|
|
||||||||
Animal: RNA Viruses |
Division of Molecular Biology, Institute for Animal Health, Compton Laboratory, Compton, Newbury RG20 7NN, UK1
Author for correspondence: John W. McCauley. Fax +44 1635 577263. e-mail john.mccauley{at}bbsrc.ac.uk
| Abstract |
|---|
|
|
|---|
| Introduction |
|---|
|
|
|---|
The pestivirus genome comprises positive-strand RNA that is translated to form a single virus polyprotein which is processed by a combination of cellular and viral proteases to produce the mature virus proteins (Collett et al., 1988a
).The structural proteins comprise the nucleocapsid protein C and three envelope glycoproteins, Erns, E1 and E2 (Donis & Dubovi, 1987a
,b
; Collett et al., 1988b
; Thiel et al., 1991
). Studies on the interactions between the three glycoproteins have been carried out for CSFV. Initially, Erns and E1 are synthesized as a heterodimer (Erns/E1 precursor), but at later stages of polypeptide processing, Erns forms a disulphide-bonded homodimer (Rümenapf et al., 1993
; König et al., 1995
), whereas E2 forms a disulphide-linked homodimer and also a heterodimer with E1 (Weiland et al., 1990
; Rümenapf et al., 1991
). Erns and E2 are located at the surface of infected cells (Weiland et al., 1999
), induce virus-neutralizing antibodies (Donis et al., 1988
; Weiland et al., 1990
, 1992
) and both have been shown to elicit protective immunity (Hulst et al., 1993
; König et al., 1995
; Rümenapf et al., 1993
; van Zijl et al., 1991
).
The virus functions of glycoprotein Erns, which is secreted into the extracellular environment (Rümenapf et al., 1993
), are not yet fully understood and the mechanism by which this protein is bound to the virion surface remains to be elucidated (Weiland et al., 1992
). Erns has been identified as a ribonuclease and this enzymatic activity is inhibited by virus-neutralizing antibodies but not by reduction and deglycosylation (Windisch et al., 1996
; Hulst et al., 1994
; Schneider et al., 1993
). CSFV Erns is able to induce apoptosis in lymphocytes of several species (Bruschke et al., 1997
).
The initial events in the cycle of BVDV infection are not known, and therefore it is important to identify the initial virushost interactions necessary for BVDV infection, not only for the general understanding of pestivirus infection but also for the effective control of this virus. Previous studies showed that monoclonal antibodies directed against two bovine cell surface proteins (60 and 90 kDa) were able to inhibit virus infection (Schelp et al., 1995
) and, in addition, Xue & Minocha (1993)
identified a 50 kDa cell surface protein as a putative E2-specific receptor. Recently, Erns and E2 were found to inhibit the infection of cultured pig kidney cells by CSFV in two distinct ways (Hulst & Moormann, 1997
) and Erns also showed binding to cells that were non-permissive for virus replication (Hulst & Moormann, 1997
). Here, we provide both biochemical and genetic evidence that cell surface glycosaminoglycans (GAGs) can serve as receptors for the BVDV Erns glycoprotein.
| Methods |
|---|
|
|
|---|
Cells and viruses.
Plasmid construction.
PCR was used to amplify a DNA fragment encoding Erns of BVDV (NCP) strain Pe515 corresponding to amino acids 268494 of the BVDV reference strain NADL polyprotein in a 12-cycle reaction using Pfu DNA polymerase (Stratagene). The primers used were: 5' ATTCAAGTTACAAGATCTGAAAATATAACA 3', which corresponded to nucleotides 11781207 of the NADL genome sequence modified to include a BglII recognition site on the 5' end of the Erns sequence; and 5' CAATAAGGGTCTAGACGCGTATGCTCCAAA 3', which corresponded to nucleotides 18621891 of the NADL genome sequence in an antisense orientation modified by the inclusion of XbaI recognition site. For the Drosophila expression system, the XbaI- and BglII-digested PCR product was cloned into pMT/BiP/V5-His (Invitrogen) cut with XbaI and BglII. The shuttle vector (pMT/BiP/Erns/V5-His; abbreviated to pErnsV5) and control vector (pMT/BiP/GFP/V5-His; abbreviated to pGFP/V5) were individually co-transfected with the hygromycin-responsive selection vector pCoHYGRO (Invitrogen) at a ratio of 29:1 into insect (S2) cells. Transformation was performed using a calcium phosphate transfection kit (Invitrogen) according to the suppliers instructions.
The sense primer used for the mammalian expression system was 5' ATTCAAGTTACAAAGCTTGAAAATATAACA 3', which corresponded to nucleotides 11781207 of the NADL genome incorporating a HindIII recognition site at the 5' end of the Erns sequence. The reverse primer, with an XbaI site at the 3' end of the Erns sequence, was 5' CAATAAGGGTCTAGACGCGTATGCTCCAAA 3', which corresponded to nucleotides 18621891 of the NADL genome sequence. The PCR product was digested with HindIII and XbaI and cloned into the Signal/pIg/Fc plasmid (R&D Systems). The recombinant plasmid (Signal/pIg/Erns/Fc) and control plasmid (Signal/pIg/CD44/Fc) were used for transient transfection of COS-7 cells using FuGENE6 transfection reagent (Roche Biochemicals) according to the suppliers instructions. ErnsV5, ErnsFc and control proteins were secreted into the culture medium in both expression systems.
Expression and purification.
