|
|
||||||||
Plant |
Faculty of Agriculture, Iwate University, Morioka 020-8550, Japan1
Department of Citriculture, National Institute of Fruit Tree Science, Kuchinotsu 859-2501, Japan2
Apple Research Center, National Institute of Fruit Tree Science, Morioka 020-0123, Japan3
Shikoku National Agricultural Experiment Station, Zentsuji 765-8508, Japan4
Author for correspondence: Nobu Yoshikawa. Fax +81 19 621 6150. e-mail yoshikawa{at}iwate-u.ac.jp
| Abstract |
|---|
|
|
|---|
| Introduction |
|---|
|
|
|---|
| Methods |
|---|
|
|
|---|
Virus.
Purification.
Infected C. quinoa leaf tissue (100 g) was homogenized in 375 ml 0·1 M TrisHCl (pH 7·8) containing 0·1 M NaCl, 5 mM MgCl2 and 1% mercaptoethanol. The homogenate was squeezed through two layers of cheesecloth and centrifuged for 10 min at 9000 r.p.m. The supernatant was clarified with bentonite (De Sequeira & Lister, 1969
) and precipitated with 8% (w/v) polyethylene glycol 6000. The pellet was suspended in 30 ml 0·1 M TrisHCl (pH 7·8) and further clarified by adding 15 ml chloroform. After centrifugation for 2 h at 28000 r.p.m., the pellet was resuspended in 2 ml 0·1 M TrisHCl (pH 7·8), layered onto a 1040% sucrose density-gradient and centrifuged for 2·5 or 5 h at 23000 r.p.m. in a Hitachi RPS27.2 rotor. The gradient was fractionated by upward displacement using an ISCO fractionator. Fractions containing virus were diluted with 0·1 M TrisHCl (pH 7·8), centrifuged and suspended in a small amount of 0·1 M TrisHCl (pH 7·8). Purified virus was layered onto a 2050% (w/w) CsCl density-gradient and centrifuged in a Beckman SW41Ti rotor for 20 h at 36000 r.p.m.
Electron microscopy.
Purified virus was negatively stained with 2% uranyl acetate and examined in a Hitachi H-800 electron microscope.
Serology.
An antiserum was prepared in a rabbit by injection of purified virus (ca. 1 mg) emulsified with an equal volume of Freunds complete adjuvant. Three injections were given subcutaneously at intervals of 2 weeks. The titre of the antiserum was 1/2048 in a ring test. Antisera against Cherry rasp leaf virus (CRLV) and Artichoke vein banding virus (AVBV) were kindly supplied by DAnn Rochon (Canada) and D. Gallitelli (Italy), respectively.
Analysis of virions.
Virus coat protein was analysed by electrophoresis in SDS12·5% or 15% polyacrylamide gels using the Laemmli (1970)
buffer system. For immunoblot analysis, viral proteins separated in a gel were electrophoretically transferred to PVDF membrane (Bio-Rad) at a current of 10 mA/cm2 and detected using antisera against ALSV, AVBV and CRLV as described previously (Yoshikawa et al., 1992
).
Nucleic acids were extracted from purified virus by treatment with proteinase K followed by SDSphenol extraction (Nakamura et al., 1996
) and electrophoresed in a 1% agarose gel containing formaldehyde (Sambrook et al., 1989
). The nucleic acids were treated with RNase A in the presence of 2x SSC (SSC: 0·15 M NaCl, 0·015 M sodium citrate, pH 7·0) or 0·1x SSC, or with DNase I in 0·05 M TrisHCl, pH 7·5, 3 mM MgCl2, and then electrophoresed as above.
N-terminal amino acid sequence analysis of viral coat proteins.
Viral coat proteins were electrophoresed in SDS10% or 12·5% polyacrylamide gels, transferred onto PVDF membrane as described above and stained with 0·1% Ponceau S. The stained bands were excised and analysed directly with an automated Edman degradation sequencer (PPSQ-21, Shimazu).
cDNA synthesis, cloning and nucleotide sequencing.
