J Gen Virol Email Content Delivery
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via CrossRef
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Iqbal, M.
Right arrow Articles by McCauley, J. W.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Iqbal, M.
Right arrow Articles by McCauley, J. W.
Agricola
Right arrow Articles by Iqbal, M.
Right arrow Articles by McCauley, J. W.
Journal of General Virology (2000), 81, 451-459.
© 2000 Society for General Microbiology


Animal: RNA Viruses

Interactions of bovine viral diarrhoea virus glycoprotein Erns with cell surface glycosaminoglycans

Munir Iqbal1, Helen Flick-Smithb,1 and John W. McCauley1

Division of Molecular Biology, Institute for Animal Health, Compton Laboratory, Compton, Newbury RG20 7NN, UK1

Author for correspondence: John W. McCauley. Fax +44 1635 577263. e-mail john.mccauley{at}bbsrc.ac.uk


   Abstract
TOP
Abstract
Introduction
Methods
Results
Discussion
References
 
Recombinant Erns glycoprotein of bovine viral diarrhoea virus (BVDV) has been tagged with a marker epitope or linked to an immunoglobulin Fc tail and expressed in insect and mammalian cell lines. The product was shown to be functional, both having ribonuclease activity and binding to a variety of cells that were permissive and non-permissive for replication of BVDV. Addition of soluble Erns to the medium blocked replication of BVDV in permissive cells. Binding of epitope-tagged Erns to permissive calf testes (CTe) cells was abolished and virus infection was reduced when cells were treated with heparinases I or III. Erns failed to bind to mutant Chinese hamster ovary (CHO) cells that lacked glycosaminoglycans (pgsA-745 cells) or heparan sulphate (pgsD-677 cells) but bound to normal CHO cells. Erns also bound to heparin immobilized on agarose and could be eluted by heparin and by a high concentration of salt. Flow cytometric analysis of Erns binding to CTe cell cultures showed that glycosaminoglycans such as heparin, fucoidan and dermatan sulphate all inhibit binding but dextran sulphate, keratan sulphate, chondroitin sulphate and mannan fail to inhibit binding. The low molecular mass polysulphonated inhibitor suramin also inhibited binding to CTe cells but poly-L-lysine did not. Furthermore, suramin, the suramin analogue CPD14, fucoidan and pentosan polysulphate inhibited the infectivity of virus. It is proposed that binding of Erns to cells is through an interaction with glycosaminoglycans and that BVDV may bind to cells initially through this interaction.


   Introduction
TOP
Abstract
Introduction
Methods
Results
Discussion
References
 
Bovine viral diarrhoea virus (BVDV), classical swine fever virus (CSFV) and border disease virus (BDV) are members of the genus Pestivirus in the family Flaviviridae and are associated with a variety of disorders of cattle, pig, sheep, deer and giraffe (Thiel et al., 1991Down ; Dekker et al., 1995Down ; van Rijn et al., 1997Down ; Becher et al., 1997Down ; Wengler et al., 1995Down ). The family Flaviviridae also includes viruses of major human importance including yellow fever virus, dengue virus and hepatitis C virus. Strains of BVDV can be classified into two genotypes, type 1 (BVDV-1) and type 2 (BVDV-2) (Pellerin et al., 1994Down ; Ridpath et al., 1994Down ). Viruses of either genotype may exist as one of two biotypes, non-cytopathogenic (NCP) or cytopathogenic (CP), as defined by the absence or presence of cytopathic effects in cell culture in which cells infected with CP virus die through apoptosis (Lee & Gillespie, 1957Down ; Gillespie et al., 1960Down ; Ridpath et al., 1994Down ; Zhang et al., 1996Down ). Co-infection with a CP virus and a related NCP virus can cause mucosal disease of cattle (Brownlie, 1991Down ).

The pestivirus genome comprises positive-strand RNA that is translated to form a single virus polyprotein which is processed by a combination of cellular and viral proteases to produce the mature virus proteins (Collett et al., 1988aDown ).The structural proteins comprise the nucleocapsid protein C and three envelope glycoproteins, Erns, E1 and E2 (Donis & Dubovi, 1987aDown ,bDown ; Collett et al., 1988bDown ; Thiel et al., 1991Down ). Studies on the interactions between the three glycoproteins have been carried out for CSFV. Initially, Erns and E1 are synthesized as a heterodimer (Erns/E1 precursor), but at later stages of polypeptide processing, Erns forms a disulphide-bonded homodimer (Rümenapf et al., 1993Down ; König et al., 1995Down ), whereas E2 forms a disulphide-linked homodimer and also a heterodimer with E1 (Weiland et al., 1990Down ; Rümenapf et al., 1991Down ). Erns and E2 are located at the surface of infected cells (Weiland et al., 1999Down ), induce virus-neutralizing antibodies (Donis et al., 1988Down ; Weiland et al., 1990Down , 1992Down ) and both have been shown to elicit protective immunity (Hulst et al., 1993Down ; König et al., 1995Down ; Rümenapf et al., 1993Down ; van Zijl et al., 1991Down ).

The virus functions of glycoprotein Erns, which is secreted into the extracellular environment (Rümenapf et al., 1993Down ), are not yet fully understood and the mechanism by which this protein is bound to the virion surface remains to be elucidated (Weiland et al., 1992Down ). Erns has been identified as a ribonuclease and this enzymatic activity is inhibited by virus-neutralizing antibodies but not by reduction and deglycosylation (Windisch et al., 1996Down ; Hulst et al., 1994Down ; Schneider et al., 1993Down ). CSFV Erns is able to induce apoptosis in lymphocytes of several species (Bruschke et al., 1997Down ).

The initial events in the cycle of BVDV infection are not known, and therefore it is important to identify the initial virus–host interactions necessary for BVDV infection, not only for the general understanding of pestivirus infection but also for the effective control of this virus. Previous studies showed that monoclonal antibodies directed against two bovine cell surface proteins (60 and 90 kDa) were able to inhibit virus infection (Schelp et al., 1995Down ) and, in addition, Xue & Minocha (1993)Down identified a 50 kDa cell surface protein as a putative E2-specific receptor. Recently, Erns and E2 were found to inhibit the infection of cultured pig kidney cells by CSFV in two distinct ways (Hulst & Moormann, 1997Down ) and Erns also showed binding to cells that were non-permissive for virus replication (Hulst & Moormann, 1997Down ). Here, we provide both biochemical and genetic evidence that cell surface glycosaminoglycans (GAGs) can serve as receptors for the BVDV Erns glycoprotein.


   Methods
TOP
Abstract
Introduction
Methods
Results
Discussion
References
 
{blacksquare} Cells and viruses.
Chinese hamster ovary cells (CHO-K1) and CHO-K1 mutant cells (GAG-deficient, pgsA-745; and heparan sulphate-deficient, pgsD-677) were obtained from the ATCC and grown in Ham’s F-12 medium supplemented with 10% BVDV-free foetal calf serum (FCS). Insect (Schneider S2; Drosophila) cells were obtained from Invitrogen and grown in DES expression medium (Invitrogen) containing 10% FCS at room temperature. Calf testes cells (CTe) were maintained in Eagle’s minimum essential medium (EMEM) supplemented with 10% FCS, 5% lactalbumin hydrolysate and 0·1% penicillin G and streptomycin. Porcine (PK15) cells were grown in EMEM supplemented with 10% FCS, 1% non-essential amino acids (NEAA) and 1 % tryptose phosphate broth. Bovine (MDBK), canine (MDCK) and human (Hep2) cells were grown in EMEM containing 10% FCS and 1% NEAA. Monkey (COS-7), human (HeLa) and murine (3T6) cells were maintained in Dulbecco’s modified minimum essential medium supplemented with 10% FCS. All of these cells were free of BVDV contamination and maintained at the Institute for Animal Health, Compton, UK. Working stocks (passage no. 12) of CP and NCP BVDV strain Pe515 (Pocock et al., 1987Down ) were prepared using CTe cells.