Drosophila S2 cells harbouring the pErnsV5 were grown in DES expression medium without FCS in 175 cm2 flasks and expression of V5-tagged Erns (ErnsV5) was induced by the addition of copper sulphate (500 µM final concentration) when the cell density reached 4x1066x106 cells/ml. After 23 days post-induction, the cells were harvested and the concentration of ErnsV5 was determined by ELISA with reference to known concentrations of purified protein. The culture supernatant was concentrated 10-fold by ultrafiltration and loaded onto a 2 ml metal affinity column (TALAN; Clontech) equilibrated and washed with buffer A (50 mM TrisHCl, pH 8·0). A second wash was performed with buffer A containing 20 mM imidazole and the histidine-tagged protein was then eluted with buffer A containing 100 mM imidazole. Fractions containing ErnsV5 were pooled and dialysed against buffer A.
For the purification of Erns linked to an immunoglobulin Fc (ErnsFc) expressed in mammalian cells, the COS-7 cell culture supernatant was adjusted to (pH 8·0) by adding 1/10 volume of 1·0 M TrisHCl (pH 8·0) and applied to a 1 ml protein Aagarose (Sigma) column. The column was equilibrated and first washed with 100 mM TrisHCl (pH 8·0) and then 10 mM TrisHCl (pH 8·0). The ErnsFc was eluted with 100 mM glycine, pH 3·0, and the fractions were immediately neutralized by adding 1/10 volume of 1·0 M TrisHCl, pH 8·0.
Immunoblot analysis.
Cell culture supernatants containing recombinant Erns were subjected to SDSPAGE in the presence or absence of 2-mercaptoethanol and electrophoretically transferred to a PVDF membrane. The membrane was blocked with 5% skimmed milk in PBS and incubated with an anti-V5-HRP antibody [specific for the V5 epitope (Invitrogen)] and detected by ECL (Amersham).
Plaque reduction assay
(i) Effect of Erns.
Confluent monolayers of CTe cells grown in 6-well tissue culture plates were washed twice with maintenance medium (EMEM) without FCS and pre-incubated for 1 h at 37 °C with 500 µl EMEM containing concentrations of ErnsV5 (050 µg/ml) or with 500 µl EMEM with a control protein (V5 epitope tagged GFP, GFP/V5His) at the same concentration. Following the preincubation period, 50 p.f.u. CP virus stock previously diluted in 500 µl EMEM was added to the cells, mixed and then incubated for 1 h. After 1 h, the virus inoculum was removed and the cells were rinsed once with EMEM and overlaid with maintenance medium containing 1% agarose. The cells were then incubated at 37 °C for 3 days, after which time they were stained with toluidine blue (0·1% toluidine blue, 4% formaldehyde in PBS) for 6 h at room temperature.
(ii) Effect of GAGs and GAG analogues.
Confluent monolayers of CTe cells grown in 6-well tissue culture plates were washed twice with EMEM without FCS and pre-incubated for 1 h at 37 °C with 500 µl EMEM containing the individual GAG or GAG analogue. These were: 020 mg/ml heparin, chondroitin sulphate, dermatan sulphate, dextran sulphate and a suramin analogue CPD1 (Braddock et al., 1994
); 010 mg/ml suramin and the suramin analogue CPD14 (Braddock et al., 1994
); or 05 mg/ml fucoidan and pentosan polysulphate. Following the preincubation period, 50 p.f.u. CP virus stock previously diluted in 500 µl EMEM was added to the cells, mixed and then incubated for 1 h. After 1 h, the virus/GAG mixture was removed and the cells were rinsed once with EMEM and overlaid with maintenance medium containing 1% agarose. The cells were then incubated at 37 °C for 3 days and the plaques were detected as above. The concentration of GAGs or GAG analogues required to reduce virus binding by 50% (IC50) was calculated using the method of moving averages (Thompson, 1947
).
Detection of RNase activity.
RNase activity was determined using equal amounts of recombinant purified ErnsV5 and control protein GFP/V5His (expressed and purified in the same way as ErnsV5). The protein was incubated with 0·5 µg 1623S rRNA (Roche Biochemicals) for 1 h at 37 °C in 50 mM TrisHCl (pH 8·0), 10 mM MgCl2 and 100 mM NaCl containing 4 units/µl RNase inhibitor (from human placenta, RNasin; Promega). Following electrophoresis on a 1% agarose gel, the samples were stained with ethidium bromide.
Binding of Erns to immobilized heparin.
Culture supernatant containing ErnsV5 was concentrated 10-fold by ultrafiltration through a 10000 MW cut-off stirred filtration unit (Amicon) and 2 ml (4 µg/ml) was loaded onto a 1 ml heparinagarose column (Sigma) previously equilibrated with PBS. The column was washed with PBS and eluted with 1000 U/ml (6·5 mg/ml) of heparin in PBS. In a second experiment, the heparinagarose column was washed and equilibrated with 50 mM TrisHCl (pH 8·0) and the ErnsV5 was eluted with a step-gradient of increasing concentration of NaCl (02 M) in equilibration buffer. Fractions were analysed by ELISA by coating a 96-well plate with dilutions of each chromatography fraction overnight at 4 °C. Following binding, the wells were blocked with 5% skimmed milk and incubated with peroxidase-conjugated anti-V5 antibody. Bound antibody was detected with tetramethyl benzidine (TMB) substrate and the absorbance was measured at 630 nm.
Detection of Erns binding by immunofluorescence.