Viral RNAs from purified virus were used as templates for cDNA synthesis. The first- and second-strand cDNAs were prepared from 1 µg RNA according to Gubler & Hoffman (1983)
, using a cDNA synthesis kit (Takara Shuzo) with an oligo(dT) primer. The double-stranded cDNAs were ligated to the EcoRV site of pBluescript II KS and used to transform competent Escherichia coli DH5
cells. Clones containing cDNA inserts were single- or double-digested with several restriction enzymes. Finally, we selected five clones containing ca. 3 to 3·5 kbp inserts corresponding to the 3'-half of RNA1 and four clones containing ca. 3·3 kbp inserts, equivalent to full-length RNA2. By Northern hybridization, these clones were ascertained to hybridize with RNA1 or RNA2. Three cDNA clones (3·03·5 kbp) of the remaining 5'-region of RNA1 were obtained using a synthetic primer (5' CACAAGGCTAGGACCAATGT 3'), complementary to nt positions 35293548 of RNA1. Deletion mutants were prepared from these clones using a Takara deletion kit for kilo-sequence. The cDNAs were sequenced with a Shimazu DNA sequencer (DSQ-1000L) using the dideoxynucleotide chain termination method (Sanger et al., 1977
). All cDNA clones were sequenced in both directions.
The 5'-extreme ends of both RNA1 and RNA2 were synthesized using a 5' Full RACE Core Kit (Takara Shuzo), ligated to pT7 blue T-vector (Novagen), used to transform E. coli, and sequenced as described above. Sequence data were collected, assembled and analysed with GENETYX (Software Development Co.) and DNASIS (Hitachi Software Engineering Co.).
Sequence comparison.
The genome sequence and ORF organization of ALSV RNA1 and RNA2 were compared to those of como-, nepo- and fabaviruses and SDV. Multiple alignments of amino acid sequence were obtained with CLUSTAL W (Thompson et al., 1994
). Phylogenetic trees were constructed by the neighbour-joining method (Saitou & Nei, 1987
), and the statistical significance of branch order was estimated by performing 1000 replications of bootstrap resampling of the original alignment with CLUSTAL W.
| Results |
|---|
|
|
|---|
Properties of purified particles
When a partially purified preparation of virus was subjected to sucrose density-gradient centrifugation, a single peak was formed in samples from infected tissues, but not from healthy controls. However, after CsCl equilibrium density-gradient centrifugation, two closely adjacent peaks (M and B) with densities of 1·41 and 1·43 g/cm3, respectively, were detected with virus preparations collected from a sucrose gradient (data not shown). These results suggest that ALSV is composed of two components which could not be separated by sucrose gradient centrifugation. Observation of purified preparations by electron microscopy revealed isometric particles (ca. 25 nm in diameter) with a hexagonal outline (not shown).
Coat protein and nucleic acids
In SDSPAGE, proteins from purified virus migrated as three species (Vp25, Vp24 and Vp20) with molecular masses of 25, 24 and 20 kDa, respectively (Fig. 1a
) These three bands were consistently detected in equal amounts in purified preparations from infected tissues, but never in samples from healthy ones. Immunoblot analysis of purified virus and extracts from infected C. quinoa tissues showed that an antiserum against virus particles reacted strongly with Vp25 and weakly with Vp24 and Vp20 (Fig. 1b
). We found that the transfer of Vp24 and Vp20 from SDSpolyacrylamide gel to PVDF membrane was more difficult than that of Vp25. This is the reason why the reaction of Vp24 and Vp20 with ALSV antiserum was weaker compared with that of Vp25.