{blacksquare} Plasmid construction.
PCR was used to amplify a DNA fragment encoding Erns of BVDV (NCP) strain Pe515 corresponding to amino acids 268–494 of the BVDV reference strain NADL polyprotein in a 12-cycle reaction using Pfu DNA polymerase (Stratagene). The primers used were: 5' ATTCAAGTTACAAGATCTGAAAATATAACA 3', which corresponded to nucleotides 1178–1207 of the NADL genome sequence modified to include a BglII recognition site on the 5' end of the Erns sequence; and 5' CAATAAGGGTCTAGACGCGTATGCTCCAAA 3', which corresponded to nucleotides 1862–1891 of the NADL genome sequence in an antisense orientation modified by the inclusion of XbaI recognition site. For the Drosophila expression system, the XbaI- and BglII-digested PCR product was cloned into pMT/BiP/V5-His (Invitrogen) cut with XbaI and BglII. The shuttle vector (pMT/BiP/Erns/V5-His; abbreviated to pErnsV5) and control vector (pMT/BiP/GFP/V5-His; abbreviated to pGFP/V5) were individually co-transfected with the hygromycin-responsive selection vector pCoHYGRO (Invitrogen) at a ratio of 29:1 into insect (S2) cells. Transformation was performed using a calcium phosphate transfection kit (Invitrogen) according to the supplier’s instructions.

The sense primer used for the mammalian expression system was 5' ATTCAAGTTACAAAGCTTGAAAATATAACA 3', which corresponded to nucleotides 1178–1207 of the NADL genome incorporating a HindIII recognition site at the 5' end of the Erns sequence. The reverse primer, with an XbaI site at the 3' end of the Erns sequence, was 5' CAATAAGGGTCTAGACGCGTATGCTCCAAA 3', which corresponded to nucleotides 1862–1891 of the NADL genome sequence. The PCR product was digested with HindIII and XbaI and cloned into the Signal/pIg/Fc plasmid (R&D Systems). The recombinant plasmid (Signal/pIg/Erns/Fc) and control plasmid (Signal/pIg/CD44/Fc) were used for transient transfection of COS-7 cells using FuGENE6 transfection reagent (Roche Biochemicals) according to the supplier’s instructions. ErnsV5, ErnsFc and control proteins were secreted into the culture medium in both expression systems.

{blacksquare} Expression and purification.
Drosophila S2 cells harbouring the pErnsV5 were grown in DES expression medium without FCS in 175 cm2 flasks and expression of V5-tagged Erns (ErnsV5) was induced by the addition of copper sulphate (500 µM final concentration) when the cell density reached 4x106–6x106 cells/ml. After 2–3 days post-induction, the cells were harvested and the concentration of ErnsV5 was determined by ELISA with reference to known concentrations of purified protein. The culture supernatant was concentrated 10-fold by ultrafiltration and loaded onto a 2 ml metal affinity column (TALAN; Clontech) equilibrated and washed with buffer A (50 mM Tris–HCl, pH 8·0). A second wash was performed with buffer A containing 20 mM imidazole and the histidine-tagged protein was then eluted with buffer A containing 100 mM imidazole. Fractions containing ErnsV5 were pooled and dialysed against buffer A.

For the purification of Erns linked to an immunoglobulin Fc (ErnsFc) expressed in mammalian cells, the COS-7 cell culture supernatant was adjusted to (pH 8·0) by adding 1/10 volume of 1·0 M Tris–HCl (pH 8·0) and applied to a 1 ml protein A–agarose (Sigma) column. The column was equilibrated and first washed with 100 mM Tris–HCl (pH 8·0) and then 10 mM Tris–HCl (pH 8·0). The ErnsFc was eluted with 100 mM glycine, pH 3·0, and the fractions were immediately neutralized by adding 1/10 volume of 1·0 M Tris–HCl, pH 8·0.

{blacksquare} Immunoblot analysis.
Cell culture supernatants containing recombinant Erns were subjected to SDS–PAGE in the presence or absence of 2-mercaptoethanol and electrophoretically transferred to a PVDF membrane. The membrane was blocked with 5% skimmed milk in PBS and incubated with an anti-V5-HRP antibody [specific for the V5 epitope (Invitrogen)] and detected by ECL (Amersham).

{blacksquare} Plaque reduction assay

(i) Effect of Erns.
Confluent monolayers of CTe cells grown in 6-well tissue culture plates were washed twice with maintenance medium (EMEM) without FCS and pre-incubated for 1 h at 37 °C with 500 µl EMEM containing concentrations of ErnsV5 (0–50 µg/ml) or with 500 µl EMEM with a control protein (V5 epitope tagged GFP, GFP/V5His) at the same concentration. Following the preincubation period, 50 p.f.u. CP virus stock previously diluted in 500 µl EMEM was added to the cells, mixed and then incubated for 1 h. After 1 h, the virus inoculum was removed and the cells were rinsed once with EMEM and overlaid with maintenance medium containing 1% agarose. The cells were then incubated at 37 °C for 3 days, after which time they were stained with toluidine blue (0·1% toluidine blue, 4% formaldehyde in PBS) for 6 h at room temperature.

(ii) Effect of GAGs and GAG analogues.
Confluent monolayers of CTe cells grown in 6-well tissue culture plates were washed twice with EMEM without FCS and pre-incubated for 1 h at 37 °C with 500 µl EMEM containing the individual GAG or GAG analogue. These were: 0–20 mg/ml heparin, chondroitin sulphate, dermatan sulphate, dextran sulphate and a suramin analogue CPD1 (Braddock et al., 1994Down ); 0–10 mg/ml suramin and the suramin analogue CPD14 (Braddock et al., 1994Down ); or 0–5 mg/ml fucoidan and pentosan polysulphate. Following the preincubation period, 50 p.f.u. CP virus stock previously diluted in 500 µl EMEM was added to the cells, mixed and then incubated for 1 h. After 1 h, the virus/GAG mixture was removed and the cells were rinsed once with EMEM and overlaid with maintenance medium containing 1% agarose. The cells were then incubated at 37 °C for 3 days and the plaques were detected as above. The concentration of GAGs or GAG analogues required to reduce virus binding by 50% (IC50) was calculated using the method of moving averages (Thompson, 1947Down ).

{blacksquare} Detection of RNase activity.
RNase activity was determined using equal amounts of recombinant purified ErnsV5 and control protein GFP/V5His (expressed and purified in the same way as ErnsV5). The protein was incubated with 0·5 µg 16–23S rRNA (Roche Biochemicals) for 1 h at 37 °C in 50 mM Tris–HCl (pH 8·0), 10 mM MgCl2 and 100 mM NaCl containing 4 units/µl RNase inhibitor (from human placenta, RNasin; Promega). Following electrophoresis on a 1% agarose gel, the samples were stained with ethidium bromide.