Cells were grown to approximately 6080% confluency on 12-mm-round glass coverslips in 24-well tissue culture dishes. Coverslips were rinsed with PBS and then incubated at room temperature for 1 h with 1 µg/ml purified ErnsV5. After washing with PBS, the cells were fixed with 4% paraformaldehyde in PBS for 10 min at room temperature, then rinsed several times with PBS, and blocked with PBS containing 5% normal goat serum and 0·1% sodium azide (GS wash buffer). Cells were incubated with 10 µg/ml anti-V5 monoclonal antibody (Invitrogen) in blocking buffer for 1 h at room temperature in a humidified chamber. After rinsing several times with PBS, cells were treated with FITC-conjugated goat anti-mouse IgG (Sigma) diluted 1:60 in GS wash buffer. Coverslips were rinsed and then mounted in mounting buffer [80% glycerol, 2·5% DABCO (1,4-diazabicyclo[2.2.2]octane) in PBS] and were viewed with a Leica TCS confocal laser microscope.
Heparinase treatment of cell monolayers.
To determine Erns binding, monolayers of CTe cells were washed with PBS and then incubated with heparinase I and/or III (Sigma) at a concentration of 10 Sigma units/ml (600 Sigma units equivalent to 1 IU) in PBS for 1 h at 37 °C. The cells were then incubated with ErnsV5, fixed and processed as described above.
To determine the effect of virus infection on the heparinase-treated cells, the cells were washed with PBS and incubated with heparinase I (Sigma) at a concentration of up to 600 Sigma units/ml in PBS containing 0·1% BSA and 0·1% glucose (digestion buffer) for 1 h at 37 °C. Following the preincubation period, heparinase I and mock-treated cells were incubated with 50 p.f.u. CP virus diluted in digestion buffer and further incubated for 20 min at room temperature. The virus inoculum was removed and the cells were washed twice with EMEM and overlaid with maintenance medium containing 1% agarose. Monolayers were stained as described above. The results were compared by Students t-test and expressed as the mean±standard error of mean.
Flow cytometric analysis.
CTe cells were grown overnight in 75 cm2 flasks, washed with EMEM and removed from the flasks using a rubber policeman. The cells were resuspended in maintenance medium containing 1 µg/ml ErnsV5 and 0·5 mg/ml of the following GAGs: heparin from bovine lung; fucoidan from Fucus vesiculosus; dermatan sulphate from bovine mucosa; chondroitin sulphate A from bovine trachea; keratan sulphate from bovine cornea; mannan from Saccharomyces cerevisiae; suramin (Sigma); poly-L-lysine (Sigma); and dextran sulphate (Sigma), and incubated at room temperature for 1 h. The cells were washed three times with GS wash buffer. Bound ErnsV5 was detected by incubation with anti-V5 antibody (10 µg/ml in GS wash buffer) for 30 min at 4 °C. After washing as above, the cells were incubated for 30 min with FITC-conjugated goat anti-mouse IgG antibody (1:200 dilution in GS wash buffer). Cells were then washed twice with GS wash buffer and resuspended in PBS containing 1% BSA and 0·1% sodium azide. Fluorescence intensity of single cells was measured using a FACScan flow cytometer (Becton Dickinson).
| Results |
|---|
|
|
|---|
Western blot analysis of the culture medium using anti-V5 epitope monoclonal antibodies revealed monomeric and dimeric forms of ErnsV5 under non-reducing conditions with apparent molecular masses of approximately 44 and 84 kDa, respectively. After reduction with 2-mercaptoethanol, the corresponding monomers show two bands of approximately 4246 kDa (Fig. 1a
).
|
Recombinant ErnsV5 was further examined by testing its ability to inhibit plaque formation. Cells were incubated with ErnsV5 and control protein GFP/V5His and infected with CP BVDV virus. As shown in Fig. 2
, the addition of ErnsV5 during the period of virus attachment reduced plaque formation in a concentration-dependent manner. The effect was specific for ErnsV5 as the control protein GFP/V5His has no effect on plaque number over the same concentration range. These results confirm that recombinant BVDV Erns similarly shares the characteristics of Erns of CSFV.
|
|
|
Treatment of cells with heparinases
To investigate whether Erns binding to the cell surface was mediated directly through GAGs, CTe cells were treated with specific GAG lyases, followed by assessment of ErnsV5 binding. Heparinase I, which degrades heparin and highly sulphated domains in heparan sulphate and heparinase III (specific for heparan sulphate) were added to cells at a concentration of 10 units/ml in medium at 37 °C for 1 h and the cells were then fixed with paraformaldehyde. ErnsV5 binding to cells was clearly reduced following pre-treatment of the cells with either heparinase I or heparinase III (Fig. 4
).
Binding to GAG-deficient mutant cell lines
To characterize further the nature of cell-surface GAGs as Erns receptors, the binding of ErnsV5 to wild-type CHO cells and mutant CHO cell lines that had defects in the production of specific GAGs was examined. Although binding of ErnsV5 to the wild-type CHO cells was easily detectable, no binding of ErnsV5 was observed on mutant cells pgsA-745 or pgsD-677 (Fig. 5
). The reduced binding of ErnsV5 to the heparan sulphate/GAG-deficient mutant cells pgsA-745 and pgsD-677, indicated that the presence of heparan sulphate proteoglycan is a principal requirement for Erns attachment to the cell surface. Furthermore, no binding to pgsD-677 (which is heparan sulphate/GAG-deficient but produces three times more chondroitin sulphate; Esko et al., 1985
) demonstrated that Erns exhibited at least some specificity for heparan sulphate or heparin.
