28.[Medline]

Elhai, J. & Wolk, C. P. (1988). A versatile class of positive-selection vectors based on the non-viability of palindrome containing plasmids, that allows cloning into the polylinkers. Gene 68, 119-138.[Medline]

Field, H. J. & Hill, T. J. (1975). The pathogenesis of pseudorabies in mice: virus replication at the inoculation site and axonal uptake. Journal of General Virology 26, 145-148.[Abstract/Free Full Text]

Kaplan, A. S. & Watter, A. E. (1959). A comparison of herpes simplex and pseudorabies virus. Virology 7, 394-407.[Medline]

Lomniczi, B., Watanabe, S., Ben-Porat, T. & Kaplan, A. S. (1984). Genetic basis of neurovirulence of pseudorabies virus. Journal of Virology 52, 198-205.[Abstract/Free Full Text]

Rall, G. F., Kupershmidt, S., Sugg, N., Veach, R. A. & Ben-Porat, T. (1992). Functions of the sequences at the end of inverted repeats of pseudorabies virus. Journal of Virology 66, 1506-1519.[Abstract/Free Full Text]

Reed, L. J. & Muench, M. (1938). A simple method of estimating fifty percent end points. American Journal of Hygiene 27, 493-497.

Ryan, P. & Shankly, F. L. (1996). A double-strand break in a herpesvirus genome stimulates targeted homologous recombination with exogenous, cloned viral sequences. Journal of Virological Methods 57, 95-107.[Medline]

Sambrook, J., Fritsch, E. F. & Maniatis, T. (1989). Molecular Cloning: A Laboratory Manual, 2nd edn. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory.

Vlcek, C., Kozmik, Z., Paces, V., Schirm, S. & Schwyzer, M. (1993). Pseudorabies virus immediate early gene overlaps with an oppositely oriented open reading frame – characterization of their promoter and enhancer regions. Virology 179, 365-377.

Received 3 June 1999; accepted 14 October 1999.


This article has been cited by other articles:


Home page
Cereb CortexHome page
S. Horvath, E. Prandovszky, E. Pankotai, Z. Kis, T. Farkas, Z. Boldogkoi, K. Boda, Z. Janka, and J. Toldi
Use of a Recombinant Pseudorabies Virus to Analyze Motor Cortical Reorganization after Unilateral Facial Denervation
Cereb Cortex, April 1, 2005; 15(4): 378 - 384.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via CrossRef
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Boldogköi, Z.
Right arrow Articles by Fodor, I.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Boldogköi, Z.
Right arrow Articles by Fodor, I.
Agricola
Right arrow Articles by Boldogköi, Z.
Right arrow Articles by Fodor, I.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
INT J SYST EVOL MICROBIOL MICROBIOLOGY J GEN VIROL
J MED MICROBIOL ALL SGM JOURNALS