{blacksquare} Binding of Erns to immobilized heparin.
Culture supernatant containing ErnsV5 was concentrated 10-fold by ultrafiltration through a 10000 MW cut-off stirred filtration unit (Amicon) and 2 ml (4 µg/ml) was loaded onto a 1 ml heparin–agarose column (Sigma) previously equilibrated with PBS. The column was washed with PBS and eluted with 1000 U/ml (6·5 mg/ml) of heparin in PBS. In a second experiment, the heparin–agarose column was washed and equilibrated with 50 mM Tris–HCl (pH 8·0) and the ErnsV5 was eluted with a step-gradient of increasing concentration of NaCl (0–2 M) in equilibration buffer. Fractions were analysed by ELISA by coating a 96-well plate with dilutions of each chromatography fraction overnight at 4 °C. Following binding, the wells were blocked with 5% skimmed milk and incubated with peroxidase-conjugated anti-V5 antibody. Bound antibody was detected with tetramethyl benzidine (TMB) substrate and the absorbance was measured at 630 nm.

{blacksquare} Detection of Erns binding by immunofluorescence.
Cells were grown to approximately 60–80% confluency on 12-mm-round glass coverslips in 24-well tissue culture dishes. Coverslips were rinsed with PBS and then incubated at room temperature for 1 h with 1 µg/ml purified ErnsV5. After washing with PBS, the cells were fixed with 4% paraformaldehyde in PBS for 10 min at room temperature, then rinsed several times with PBS, and blocked with PBS containing 5% normal goat serum and 0·1% sodium azide (GS wash buffer). Cells were incubated with 10 µg/ml anti-V5 monoclonal antibody (Invitrogen) in blocking buffer for 1 h at room temperature in a humidified chamber. After rinsing several times with PBS, cells were treated with FITC-conjugated goat anti-mouse IgG (Sigma) diluted 1:60 in GS wash buffer. Coverslips were rinsed and then mounted in mounting buffer [80% glycerol, 2·5% DABCO (1,4-diazabicyclo[2.2.2]octane) in PBS] and were viewed with a Leica TCS confocal laser microscope.

{blacksquare} Heparinase treatment of cell monolayers.
To determine Erns binding, monolayers of CTe cells were washed with PBS and then incubated with heparinase I and/or III (Sigma) at a concentration of 10 Sigma units/ml (600 Sigma units equivalent to 1 IU) in PBS for 1 h at 37 °C. The cells were then incubated with ErnsV5, fixed and processed as described above.

To determine the effect of virus infection on the heparinase-treated cells, the cells were washed with PBS and incubated with heparinase I (Sigma) at a concentration of up to 600 Sigma units/ml in PBS containing 0·1% BSA and 0·1% glucose (digestion buffer) for 1 h at 37 °C. Following the preincubation period, heparinase I and mock-treated cells were incubated with 50 p.f.u. CP virus diluted in digestion buffer and further incubated for 20 min at room temperature. The virus inoculum was removed and the cells were washed twice with EMEM and overlaid with maintenance medium containing 1% agarose. Monolayers were stained as described above. The results were compared by Student’s t-test and expressed as the mean±standard error of mean.

{blacksquare} Flow cytometric analysis.
CTe cells were grown overnight in 75 cm2 flasks, washed with EMEM and removed from the flasks using a rubber policeman. The cells were resuspended in maintenance medium containing 1 µg/ml ErnsV5 and 0·5 mg/ml of the following GAGs: heparin from bovine lung; fucoidan from Fucus vesiculosus; dermatan sulphate from bovine mucosa; chondroitin sulphate A from bovine trachea; keratan sulphate from bovine cornea; mannan from Saccharomyces cerevisiae; suramin (Sigma); poly-L-lysine (Sigma); and dextran sulphate (Sigma), and incubated at room temperature for 1 h. The cells were washed three times with GS wash buffer. Bound ErnsV5 was detected by incubation with anti-V5 antibody (10 µg/ml in GS wash buffer) for 30 min at 4 °C. After washing as above, the cells were incubated for 30 min with FITC-conjugated goat anti-mouse IgG antibody (1:200 dilution in GS wash buffer). Cells were then washed twice with GS wash buffer and resuspended in PBS containing 1% BSA and 0·1% sodium azide. Fluorescence intensity of single cells was measured using a FACScan flow cytometer (Becton Dickinson).


   Results
TOP
Abstract
Introduction
Methods
Results
Discussion
References
 
Production and characterization of recombinant Erns
A cDNA fragment encoding the 227 amino acid polypeptide of Erns was obtained by PCR amplification from a cloned plasmid containing a cDNA from NCP BVDV strain Pe515. The PCR product was inserted into plasmids from Drosophila (pMT/Bip/V5-His) and mammalian (Signal/pIg plus) expression systems. The resulting plasmids were pMT/Bip/Erns/V5-His (which produced ErnsV5) and Signal/pIg/Erns/Fc (which produced ErnsFc), respectively. For expression in mammalian cells, transient transfection of COS-7 cells was performed; whereas insect (S2) cells were transfected and selected for stable expression of recombinant proteins. The overall yields of Erns in the mammalian and insect expression systems were approximately 100 and 400 µg/l, respectively. Purified recombinant Erns produced in insect (S2) and COS-7 cells showed similar cell surface binding and RNase activities as described below. In this report, we detail the results obtained using the insect (S2) cell line-derived recombinant Erns.

Western blot analysis of the culture medium using anti-V5 epitope monoclonal antibodies revealed monomeric and dimeric forms of ErnsV5 under non-reducing conditions with apparent molecular masses of approximately 44 and 84 kDa, respectively. After reduction with 2-mercaptoethanol, the corresponding monomers show two bands of approximately 42–46 kDa (Fig. 1aDown).



View larger version (45K):
[in this window]
[in a new window]
 
Fig. 1. Characterization of recombinant Erns produced in insect (S2) cells. (a) Western blot analysis of ErnsV5 (lanes 1 and 3) and control GFP/V5His (lanes 2 and 4) fusion proteins expressed in Drosophila (S2) cells and separated by 10% SDS–PAGE under non-reducing (lanes 1 and 2) and reducing (lanes 3 and 4) conditions, and probed with HRP-conjugated anti-V5 antibody in conjunction with a chemiluminescent substrate. (b) Detection of Erns ribonuclease activity. 16–23S rRNA (mock, lane 1) treated with ErnsV5 (lane 2) and with control protein GFP/V5His (lane 3). The samples were incubated for 1 h at 37 °C in 50 mM Tris–HCl, pH 8·0, 10 mM MgCl2, 100 mM NaCl containing 4 units/µl RNase inhibitor and analysed on 1% agarose gel and stained with ethidium bromide.

 
Ribonuclease activity of insect cell-derived ErnsV5, purified on a metal chelating resin, was detected using a 16–23S rRNA as a substrate in the presence of RNasin. In contrast, no ribonuclease activity was observed with a control protein, GFP/V5His, produced in S2 cells and purified using the same protocol (Fig. 1bUp).

Recombinant ErnsV5 was further examined by testing its ability to inhibit plaque formation. Cells were incubated with ErnsV5 and control protein GFP/V5His and infected with CP BVDV virus. As shown in Fig. 2Down, the addition of ErnsV5 during the period of virus attachment reduced plaque formation in a concentration-dependent manner. The effect was specific for ErnsV5 as the control protein GFP/V5His has no effect on plaque number over the same concentration range. These results confirm that recombinant BVDV Erns similarly shares the characteristics of Erns of CSFV.



View larger version (17K):
[in this window]
[in a new window]
 
Fig. 2. Inhibition of infection of BVDV by Erns. CTe cells were pre-incubated for 1 h with 500 µl medium containing (a) ErnsV5 (•) and (b) control protein GFP/V5His ({blacksquare}) at the indicated concentrations. Subsequently, 500 µl medium containing CP virus was added and the cells were further incubated for 1 h, washed and overlaid with medium containing 1% agarose. After incubation for 3 days, the cells were fixed, and stained with toluidine blue.