|
Inhibition of virus infection by GAGs, GAG analogues and heparinase treatment
To correlate the results obtained with recombinant Erns, virus infection experiments were performed to determine whether soluble GAGs or GAG analogues could inhibit infection of CTe cells by BVDV. Suramin and the suramin analogues CPD1 and CPD14, fucoidan, pentosan polysulphate, heparin, chondroitin sulphate, dermatan sulphate and dextran sulphate were incubated with permissive cells both prior to, and during, virus binding. The effect of these compounds on virus infection was determined by reduction in the plaque titre. Results of these studies show that addition of suramin, the suramin analogue CPD14, fucoidan and pentosan polysulphate can reduce plaque number in a concentration-dependent manner (Fig. 6
); the concentrations required to reduce virus infection by 50% were 2·87, 5, 0·15 and 0·62 mg/ml, respectively. In contrast, heparin, chondroitin sulphate, dermatan sulphate, dextran sulphate and the suramin analogue CPD1 did not have any significant effect on virus infectivity.
|
Binding of Erns to immobilized heparin
To examine whether Erns binds directly to GAGs, recombinant ErnsV5 was applied to immobilized heparinagarose. The majority of ErnsV5 bound to the column and was eluted with 1000 units/ml (6·5 mg/ml) soluble heparin and by 0·5 M and 1 M NaCl (Fig. 7
). These data confirmed that Erns can bind to charged GAGs in vitro and is consistent with a direct interaction of Erns with sulphated GAGs present on the surface of cells.
|
| Discussion |
|---|
|
|
|---|
We demonstrated that BVDV Erns binding to cells was inhibited by soluble GAGs and we hypothesize that Erns binds directly to GAGs on the cell surface since enzymatic treatment of cells with heparinase abolishes Erns binding to cells. Moreover, recombinant Erns can bind to heparin immobilized on agarose and could be eluted with heparin and relatively high salt concentration. A variety of GAGs and polyanions were tested for their ability to inhibit Erns binding to cells and the results indicated that soluble GAGs (heparin, fucoidan and dermatan sulphate) inhibited binding whereas chondroitin sulphate, keratan sulphate and mannan failed to inhibit binding. From these experiments, we conclude that Erns binding showed some specificity to GAGs. This conclusion is supported by the experiments that examined Erns binding to mutant CHO cells in which GAG biosynthesis was defective. Erns failed to bind to cells with greatly reduced levels of GAGs (pgsA-745), but also failed to bind to cells that were unable to make heparan sulphate (pgsD-677) but presented chondroitin sulphate on the cell surface (Esko et al., 1985
; Lidholt et al., 1992
). Overall, our data indicated that Erns binding requires heparan sulphate and not chondroitin sulphate moieties, although we have not yet identified the specific sugar sequence required for Erns binding. Heparan sulphate GAGs consist of repeating disaccharide units composed of alternating glucosamine monosaccharides. The specificity exhibited by Erns for heparan sulphate moieties demonstrates that Erns may interact with a glucosaminehexuronic acid backbone. Further, since excess soluble dermatan sulphate could inhibit Erns binding, Erns may also interact with a heparan sulphate backbone that contains iduronic acid.
Erns is secreted from infected cells but it is also a structural component of the virus particle (Rümenapf et al., 1993
; Weiland et al., 1992
). We have shown that the polysulphonated compounds suramin and fucoidan blocked both Erns binding to cells and also inhibited virus replication in tissue culture. These observations suggest that Erns binding to the cell surface plays a role in virus replication. However, we failed to observe inhibition of virus replication with heparin sulphate and heparinase treatment of CTe cells did not completely block virus infection. In the case of dengue virus, hepatitis C virus and adeno-associated virus type 2, highly sulphated forms of GAGs are required in order to inhibit infectivity (Chen et al., 1997
; Garson et al., 1999
; Summerford & Samulski, 1998
). It is possible that the failure of heparin sulphate to block infection of CTe cells by BVDV may be similarly determined by the degree of sulphation of heparan sulphate. The preparation of heparan sulphate used in our studies was clearly sufficient to inhibit monomeric or dimeric binding of Erns but possibly not when Erns was associated with the virus particle.
Heparinase treatment of CTe cells reduced infection by approximately 50%. This level of inhibition is somewhat lower than that observed with some other viruses that bind to heparan sulphate moieties. For example, although infectivity of cells treated with heparinase was reduced only by 50% for Sindbis virus (Mastromarino et al., 1991
; Byrnes & Griffin, 1998
), for other viruses the reduction of infectivity following heparinase treatment of cells was higher: reductions of infectivity of 8090% for herpes simplex viruses (HSV) (WuDunn & Spear, 1989
), of 66% for adeno-associated virus (Summerford & Samulski, 1998
) and of 7080% for foot-and-mouth disease virus (Jackson et al., 1996
) have been reported. Nevertheless, reduction of BVDV infectivity following heparinase treatment of CTe cells was statistically significant. The reasons for the variation in the effect of heparinase treatment have not been systematically explored. The variable response may be caused by the differences in cell type and the degree to which virus may have adapted in culture to more efficient use of heparan sulphate (Sa-Carvalho et al., 1997
). Indeed, HSV that fails to bind heparan sulphate through either gC or gB retains its ability to infect cells (Laquerre et al., 1998
). The binding to heparan sulphate may be bypassed for BVDV infection of cultured CTe cells.
Our results show that cell lines from cattle, pig, human, mouse, monkey and dog interact with BVDV Erns; similar results were shown by Hulst & Moormann (1997)
for CSFV. However, BVDV infection of mammalian cells shows species specificity. This suggests that infection of cells by BVDV may be dependent on a multistep process in which virus attachment to cells and internalization are two distinct steps requiring different cell surface receptors. This conclusion is supported by the literature. Hulst & Moormann (1997)
reported that CSFV glycoproteins Erns and E2 interact with distinct cell surface receptors, whereas Schelp et al. (1995)
identified two bovine-specific cell surface proteins of 60 and 90 kDa with monoclonal antibodies which efficiently inhibited the infection of bovine cells with BVDV, and Xue & Minocha (1993)
identified a 50 kDa cell surface protein as a potential E2-specific receptor.
There is a growing list of viruses that enter cells by binding to two or more receptors. Herpesviruses, including HSV (WuDunn & Spear, 1989
), human cytomegalovirus (Compton et al., 1993
), bovine herpesvirus types 1 and 4 (Okazaki et al., 1991
; Vanderplasschen et al., 1993
), pseudorabies virus (Mettenleiter et al., 1990
) and varicella-zoster virus (Zhu et al., 1995
), have recently been reported to use GAGs as the initial site of binding to cells. Foot-and-mouth disease virus (Jackson et al., 1996
; Sa-Carvalho et al., 1997
), dengue virus (Chen et al., 1997
), respiratory syncytial virus (Krusat & Streckert, 1997
), Sindbis virus (Klimstra et al., 1998
), porcine reproductive and respiratory syndrome virus (Jusa et al., 1997
), equine arteritis virus (Asagoe et al., 1997
) and vaccinia virus (Chung et al., 1998
) have also been shown to bind to cells through GAGs. Three-stage binding of virus to cells occurs in human immunodeficiency virus (HIV) infection, in which HIV glycoproteins bind to heparan sulphate proteoglycans and CD4 (Roderiquez et al., 1995
; Sattentau & Weiss, 1991
) followed by binding to chemokine receptors (Doms & Peiper, 1997
). The demonstration here that a pestivirus Erns binds to cell surface GAGs leads us to postulate that pestivirus attachment and entry into cells is likely to be another example of a complex virus entry mechanism.
Recent work on Erns from CSFV shows that it, like BVDV Erns, binds to GAGs, and virus replication in vitro is also inhibited by polysulphonated compounds and GAGs (M. M. Hulst & R. J. M. Moormann, personal communication).
Note added in proof. It has recently been shown by Agnello et al. (Proceedings of the National Academy of Sciences, USA 96, 1276612771, 1999) that the low density lipoprotein receptor can mediate entry of several members of the Flaviviridae, including BVDV, and that BVDV is restricted at a stage beyond virus entry.
| Acknowledgments |
|---|
| Footnotes |
|---|
| References |
|---|
|
|
|---|
Becher, P., Orlich, M., Shannon, A. D., Horner, G., König, M. & Thiel, H.-J. (1997). Phylogenetic analysis of pestiviruses from domestic and wild ruminants. Journal of General Virology 78, 1357-1366.[Abstract]
Braddock, P. S., Hu, D. E., Fan, T. P. D., Stratford, I. J., Harris, A. L. & Bicknell, R. (1994). A structure-activity analysis of antagonism of the growth factor and angiogenic activity of basic growth factor by suramin and related polyanions. British Journal of Cancer 69, 890-898.[Medline]
Brownlie, J. (1991). The pathway for bovine virus diarrhoea virus biotypes in the pathogenesis of disease. Archives of Virology Supplement 3, 79-96.[Medline]
Bruschke, C. J. M., Hulst, M. M., Moormann, R. J. M., van Rijn, P. A. & van Oirschot, J. T. (1997). Glycoprotein Erns of pestiviruses induces apoptosis in lymphocytes of several species. Journal of Virology 71, 6692-6696.[Abstract]
Byrnes, A. P. & Griffin, D. E. (1998). Binding of Sindbis virus to cells surface heparan sulfate. Journal of Virology 72, 7349-7356.
Chen, Y., Maguire, T., Hileman, R. E., Fromm, J. R., Esko, J. D., Linhardt, R. J. & Marks, R. M. (1997). Dengue virus infectivity depends on envelope protein binding to target cell heparan sulfate. Nature Medicine 3, 866-871.[Medline]
Chung, C.-S., Hsaio, J.-C., Chang, Y.-S. & Chang, W. (1998). A27L protein-mediated vaccinia virus interaction with cell surface heparan sulfate. Journal of Virology 72, 1577-1585.
Collett, M. S., Larson, R., Gold, C., Strick, D., Anderson, D. K. & Purchio, A. F. (1988a). Molecular cloning and nucleotide sequence of pestivirus bovine viral diarrhea virus. Virology 165, 191-199.[Medline]
Collett, M. S., Larson, R., Belzer, S. K. & Retzel, E. (1988b). Proteins encoded by bovine viral diarrhea virus: the genomic organization of a pestivirus. Virology 165, 200-208.[Medline]
Compton, T., Nowlin, D. M. & Cooper, N. R. (1993). Initiation of human cytomegalovirus infection requires initial interaction with cell surface heparan sulfate. Virology 193, 834-841.[Medline]
Dekker, A., Wensvoort, G. & Terpstra, C. (1995). Six antigenic groups within the genus pestivirus as identified by cross neutralization assays. Veterinary Microbiology 47, 317-329.[Medline]
Doms, R. W. & Peiper, S. C. (1997). Unwelcomed guests with master keys: how HIV uses chemokine receptors for cellular entry. Virology 235, 179-190.[Medline]
Donis, R. O. & Dubovi, E. J. (1987a). Characterization of bovine viral diarrhoea-mucosal disease virus-specific proteins in bovine cells. Journal of General Virology 68, 1597-1605.