 
Erns binding to the cell surface
Binding of BVDV ErnsV5 to the surface of a wide variety of cells, both permissive [CTe (exemplified in Fig. 3Down), MDBK and PK15, data not shown] and non-permissive [CHO-K1 (exemplified in Fig. 4Down), HeLa, MDCK, COS-7, 3T6 and Hep2, data not shown] for BVDV replication was examined. Detection of Erns on the cell surface was done with a monoclonal antibody to the V5 epitope and the results showed that ErnsV5 was able to bind to each cell type examined. A control protein with the same epitope tag, GFP-V5, did not bind any of the cells.



View larger version (30K):
[in this window]
[in a new window]
 
Fig. 3. Flow cytometric analysis of interactions between cell surface GAGs and Erns. CTe cells were incubated with (a) ErnsV5 (filled-in histograms) or control protein GFP/V5His (open histograms) and examined by flow cytometry. (b–j) CTe cells were treated with 1 µg/ml ErnsV5 alone (filled-in histograms) or 1 µg/ml Erns V5 and 500 µg/ml GAGs or analogues (open histograms): (b) heparin, (c) suramin, (d) fucoidan, (e) dermatan sulphate, (f) chondroitin sulphate, (g) keratan sulphate, (h) dextran sulphate, (i) poly-L-lysine, (j) mannan. The cells were then washed and probed with anti-V5 antibody and FITC-conjugated secondary antibody and examined by flow cytometry.

 


View larger version (65K):
[in this window]
[in a new window]
 
Fig. 4. Effect of heparinases on Erns binding to calf testes cells. Cells were untreated (a and b) or were treated with heparinase I (c) or heparinase III (d). After rinsing, the cells were incubated with ErnsV5 (a, c, d) or control protein GFP/V5His (b) for 1 h. The cells were washed with PBS and fixed with 4 % paraformaldehyde. Bound Erns was detected with anti-V5 antibody and FITC-conjugated secondary antibody and visualized by confocal microscopy.

 
We hypothesized that Erns may bind to cell surface proteoglycans. To test this hypothesis, we analysed the ability of soluble GAGs to inhibit the binding of ErnsV5 to the cell surface. ErnsV5 (1 µg/ml) and GAGs (at a concentration of 500 µg/ml) were mixed and incubated with cultured cells for 1 h at room temperature. Following incubation, the cells were rinsed and assayed for ErnsV5 binding by flow cytometry (Fig. 3aUp) and by immunofluorescence microscopy (data not shown). Co-incubation of heparin, suramin, fucoidan and dermatan sulphate with ErnsV5 resulted in a marked inhibition of ErnsV5 binding (Fig. 3bUp, cUp, dUp, eUp) whereas chondroitin sulphate, keratan sulphate, dextran sulphate, poly-L-lysine and mannan had no significant effect on ErnsV5 binding (Fig. 3fUp, gUp, hUp, iUp, jUp).

Treatment of cells with heparinases
To investigate whether Erns binding to the cell surface was mediated directly through GAGs, CTe cells were treated with specific GAG lyases, followed by assessment of ErnsV5 binding. Heparinase I, which degrades heparin and highly sulphated domains in heparan sulphate and heparinase III (specific for heparan sulphate) were added to cells at a concentration of 10 units/ml in medium at 37 °C for 1 h and the cells were then fixed with paraformaldehyde. ErnsV5 binding to cells was clearly reduced following pre-treatment of the cells with either heparinase I or heparinase III (Fig. 4Up).

Binding to GAG-deficient mutant cell lines
To characterize further the nature of cell-surface GAGs as Erns receptors, the binding of ErnsV5 to wild-type CHO cells and mutant CHO cell lines that had defects in the production of specific GAGs was examined. Although binding of ErnsV5 to the wild-type CHO cells was easily detectable, no binding of ErnsV5 was observed on mutant cells pgsA-745 or pgsD-677 (Fig. 5Down). The reduced binding of ErnsV5 to the heparan sulphate/GAG-deficient mutant cells pgsA-745 and pgsD-677, indicated that the presence of heparan sulphate proteoglycan is a principal requirement for Erns attachment to the cell surface. Furthermore, no binding to pgsD-677 (which is heparan sulphate/GAG-deficient but produces three times more chondroitin sulphate; Esko et al., 1985Down ) demonstrated that Erns exhibited at least some specificity for heparan sulphate or heparin.



View larger version (20K):
[in this window]
[in a new window]
 
Fig. 5. Immunofluorescence staining of Erns bound to the cell surface of wild-type and mutant CHO cells. Coverslips of wild-type (a and b) and mutant cell lines pgsA-745 (c), pgsD-677 (d) were incubated with ErnsV5 (a, c, d) or control protein GFP/V5His (b) for 1 h, rinsed with PBS, fixed with 4% paraformaldehyde and stained with anti-V5 antibody and FITC-conjugated secondary antibody and examined by confocal microscopy.

 
These results indicated that the heparin or heparan sulphate and not the chondroitin sulphate moieties of cell surface proteoglycans serve as receptors for the BVDV Erns glycoprotein. In addition, the reduced binding of ErnsV5 to pgsD-677 cells and the inability of chondroitin sulphate and dextran sulphate to inhibit binding suggest that the degree of sulphation may be an important factor influencing binding of Erns to proteoglycans.

Inhibition of virus infection by GAGs, GAG analogues and heparinase treatment
To correlate the results obtained with recombinant Erns, virus infection experiments were performed to determine whether soluble GAGs or GAG analogues could inhibit infection of CTe cells by BVDV. Suramin and the suramin analogues CPD1 and CPD14, fucoidan, pentosan polysulphate, heparin, chondroitin sulphate, dermatan sulphate and dextran sulphate were incubated with permissive cells both prior to, and during, virus binding. The effect of these compounds on virus infection was determined by reduction in the plaque titre. Results of these studies show that addition of suramin, the suramin analogue CPD14, fucoidan and pentosan polysulphate can reduce plaque number in a concentration-dependent manner (Fig. 6Down); the concentrations required to reduce virus infection by 50% were 2·87, 5, 0·15 and 0·62 mg/ml, respectively. In contrast, heparin, chondroitin sulphate, dermatan sulphate, dextran sulphate and the suramin analogue CPD1 did not have any significant effect on virus infectivity.



View larger version (23K):
[in this window]
[in a new window]
 
Fig. 6. Inhibition of BVDV infection by various GAGs and GAG analogues. The CTe cells were pre-incubated with the indicated concentrations of suramin (•), suramin analogue CPD14 ({blacksquare}), fucoidan ({blacktriangleup}), pentosan polysulphate ({diamondsuit}), suramin analogue CPD1 (), heparin ({circ}), chondroitin sulphate ({square}), dermatan sulphate ({bigtriangledown}) and dextran sulphate ({triangleup}) for 1 h at 37 °C, followed by the addition of CP BVDV adsorption for 1 h. After adsorption, the virus–GAG mixture was removed and the cells were washed and overlaid with medium containing 1% agarose. After incubation at 37 °C for 3 days, the cells were fixed and stained with toluidine blue. Each point represents the average of duplicate cultures repeated three times. Plaque formation without GAG addition was taken as 100%.

 
In addition, the effect of heparinase treatment of permissive cells on virus infectivity was examined. Treatment of cells with heparinase prior to infection reduced significantly (P<0·01) the virus titre by approximately 50% compared to mock-treated controls (treated, 10·0±0·5 plaques per well; untreated, 19·62±0·62 plaques per well).