Donis, R. O. & Dubovi, E. J. (1987b). Glycoproteins of bovine viral diarrhoea-mucosal disease virus in infected bovine cells. Journal of General Virology 68, 1607-1616.
Donis, R. O., Corapi, W. V. & Dubovi, E. J. (1988). Neutralizing monoclonal antibodies to bovine viral diarrhoea virus binds to the 56K to 58K glycoprotein. Journal of General Virology 69, 77-86.
Esko, J. D., Stewart, T. E. & Taylor, W. H. (1985). Animal cell mutants defective in glycosaminoglycan synthesis. Proceedings of the National Academy of Sciences, USA 82, 3197-3201.
Garson, J. A., Lubach, D., Passas, J., Whitby, K. & Grant, P. R. (1999). Suramin blocks hepatitis C binding hepatoma cells in vitro. Journal of Medical Virology 57, 238-242.[Medline]
Gillespie, J. H., Baker, J. A. & McEntee, K. (1960). A Cytopathogenic strain of virus diarrhea virus. Cornell Veterinary 50, 73-79.
Hulst, M. M. & Moormann, R. J. M. (1997). Inhibition of pestivirus infection in cell culture by envelope proteins Erns and E2 of classical swine fever virus: Erns and E2 interact with different receptors. Journal of General Virology 78, 2779-2787.[Abstract]
Hulst, M. M., Westra, D. F., Wensvoort, G. & Moormann, R. J. M. (1993). Glycoprotein E1 of hog cholera virus expressed in insect cells protects swine from hog cholera. Journal of Virology 67, 5435-5442.
Hulst, M. M., Himes, G., Newbigin, E. & Moormann, R. J. M. (1994). Glycoprotein E2 of classical swine fever virus: expression in insect cells and identification as a ribonuclease. Virology 200, 558-565.[Medline]
Jackson, T., Ellard, F. M., Ghazaleh, R. A., Brookes, S. M., Blakemore, W. E., Corteyn, A. H., Stuart, D. I., Newman, J. W. I. & King, A. M. (1996). Efficient infection of cells in culture by type O foot-and-mouth disease virus requires binding to cell surface heparan sulphate. Journal of Virology 70, 5282-5287.
Jusa, E. R., Inaba, Y., Kouno, M. & Hirose, O. (1997). Effect of heparin on infection of cells by porcine reproductive and respiratory syndrome virus. American Journal of Veterinary Research 58, 488-491.[Medline]
Klimstra, W. B., Ryman, K. D. & Johnston, R. E. (1998). Adaptation of Sindbis virus to BHK cells selects for use of heparan sulfate as an attachment receptor. Journal of Virology 72, 7357-7366.
König, M., Lengsfeld, T., Pauly, T., Stark, R. & Thiel, H.-J. (1995). Classical swine fever virus: independent induction of protective immunity by two structural proteins. Journal of Virology 69, 6479-6486.[Abstract]
Krusat, T. & Streckert, H.-J. (1997). Heparin-dependent attachment of respiratory syncytial virus (RSV) to host cells. Archives of Virology 142, 1247-1254.[Medline]
Laquerre, S., Argnani, R., Anderson, D. B., Zucchini, S., Manservigi, R. & Glorioso, J. C. (1998). Heparan sulfate proteoglycan binding by herpes simplex virus type 1 glycoproteins B and C, which differ in their contributions to virus attachment, penetration, and cell-to-cell spread. Journal of Virology 72, 6119-6130.
Lee, K. L. & Gillespie, J. H. (1957). Propagation of virus diarrhea virus of cattle in tissue culture. American Journal of Veterinary Research 18, 952-953.[Medline]
Lidholt, K., Weinke, J. L., Kiser, C. S., Lugemwa, F. N., Bame, K. J., Cheifetz, S., Massague, J., Lindahl, U. & Esko, J. D. (1992). A single mutation affects both N-acetylglucosaminyltransferase and glucuronosyltransferase activities in a Chinese hamster ovary cell mutant defective in heparan sulfate biosynthesis. Proceedings of the National Academy of Sciences, USA 89, 2267-2271.
Mastromarino, P., Conti, C., Petruzziello, R., Lapadula, R. & Orsi, N. (1991). Effect of polyions on the early events of Sindbis virus infection of Vero cells. Archives of Virology 121, 19-27.[Medline]
Mettenleiter, T. C., Zsak, L., Zuckermann, F., Sugg, N., Kern, H. & Ben-Porat, T. (1990). Interaction of glycoprotein gIII with cellular heparin-like substance mediates adsorption of pseudorabies virus. Journal of Virology 64, 278-286.