Binding of Erns to immobilized heparin
To examine whether Erns binds directly to GAGs, recombinant ErnsV5 was applied to immobilized heparin–agarose. The majority of ErnsV5 bound to the column and was eluted with 1000 units/ml (6·5 mg/ml) soluble heparin and by 0·5 M and 1 M NaCl (Fig. 7Down). These data confirmed that Erns can bind to charged GAGs in vitro and is consistent with a direct interaction of Erns with sulphated GAGs present on the surface of cells.



View larger version (2K):
[in this window]
[in a new window]
 
Fig. 7. Binding of Erns to heparin–agarose. Concentrated culture supernatant of recombinant ErnsV5 was applied to a 1 ml heparin–agarose column. (a) The column was equilibrated, washed with PBS (fractions 1–10), and ErnsV5 was eluted with 6·5 mg/ml soluble heparin (fractions 11–20). (b) The column was equilibrated and washed with Tris–HCl, pH 8·0, and the ErnsV5 was eluted with steps of increasing concentrations of NaCl (0–2 M) in equilibration buffer. The concentration of ErnsV5 was assayed by ELISA in each fraction as described in Methods.

 

   Discussion
TOP
Abstract
Introduction
Methods
Results
Discussion
References
 
To study the interaction of BVDV glycoprotein Erns with the cell surface, we have cloned recombinant Erns into mammalian and Drosophila expression vectors. As expected, the recombinant Erns displayed very similar biological activities as those reported for Erns from CSFV (Windisch et al., 1996Down ; Schneider et al., 1993Down ; Hulst et al., 1994Down ; Hulst & Moormann, 1997Down ). The glycoprotein was secreted into the culture medium as a monomer and as a disulphide-linked homodimer, it contained ribonuclease activity, it inhibited BVDV infection of cultured cells and bound to cells both permissive and non-permissive for BVDV replication.

We demonstrated that BVDV Erns binding to cells was inhibited by soluble GAGs and we hypothesize that Erns binds directly to GAGs on the cell surface since enzymatic treatment of cells with heparinase abolishes Erns binding to cells. Moreover, recombinant Erns can bind to heparin immobilized on agarose and could be eluted with heparin and relatively high salt concentration. A variety of GAGs and polyanions were tested for their ability to inhibit Erns binding to cells and the results indicated that soluble GAGs (heparin, fucoidan and dermatan sulphate) inhibited binding whereas chondroitin sulphate, keratan sulphate and mannan failed to inhibit binding. From these experiments, we conclude that Erns binding showed some specificity to GAGs. This conclusion is supported by the experiments that examined Erns binding to mutant CHO cells in which GAG biosynthesis was defective. Erns failed to bind to cells with greatly reduced levels of GAGs (pgsA-745), but also failed to bind to cells that were unable to make heparan sulphate (pgsD-677) but presented chondroitin sulphate on the cell surface (Esko et al., 1985Down ; Lidholt et al., 1992Down ). Overall, our data indicated that Erns binding requires heparan sulphate and not chondroitin sulphate moieties, although we have not yet identified the specific sugar sequence required for Erns binding. Heparan sulphate GAGs consist of repeating disaccharide units composed of alternating glucosamine monosaccharides. The specificity exhibited by Erns for heparan sulphate moieties demonstrates that Erns may interact with a glucosamine–hexuronic acid backbone. Further, since excess soluble dermatan sulphate could inhibit Erns binding, Erns may also interact with a heparan sulphate backbone that contains iduronic acid.

Erns is secreted from infected cells but it is also a structural component of the virus particle (Rümenapf et al., 1993Down ; Weiland et al., 1992Down ). We have shown that the polysulphonated compounds suramin and fucoidan blocked both Erns binding to cells and also inhibited virus replication in tissue culture. These observations suggest that Erns binding to the cell surface plays a role in virus replication. However, we failed to observe inhibition of virus replication with heparin sulphate and heparinase treatment of CTe cells did not completely block virus infection. In the case of dengue virus, hepatitis C virus and adeno-associated virus type 2, highly sulphated forms of GAGs are required in order to inhibit infectivity (Chen et al., 1997Down ; Garson et al., 1999Down ; Summerford & Samulski, 1998Down ). It is possible that the failure of heparin sulphate to block infection of CTe cells by BVDV may be similarly determined by the degree of sulphation of heparan sulphate. The preparation of heparan sulphate used in our studies was clearly sufficient to inhibit monomeric or dimeric binding of Erns but possibly not when Erns was associated with the virus particle.

Heparinase treatment of CTe cells reduced infection by approximately 50%. This level of inhibition is somewhat lower than that observed with some other viruses that bind to heparan sulphate moieties. For example, although infectivity of cells treated with heparinase was reduced only by 50% for Sindbis virus (Mastromarino et al., 1991Down ; Byrnes & Griffin, 1998Down ), for other viruses the reduction of infectivity following heparinase treatment of cells was higher: reductions of infectivity of 80–90% for herpes simplex viruses (HSV) (WuDunn & Spear, 1989Down ), of 66% for adeno-associated virus (Summerford & Samulski, 1998Down ) and of 70–80% for foot-and-mouth disease virus (Jackson et al., 1996Down ) have been reported. Nevertheless, reduction of BVDV infectivity following heparinase treatment of CTe cells was statistically significant. The reasons for the variation in the effect of heparinase treatment have not been systematically explored. The variable response may be caused by the differences in cell type and the degree to which virus may have adapted in culture to more efficient use of heparan sulphate (Sa-Carvalho et al., 1997Down ). Indeed, HSV that fails to bind heparan sulphate through either gC or gB retains its ability to infect cells (Laquerre et al., 1998Down ). The binding to heparan sulphate may be bypassed for BVDV infection of cultured CTe cells.

Our results show that cell lines from cattle, pig, human, mouse, monkey and dog interact with BVDV Erns; similar results were shown by Hulst & Moormann (1997)Down for CSFV. However, BVDV infection of mammalian cells shows species specificity. This suggests that infection of cells by BVDV may be dependent on a multistep process in which virus attachment to cells and internalization are two distinct steps requiring different cell surface receptors. This conclusion is supported by the literature. Hulst & Moormann (1997)Down reported that CSFV glycoproteins Erns and E2 interact with distinct cell surface receptors, whereas Schelp et al. (1995)Down identified two bovine-specific cell surface proteins of 60 and 90 kDa with monoclonal antibodies which efficiently inhibited the infection of bovine cells with BVDV, and Xue & Minocha (1993)Down identified a 50 kDa cell surface protein as a potential E2-specific receptor.

There is a growing list of viruses that enter cells by binding to two or more receptors. Herpesviruses, including HSV (WuDunn & Spear, 1989Down ), human cytomegalovirus (Compton et al., 1993Down ), bovine herpesvirus types 1 and 4 (Okazaki et al., 1991Down ; Vanderplasschen et al., 1993Down ), pseudorabies virus (Mettenleiter et al., 1990Down ) and varicella-zoster virus (Zhu et al., 1995Down ), have recently been reported to use GAGs as the initial site of binding to cells. Foot-and-mouth disease virus (Jackson et al., 1996Down ; Sa-Carvalho et al., 1997Down ), dengue virus (Chen et al., 1997Down ), respiratory syncytial virus (Krusat & Streckert, 1997Down ), Sindbis virus (Klimstra et al., 1998Down ), porcine reproductive and respiratory syndrome virus (Jusa et al., 1997Down ), equine arteritis virus (Asagoe et al., 1997Down ) and vaccinia virus (Chung et al., 1998Down ) have also been shown to bind to cells through GAGs. Three-stage binding of virus to cells occurs in human immunodeficiency virus (HIV) infection, in which HIV glycoproteins bind to heparan sulphate proteoglycans and CD4 (Roderiquez et al., 1995Down ; Sattentau & Weiss, 1991Down ) followed by binding to chemokine receptors (Doms & Peiper, 1997Down ). The demonstration here that a pestivirus Erns binds to cell surface GAGs leads us to postulate that pestivirus attachment and entry into cells is likely to be another example of a complex virus entry mechanism.