Okazaki, K., Matsuzaki, T., Sugahara, Y., Okada, J., Hasebe, M., Iwamura, Y., Ohnishi, M., Kanno, T., Shimizu, M., Honda, E. & Kono, Y. (1991). BHV-1 adsorption is mediated by the interaction of glycoprotein gIII with heparinlike moiety on the cell surface. Virology 181, 666-670.[Medline]
Pellerin, C., van den Hurk, J., Lecomte, J. & Tijssen, P. (1994). Identification of a new group of bovine viral diarrhea virus strains associated with severe outbreaks and high mortalities. Virology 203, 260-268.[Medline]
Pocock, D. H., Howard, C. J., Clarke, M. C. & Brownlie, J. (1987). Variation in the intracellular polypeptide profiles from different isolates of BVDV. Archives of Virology 94, 43-53.[Medline]
Ridpath, J. F., Bolin, S. R. & Dubovi, E. J. (1994). Segregation of bovine viral diarrhea virus into genotypes. Virology 205, 66-74.[Medline]
Roderiquez, G., Oravecz, T., Yanagishita, M., Bou-Habib, D. C., Mostowski, H. & Norcross, M. A. (1995). Mediation of human immunodeficiency virus type 1 binding by interaction of cell surface heparan sulphate proteoglycans with the V3 region of envelope gp120-gp41. Journal of Virology 69, 2233-2239.[Abstract]
Rümenapf, T., Stark, R. G., Meyers, G. & Thiel, H.-J. (1991). Structural proteins of hog cholera virus expressed by vaccinia virus: further characterization and induction of protective immunity. Journal of Virology 65, 589-597.
Rümenapf, T., Unger, G., Strauss, J. H. & Thiel, H.-J. (1993). Processing of the envelope glycoproteins of pestiviruses. Journal of Virology 67, 3288-3294.
Sa-Carvalho, D., Reider, E., Baxt, B., Rodarte, R., Tanuri, A. & Mason, P. W. (1997). Tissue culture adaptation of foot-and-mouth disease virus selects viruses that bind to heparin and are attenuated in cattle. Journal of Virology 71, 5115-5123.[Abstract]
Sattentau, Q. J. & Weiss, R. A. (1991). The CD4 antigen: physiological ligand and HIV receptor. Cell 52, 631-633.
Schelp, C., Greiser-Wilke, I., Wolf, G., Beer, M., Moennig, V. & Liess, B. (1995). Identification of cell membrane proteins linked to susceptibility to bovine viral diarrhoea virus infection. Archives of Virology 140, 1997-2009.[Medline]
Schneider, R., Unger, G., Stark, R., Schneider-Scherzer, E. & Thiel, H.-J. (1993). Identification of a structural glycoprotein of an RNA virus as a ribonuclease. Science 261, 1169-1171.
Summerford, C. & Samulski, R. J. (1998). Membrane-associated heparan sulfate proteoglycan is a receptor for adeno-associated virus type 2 virions. Journal of Virology 72, 1438-1445.
Thiel, H.-J., Stark, R., Weiland, E., Rümenapf, T. & Meyers, G. (1991). Hog cholera virus: molecular composition of virions from a pestivirus. Journal of Virology 65, 4705-4712.
Thompson, W. R. (1947). Use of moving averages and interpolation to estimate median-effective dose. Bacteriological Reviews 11, 115-145.
Vanderplasschen, A., Bublot, M., Dubuisson, J., Pastoret, P.-P. & Thiry, E. (1993). Attachment of the gammaherpesvirus bovine herpesvirus 4 is mediated by the interaction of gp8 glycoprotein with heparin like moieties on the cell surface. Virology 196, 232-240.[Medline]
van Rijn, P. A., van Gennip, H. G. P., Leendertse, C. H., Bruschke, C. J. M., Paton, D. J., Moormann, R. J. M. & Van Oirschot, J. T. (1997). Subdivision of the pestivirus genus based on envelope glycoprotein E2. Virology 237, 337-348.[Medline]
van Zijl, M., Wensvoort, G., de Kluyver, E., Hulst, M., van der Gulden, H., Gielkens, A., Berns, A. & Moormann, R. J. M. (1991). Live attenuated pseudorabies virus expressing envelope glycoprotein E1 of hog cholera virus protects swine against both pseudorabies and hog cholera. Journal of Virology 65, 2761-2765.
Weiland, E., Stark, R., Haas, B., Rümenapf, T., Meyers, G. & Thiel, H.-J. (1990). Pestivirus glycoprotein which induces neutralizing antibodies forms part of a disulfide-linked heterodimer. Journal of Virology 64, 3563-3569.
Weiland, E., Stark, R., Weiland, F. & Thiel, H.-J. (1992). A second envelope glycoprotein mediates neutralization of a pestivirus, hog cholera virus. Journal of Virology 66, 3677-3682.
Weiland, F., Weiland, E., Unger, G., Saalmüller, A. & Thiel, H.-J. (1999). Localization of pestiviral envelope proteins Erns and E2 at the cell surface and on isolated particles. Journal of General Virology 80, 1157-1165.[Abstract]
Wengler, G., Bradley, D. W., Collett, M. S., Heinz, F. X., Schlesinger, R. W. & Strauss, J. H. (1995). Flaviviridae. In Virus Taxonomy. Sixth Report of the International Committee on Taxonomy of Viruses, pp. 415-427. Edited by F. A. Murphy, C. M. Fauquet, D. H. L. Bishop, S. A. Ghabrial, A. W. Jarvis, G. P. Martelli, M. A. Mayo & M. D. Summers. Vienna & New York: Springer-Verlag.
Windisch, J. M., Schneider, R., Stark, R., Weiland, E., Meyers, G. & Thiel, H.-J. (1996). RNase of classical swine fever virus: biochemical characterization and inhibition by virus-neutralizing monoclonal antibodies. Journal of Virology 70, 352-358.[Abstract]
WuDunn, D. & Spear, P. (1989). Initial interaction of herpes simplex virus with cells is binding to heparin sulfate. Journal of Virology 63, 52-58.
Xue, W. & Minocha, H. C. (1993). Identification of the cell surface receptor for bovine viral diarrhoea virus by using anti-idiotypic antibodies. Journal of General Virology 74, 73-79.