Recent work on Erns from CSFV shows that it, like BVDV Erns, binds to GAGs, and virus replication in vitro is also inhibited by polysulphonated compounds and GAGs (M. M. Hulst & R. J. M. Moormann, personal communication).

Note added in proof. It has recently been shown by Agnello et al. (Proceedings of the National Academy of Sciences, USA 96, 12766–12771, 1999) that the low density lipoprotein receptor can mediate entry of several members of the Flaviviridae, including BVDV, and that BVDV is restricted at a stage beyond virus entry.


   Acknowledgments
 
We thank Mrs Michelle Hill for providing the initial Erns cDNA clone, Dr Terry Jackson for discussion and for providing GAG-deficient mutant cells, Dr R. Bicknell (John Radcliffe Hospital, Oxford, UK) for kindly providing suramin analogues, Drs Martin Fray and Sue Baigent for critical review of the manuscript and discussion, and Drs Gang Zhang, Ivan Morrison, Bryan Charleston, Trevor Collen and Mr Michael Clarke for comments and discussion.


   Footnotes
 
b Present address: DERA, Porton Down, SP4 0JQ, UK. Back


   References
TOP
Abstract
Introduction
Methods
Results
Discussion
References
 
Asagoe, T., Inaba, Y., Jusa, E. R., Kouno, M., Uwatoko, K. & Fukunaga, Y. (1997). Effect of heparin on infection of cells by equine arteritis virus. Journal of Veterinary Medical Science 59, 727-728.[Medline]

Becher, P., Orlich, M., Shannon, A. D., Horner, G., König, M. & Thiel, H.-J. (1997). Phylogenetic analysis of pestiviruses from domestic and wild ruminants. Journal of General Virology 78, 1357-1366.[Abstract]

Braddock, P. S., Hu, D. E., Fan, T. P. D., Stratford, I. J., Harris, A. L. & Bicknell, R. (1994). A structure-activity analysis of antagonism of the growth factor and angiogenic activity of basic growth factor by suramin and related polyanions. British Journal of Cancer 69, 890-898.[Medline]

Brownlie, J. (1991). The pathway for bovine virus diarrhoea virus biotypes in the pathogenesis of disease. Archives of Virology Supplement 3, 79-96.[Medline]

Bruschke, C. J. M., Hulst, M. M., Moormann, R. J. M., van Rijn, P. A. & van Oirschot, J. T. (1997). Glycoprotein Erns of pestiviruses induces apoptosis in lymphocytes of several species. Journal of Virology 71, 6692-6696.[Abstract]

Byrnes, A. P. & Griffin, D. E. (1998). Binding of Sindbis virus to cells surface heparan sulfate. Journal of Virology 72, 7349-7356.[Abstract/Free Full Text]

Chen, Y., Maguire, T., Hileman, R. E., Fromm, J. R., Esko, J. D., Linhardt, R. J. & Marks, R. M. (1997). Dengue virus infectivity depends on envelope protein binding to target cell heparan sulfate. Nature Medicine 3, 866-871.[Medline]

Chung, C.-S., Hsaio, J.-C., Chang, Y.-S. & Chang, W. (1998). A27L protein-mediated vaccinia virus interaction with cell surface heparan sulfate. Journal of Virology 72, 1577-1585.[Abstract/Free Full Text]

Collett, M. S., Larson, R., Gold, C., Strick, D., Anderson, D. K. & Purchio, A. F. (1988a). Molecular cloning and nucleotide sequence of pestivirus bovine viral diarrhea virus. Virology 165, 191-199.[Medline]

Collett, M. S., Larson, R., Belzer, S. K. & Retzel, E. (1988b). Proteins encoded by bovine viral diarrhea virus: the genomic organization of a pestivirus. Virology 165, 200-208.[Medline]

Compton, T., Nowlin, D. M. & Cooper, N. R. (1993). Initiation of human cytomegalovirus infection requires initial interaction with cell surface heparan sulfate. Virology 193, 834-841.[Medline]

Dekker, A., Wensvoort, G. & Terpstra, C. (1995). Six antigenic groups within the genus pestivirus as identified by cross neutralization assays. Veterinary Microbiology 47, 317-329.[Medline]

Doms, R. W. & Peiper, S. C. (1997). Unwelcomed guests with master keys: how HIV uses chemokine receptors for cellular entry. Virology 235, 179-190.[Medline]

Donis, R. O. & Dubovi, E. J. (1987a). Characterization of bovine viral diarrhoea-mucosal disease virus-specific proteins in bovine cells. Journal of General Virology 68, 1597-1605.[Abstract/Free Full Text]

Donis, R. O. & Dubovi, E. J. (1987b). Glycoproteins of bovine viral diarrhoea-mucosal disease virus in infected bovine cells. Journal of General Virology 68, 1607-1616.[Abstract/Free Full Text]

Donis, R. O., Corapi, W. V. & Dubovi, E. J. (1988). Neutralizing monoclonal antibodies to bovine viral diarrhoea virus binds to the 56K to 58K glycoprotein. Journal of General Virology 69, 77-86.[Abstract/Free Full Text]

Esko, J. D., Stewart, T. E. & Taylor, W. H. (1985). Animal cell mutants defective in glycosaminoglycan synthesis. Proceedings of the National Academy of Sciences, USA 82, 3197-3201.[Abstract/Free Full Text]

Garson, J. A., Lubach, D., Passas, J., Whitby, K. & Grant, P. R. (1999). Suramin blocks hepatitis C binding hepatoma cells in vitro. Journal of Medical Virology 57, 238-242.[Medline]

Gillespie, J. H., Baker, J. A. & McEntee, K. (1960). A Cytopathogenic strain of virus diarrhea virus. Cornell Veterinary 50, 73-79.

Hulst, M. M. & Moormann, R. J. M. (1997). Inhibition of pestivirus infection in cell culture by envelope proteins Erns and E2 of classical swine fever virus: Erns and E2 interact with different receptors. Journal of General Virology 78, 2779-2787.[Abstract]

Hulst, M. M., Westra, D. F., Wensvoort, G. & Moormann, R. J. M. (1993). Glycoprotein E1 of hog cholera virus expressed in insect cells protects swine from hog cholera. Journal of Virology 67, 5435-5442.[Abstract/Free Full Text]

Hulst, M. M., Himes, G., Newbigin, E. & Moormann, R. J. M. (1994). Glycoprotein E2 of classical swine fever virus: expression in insect cells and identification as a ribonuclease. Virology 200, 558-565.[Medline]

Jackson, T., Ellard, F. M., Ghazaleh, R. A., Brookes, S. M., Blakemore, W. E., Corteyn, A. H., Stuart, D. I., Newman, J. W. I. & King, A. M. (1996). Efficient infection of cells in culture by type O foot-and-mouth disease virus requires binding to cell surface heparan sulphate. Journal of Virology 70, 5282-5287.[Abstract/Free Full Text]

Jusa, E. R., Inaba, Y., Kouno, M. & Hirose, O. (1997). Effect of heparin on infection of cells by porcine reproductive and respiratory syndrome virus. American Journal of Veterinary Research 58, 488-491.[Medline]

Klimstra, W. B., Ryman, K. D. & Johnston, R. E. (1998). Adaptation of Sindbis virus to BHK cells selects for use of heparan sulfate as an attachment receptor. Journal of Virology 72, 7357-7366.[Abstract/Free Full Text]

König, M., Lengsfeld, T., Pauly, T., Stark, R. & Thiel, H.-J. (1995). Classical swine fever virus: independent induction of protective immunity by two structural proteins. Journal of Virology 69, 6479-6486.[Abstract]

Krusat, T. & Streckert, H.-J. (1997). Heparin-dependent attachment of respiratory syncytial virus (RSV) to host cells. Archives of Virology 142, 1247-1254.[Medline]

Laquerre, S., Argnani, R., Anderson, D. B., Zucchini, S., Manservigi, R. & Glorioso, J. C. (1998). Heparan sulfate proteoglycan binding by herpes simplex virus type 1 glycoproteins B and C, which differ in their contributions to virus attachment, penetration, and cell-to-cell spread. Journal of Virology 72, 6119-6130.[Abstract/Free Full Text]

Lee, K. L. & Gillespie, J. H. (1957). Propagation of virus diarrhea virus of cattle in tissue culture. American Journal of Veterinary Research 18, 952-953.[Medline]

Lidholt, K., Weinke, J. L., Kiser, C. S., Lugemwa, F. N., Bame, K. J., Cheifetz, S., Massague, J., Lindahl, U. & Esko, J. D. (1992). A single mutation affects both N-acetylglucosaminyltransferase and glucuronosyltransferase activities in a Chinese hamster ovary cell mutant defective in heparan sulfate biosynthesis. Proceedings of the National Academy of Sciences, USA 89, 2267-2271.[Abstract/Free Full Text]

Mastromarino, P., Conti, C., Petruzziello, R., Lapadula, R. & Orsi, N. (1991). Effect of polyions on the early events of Sindbis virus infection of Vero cells. Archives of Virology 121, 19-27.[Medline]

Mettenleiter, T. C., Zsak, L., Zuckermann, F., Sugg, N., Kern, H. & Ben-Porat, T. (1990). Interaction of glycoprotein gIII with cellular heparin-like substance mediates adsorption of pseudorabies virus. Journal of Virology 64, 278-286.[Abstract/Free Full Text]

Okazaki, K., Matsuzaki, T., Sugahara, Y., Okada, J., Hasebe, M., Iwamura, Y., Ohnishi, M., Kanno, T., Shimizu, M., Honda, E. & Kono, Y. (1991). BHV-1 adsorption is mediated by the interaction of glycoprotein gIII with heparin–like moiety on the cell surface. Virology 181, 666-670.[Medline]

Pellerin, C., van den Hurk, J., Lecomte, J. & Tijssen, P. (1994). Identification of a new group of bovine viral diarrhea virus strains associated with severe outbreaks and high mortalities. Virology 203, 260-268.[Medline]

Pocock, D. H., Howard, C. J., Clarke, M. C. & Brownlie, J. (1987). Variation in the intracellular polypeptide profiles from different isolates of BVDV. Archives of Virology 94, 43-53.[Medline]

Ridpath, J. F., Bolin, S. R. & Dubovi, E. J. (1994). Segregation of bovine viral diarrhea virus into genotypes. Virology 205, 66-74.[Medline]

Roderiquez, G., Oravecz, T., Yanagishita, M., Bou-Habib, D. C., Mostowski, H. & Norcross, M. A. (1995). Mediation of human immunodeficiency virus type 1 binding by interaction of cell surface heparan sulphate proteoglycans with the V3 region of envelope gp120-gp41. Journal of Virology 69, 2233-2239.[Abstract]

Rümenapf, T., Stark, R. G., Meyers, G. & Thiel, H.-J. (1991). Structural proteins of hog cholera virus expressed by vaccinia virus: further characterization and induction of protective immunity. Journal of Virology 65, 589-597.[Abstract/Free Full Text]

Rümenapf, T., Unger, G., Strauss, J. H. & Thiel, H.-J. (1993). Processing of the envelope glycoproteins of pestiviruses. Journal of Virology 67, 3288-3294.[Abstract/Free Full Text]

Sa-Carvalho, D., Reider, E., Baxt, B., Rodarte, R., Tanuri, A. & Mason, P. W. (1997). Tissue culture adaptation of foot-and-mouth disease virus selects viruses that bind to heparin and are attenuated in cattle. Journal of Virology 71, 5115-5123.[Abstract]

Sattentau, Q. J. & Weiss, R. A. (1991). The CD4 antigen: physiological ligand and HIV receptor. Cell 52, 631-633.

Schelp, C., Greiser-Wilke, I., Wolf, G., Beer, M., Moennig, V. & Liess, B. (1995). Identification of cell membrane proteins linked to susceptibility to bovine viral diarrhoea virus infection. Archives of Virology 140, 1997-2009.[Medline]

Schneider, R., Unger, G., Stark, R., Schneider-Scherzer, E. & Thiel, H.-J. (1993). Identification of a structural glycoprotein of an RNA virus as a ribonuclease. Science 261, 1169-1171.[Abstract/Free Full Text]

Summerford, C. & Samulski, R. J. (1998). Membrane-associated heparan sulfate proteoglycan is a receptor for adeno-associated virus type 2 virions. Journal of Virology 72, 1438-1445.[Abstract/Free Full Text]

Thiel, H.-J., Stark, R., Weiland, E., Rümenapf, T. & Meyers, G. (1991). Hog cholera virus: molecular composition of virions from a pestivirus. Journal of Virology 65, 4705-4712.[Abstract/Free Full Text]

Thompson, W. R. (1947). Use of moving averages and interpolation to estimate median-effective dose. Bacteriological Reviews 11, 115-145.

Vanderplasschen, A., Bublot, M., Dubuisson, J., Pastoret, P.-P. & Thiry, E. (1993). Attachment of the gammaherpesvirus bovine herpesvirus 4 is mediated by the interaction of gp8 glycoprotein with heparin like moieties on the cell surface. Virology 196, 232-240.[Medline]

van Rijn, P. A., van Gennip, H. G. P., Leendertse, C. H., Bruschke, C. J. M., Paton, D. J., Moormann, R. J. M. & Van Oirschot, J. T. (1997). Subdivision of the pestivirus genus based on envelope glycoprotein E2. Virology 237, 337-348.[Medline]

van Zijl, M., Wensvoort, G., de Kluyver, E., Hulst, M., van der Gulden, H., Gielkens, A., Berns, A. & Moormann, R. J. M. (1991). Live attenuated pseudorabies virus expressing envelope glycoprotein E1 of hog cholera virus protects swine against both pseudorabies and hog cholera. Journal of Virology 65, 2761-2765.[Abstract/Free Full Text]

Weiland, E., Stark, R., Haas, B., Rümenapf, T., Meyers, G. & Thiel, H.-J. (1990). Pestivirus glycoprotein which induces neutralizing antibodies forms part of a disulfide-linked heterodimer. Journal of Virology 64, 3563-3569.[Abstract/Free Full Text]

Weiland, E., Stark, R., Weiland, F. & Thiel, H.-J. (1992). A second envelope glycoprotein mediates neutralization of a pestivirus, hog cholera virus. Journal of Virology 66, 3677-3682.[Abstract/Free Full Text]

Weiland, F., Weiland, E., Unger, G., Saalmüller, A. & Thiel, H.-J. (1999). Localization of pestiviral envelope proteins Erns and E2 at the cell surface and on isolated particles. Journal of General Virology 80, 1157-1165.[Abstract]

Wengler, G., Bradley, D. W., Collett, M. S., Heinz, F. X., Schlesinger, R. W. & Strauss, J. H. (1995). Flaviviridae. In Virus Taxonomy. Sixth Report of the International Committee on Taxonomy of Viruses, pp. 415-427. Edited by F. A. Murphy, C. M. Fauquet, D. H. L. Bishop, S. A. Ghabrial, A. W. Jarvis, G. P. Martelli, M. A. Mayo & M. D. Summers. Vienna & New York: Springer-Verlag.