Zhang, G., Aldridge, S., Clarke, M. C. & McCauley, J. W. (1996). Cell death induced by cytopathic bovine viral diarrhoea virus is mediated by apoptosis. Journal of General Virology 77, 1677-1681.
Zhu, Z., Gershon, M. D., Ambron, R., Gabel, C. & Gershon, A. E. (1995). Infection of cells by varicella zoster virus: inhibition of viral entry by mannose 6-phosphate and heparin. Proceedings of the National Academy of Sciences, USA 92, 3546-3550.
Received 17 May 1999;
accepted 5 December 1999.
This article has been cited by other articles:
![]() |
S. Ronecker, G. Zimmer, G. Herrler, I. Greiser-Wilke, and B. Grummer Formation of bovine viral diarrhea virus E1-E2 heterodimers is essential for virus entry and depends on charged residues in the transmembrane domains J. Gen. Virol., September 1, 2008; 89(9): 2114 - 2121. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. A. Tews and G. Meyers The Pestivirus Glycoprotein Erns Is Anchored in Plane in the Membrane via an Amphipathic Helix J. Biol. Chem., November 9, 2007; 282(45): 32730 - 32741. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Chapel, C. Garcia, B. Bartosch, P. Roingeard, N. Zitzmann, F.-L. Cosset, J. Dubuisson, R. A. Dwek, C. Trepo, F. Zoulim, et al. Reduction of the infectivity of hepatitis C virus pseudoparticles by incorporation of misfolded glycoproteins induced by glucosidase inhibitors J. Gen. Virol., April 1, 2007; 88(4): 1133 - 1143. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Krey, E. Moussay, H.-J. Thiel, and T. Rumenapf Role of the Low-Density Lipoprotein Receptor in Entry of Bovine Viral Diarrhea Virus J. Virol., November 1, 2006; 80(21): 10862 - 10867. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Krey, A. Himmelreich, M. Heimann, C. Menge, H.-J. Thiel, K. Maurer, and T. Rumenapf Function of Bovine CD46 as a Cellular Receptor for Bovine Viral Diarrhea Virus Is Determined by Complement Control Protein 1. J. Virol., April 1, 2006; 80(8): 3912 - 3922. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. H. V. G. Gil, I. H. Ansari, V. Vassilev, D. Liang, V. C. H. Lai, W. Zhong, Z. Hong, E. J. Dubovi, and R. O. Donis The Amino-Terminal Domain of Bovine Viral Diarrhea Virus Npro Protein Is Necessary for Alpha/Beta Interferon Antagonism J. Virol., January 15, 2006; 80(2): 900 - 911. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Fetzer, B. A. Tews, and G. Meyers The Carboxy-Terminal Sequence of the Pestivirus Glycoprotein Erns Represents an Unusual Type of Membrane Anchor J. Virol., September 15, 2005; 79(18): 11901 - 11913. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Lecot, S. Belouzard, J. Dubuisson, and Y. Rouille Bovine Viral Diarrhea Virus Entry Is Dependent on Clathrin-Mediated Endocytosis J. Virol., August 15, 2005; 79(16): 10826 - 10829. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Krey, H.-J. Thiel, and T. Rumenapf Acid-Resistant Bovine Pestivirus Requires Activation for pH-Triggered Fusion during Entry J. Virol., April 1, 2005; 79(7): 4191 - 4200. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Maurer, T. Krey, V. Moennig, H.-J. Thiel, and T. Rumenapf CD46 Is a Cellular Receptor for Bovine Viral Diarrhea Virus J. Virol., February 15, 2004; 78(4): 1792 - 1799. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Iqbal, E. Poole, S. Goodbourn, and J. W. McCauley Role for Bovine Viral Diarrhea Virus Erns Glycoprotein in the Control of Activation of Beta Interferon by Double-Stranded RNA J. Virol., January 1, 2004; 78(1): 136 - 145. [Abstract] [Full Text] [PDF] |
||||
![]() |
O. Berteau and B. Mulloy Sulfated fucans, fresh perspectives: structures, functions, and biological properties of sulfated fucans and an overview of enzymes active toward this class of polysaccharide Glycobiology, June 1, 2003; 13(6): 29R - 40R. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. P. M. Langedijk, P. A. van Veelen, W. M. M. Schaaper, A. H. de Ru, R. H. Meloen, and M. M. Hulst A Structural Model of Pestivirus Erns Based on Disulfide Bond Connectivity and Homology Modeling Reveals an Extremely Rare Vicinal Disulfide J. Virol., September 11, 2002; 76(20): 10383 - 10392. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Iqbal and J. W. McCauley Identification of the glycosaminoglycan-binding site on the glycoprotein Erns of bovine viral diarrhoea virus by site-directed mutagenesis J. Gen. Virol., September 1, 2002; 83(9): 2153 - 2159. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. P. M. Langedijk Translocation Activity of C-terminal Domain of Pestivirus Erns and Ribotoxin L3 Loop J. Biol. Chem., February 8, 2002; 277(7): 5308 - 5314. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. M. Hulst, H. G. P. van Gennip, and R. J. M. Moormann Passage of Classical Swine Fever Virus in Cultured Swine Kidney Cells Selects Virus Variants That Bind to Heparan Sulfate due to a Single Amino Acid Change in Envelope Protein Erns J. Virol., October 15, 2000; 74(20): 9553 - 9561. [Abstract] [Full Text] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| INT J SYST EVOL MICROBIOL | MICROBIOLOGY | J GEN VIROL |
| J MED MICROBIOL | ALL SGM JOURNALS | |