Windisch, J. M., Schneider, R., Stark, R., Weiland, E., Meyers, G. & Thiel, H.-J. (1996). RNase of classical swine fever virus: biochemical characterization and inhibition by virus-neutralizing monoclonal antibodies. Journal of Virology 70, 352-358.[Abstract]

WuDunn, D. & Spear, P. (1989). Initial interaction of herpes simplex virus with cells is binding to heparin sulfate. Journal of Virology 63, 52-58.[Abstract/Free Full Text]

Xue, W. & Minocha, H. C. (1993). Identification of the cell surface receptor for bovine viral diarrhoea virus by using anti-idiotypic antibodies. Journal of General Virology 74, 73-79.[Abstract/Free Full Text]

Zhang, G., Aldridge, S., Clarke, M. C. & McCauley, J. W. (1996). Cell death induced by cytopathic bovine viral diarrhoea virus is mediated by apoptosis. Journal of General Virology 77, 1677-1681.[Abstract/Free Full Text]

Zhu, Z., Gershon, M. D., Ambron, R., Gabel, C. & Gershon, A. E. (1995). Infection of cells by varicella zoster virus: inhibition of viral entry by mannose 6-phosphate and heparin. Proceedings of the National Academy of Sciences, USA 92, 3546-3550.[Abstract/Free Full Text]

Received 17 May 1999; accepted 5 December 1999.


This article has been cited by other articles:


Home page
J. Gen. Virol.Home page
S. Ronecker, G. Zimmer, G. Herrler, I. Greiser-Wilke, and B. Grummer
Formation of bovine viral diarrhea virus E1-E2 heterodimers is essential for virus entry and depends on charged residues in the transmembrane domains
J. Gen. Virol., September 1, 2008; 89(9): 2114 - 2121.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
B. A. Tews and G. Meyers
The Pestivirus Glycoprotein Erns Is Anchored in Plane in the Membrane via an Amphipathic Helix
J. Biol. Chem., November 9, 2007; 282(45): 32730 - 32741.
[Abstract] [Full Text] [PDF]


Home page
J. Gen. Virol.Home page
C. Chapel, C. Garcia, B. Bartosch, P. Roingeard, N. Zitzmann, F.-L. Cosset, J. Dubuisson, R. A. Dwek, C. Trepo, F. Zoulim, et al.
Reduction of the infectivity of hepatitis C virus pseudoparticles by incorporation of misfolded glycoproteins induced by glucosidase inhibitors
J. Gen. Virol., April 1, 2007; 88(4): 1133 - 1143.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
T. Krey, E. Moussay, H.-J. Thiel, and T. Rumenapf
Role of the Low-Density Lipoprotein Receptor in Entry of Bovine Viral Diarrhea Virus
J. Virol., November 1, 2006; 80(21): 10862 - 10867.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
T. Krey, A. Himmelreich, M. Heimann, C. Menge, H.-J. Thiel, K. Maurer, and T. Rumenapf
Function of Bovine CD46 as a Cellular Receptor for Bovine Viral Diarrhea Virus Is Determined by Complement Control Protein 1.
J. Virol., April 1, 2006; 80(8): 3912 - 3922.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
L. H. V. G. Gil, I. H. Ansari, V. Vassilev, D. Liang, V. C. H. Lai, W. Zhong, Z. Hong, E. J. Dubovi, and R. O. Donis
The Amino-Terminal Domain of Bovine Viral Diarrhea Virus Npro Protein Is Necessary for Alpha/Beta Interferon Antagonism
J. Virol., January 15, 2006; 80(2): 900 - 911.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
C. Fetzer, B. A. Tews, and G. Meyers
The Carboxy-Terminal Sequence of the Pestivirus Glycoprotein Erns Represents an Unusual Type of Membrane Anchor
J. Virol., September 15, 2005; 79(18): 11901 - 11913.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
S. Lecot, S. Belouzard, J. Dubuisson, and Y. Rouille
Bovine Viral Diarrhea Virus Entry Is Dependent on Clathrin-Mediated Endocytosis
J. Virol., August 15, 2005; 79(16): 10826 - 10829.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
T. Krey, H.-J. Thiel, and T. Rumenapf
Acid-Resistant Bovine Pestivirus Requires Activation for pH-Triggered Fusion during Entry
J. Virol., April 1, 2005; 79(7): 4191 - 4200.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
K. Maurer, T. Krey, V. Moennig, H.-J. Thiel, and T. Rumenapf
CD46 Is a Cellular Receptor for Bovine Viral Diarrhea Virus
J. Virol., February 15, 2004; 78(4): 1792 - 1799.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
M. Iqbal, E. Poole, S. Goodbourn, and J. W. McCauley
Role for Bovine Viral Diarrhea Virus Erns Glycoprotein in the Control of Activation of Beta Interferon by Double-Stranded RNA
J. Virol., January 1, 2004; 78(1): 136 - 145.
[Abstract] [Full Text] [PDF]


Home page
GlycobiologyHome page
O. Berteau and B. Mulloy
Sulfated fucans, fresh perspectives: structures, functions, and biological properties of sulfated fucans and an overview of enzymes active toward this class of polysaccharide
Glycobiology, June 1, 2003; 13(6): 29R - 40R.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
J. P. M. Langedijk, P. A. van Veelen, W. M. M. Schaaper, A. H. de Ru, R. H. Meloen, and M. M. Hulst
A Structural Model of Pestivirus Erns Based on Disulfide Bond Connectivity and Homology Modeling Reveals an Extremely Rare Vicinal Disulfide
J. Virol., September 11, 2002; 76(20): 10383 - 10392.
[Abstract] [Full Text] [PDF]


Home page
J. Gen. Virol.Home page
M. Iqbal and J. W. McCauley
Identification of the glycosaminoglycan-binding site on the glycoprotein Erns of bovine viral diarrhoea virus by site-directed mutagenesis
J. Gen. Virol., September 1, 2002; 83(9): 2153 - 2159.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
J. P. M. Langedijk
Translocation Activity of C-terminal Domain of Pestivirus Erns and Ribotoxin L3 Loop
J. Biol. Chem., February 8, 2002; 277(7): 5308 - 5314.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
M. M. Hulst, H. G. P. van Gennip, and R. J. M. Moormann
Passage of Classical Swine Fever Virus in Cultured Swine Kidney Cells Selects Virus Variants That Bind to Heparan Sulfate due to a Single Amino Acid Change in Envelope Protein Erns
J. Virol., October 15, 2000; 74(20): 9553 - 9561.
[Abstract] [Full Text]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via CrossRef
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Iqbal, M.
Right arrow Articles by McCauley, J. W.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Iqbal, M.
Right arrow Articles by McCauley, J. W.
Agricola
Right arrow Articles by Iqbal, M.
Right arrow Articles by McCauley, J. W.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
INT J SYST EVOL MICROBIOL MICROBIOLOGY J GEN VIROL
J MED MICROBIOL ALL SGM JOURNALS