|
Nucleotide sequences and coding regions
We determined the complete nucleotide sequences of ALSV RNA1 and RNA2. RNA1 is 6815 nt long excluding the 3'-terminal poly(A) tail. Analysis showed that two potential, partially overlapping ORFs (ORF1 and ORF2) were present in the positive-sense strand (Fig. 2
). ORF1 begins at AUG (nt positions 158160) and terminates at UGA (nt 806808) to yield a polypeptide with an Mr of 23421·41 (216 aa; 23K). ORF2 starts at AUG (nt 388390) and stops at TAA (nt 66256627) encoding a large polypeptide with an Mr of 234714·16 (2079 aa; 235K) (Fig. 2
). The 235K polyprotein encoded by ORF2 contains consensus motifs IVIII of the RNA-dependent RNA polymerase (POL) (aa 15671845) of positive-strand RNA viruses (Koonin & Dolja, 1993
) and motifs AC of the NTP-binding helicase (HEL) (aa 689802) of superfamily 3 of positive-strand RNA viruses (Gorbalenya et al., 1990
; Koonin & Dolja, 1993
) (Fig. 2
). The 235K protein also contains the catalytic triad of H, E/D and C (aa 1189, 1227 and 1322) conserved in cysteine proteases (C-PRO) (Dessens & Lomonossoff, 1991
; Gorbalenya et al., 1989
; Margis & Pinck, 1992
) and amino acids F, W and L (aa 375, 401 and 435) conserved in the protease cofactor (PRO-Co) found in como-and nepoviruses (Ritzenthaler et al., 1991
) (Fig. 2
).
|
By analogy with como- and nepoviruses, capsid proteins are likely to be encoded in the 3'-terminal region of RNA2. We determined the 15 amino acid residues at the N termini of the three proteins (Vp25, Vp24 and Vp20) separated by SDSPAGE of purified virus. The resulting N-terminal sequences (Vp25, GPDFTKIIWPTVVER; Vp24, GSDPFSFLLNYSHCG; Vp20, GACLSIPNFPVHITG) were identical to the amino acid sequences of the 108K protein at aa 377391, 770784 and 594608, respectively. The cleavage sites of the 108K polyprotein are probably Q/G between MP and Vp25, and Vp25 and Vp20, and E/G between Vp20 and Vp24 (Fig. 2
). The calculated Mrs of Vp25, Vp20 and Vp24 are 24079·13 (217 aa), 19933·64 (176 aa) and 21555·13 (192 aa), respectively, in good agreement with those determined by SDSPAGE.
Noncoding regions
The 3'-noncoding regions of RNA1 and RNA2 of ALSV are 191 and 190 nt long, respectively, and display ca. 80% sequence identity. This identity is similar to that of nepoviruses, in which the 3'-noncoding regions of RNA1 and RNA2 of Tomato ringspot virus, Tomato black ring virus, Grapevine chrome mosaic virus and Blueberry leaf mottle virus are nearly identical and that of Grapevine fanleaf virus has an average similarity of 80% (Bacher et al., 1994
; Brooks & Bruening, 1995
; Le Gall et al., 1989
; Ritzenthaler et al., 1991
; Rott et al., 1991b
).
Extensive sequence identity between RNA1 and RNA2 5'-noncoding regions has previously been also reported for nepoviruses (Greif et al., 1988
; Ritzenthaler et al., 1991
; Rott et al., 1991b
). If the ORF1 of ALSV RNA1 is translatable, the 5'-noncoding region of RNA1 is 157 nt; that of RNA2 is 311 nt, assuming that the second in-phase AUG is the initiation codon. The similarity between these two sequences (157 nt) is 61·4%.
The sequence Vpg-UAUUAAAAU is found at the 5'-end of RNA B and RNA M of all comoviruses sequenced (Chen & Bruening, 1992a
, b
), whereas the sequence UG/UGAAAAU/AU/AU/A, adjacent to the Vpg, is found in RNA1 and RNA2 of nepoviruses (Fuchs et al., 1989
). We failed to find these consensus sequences at the 5' terminus of either RNA1 or RNA2 of ALSV.
Phylogenetic analysis
The genome organization of ALSV resembles that of viruses in the Comoviridae (Fig. 2
). We analysed phylogenetic relationships between ALSV and the species in the Comoviridae for amino acid sequences in the RNA polymerase domain. As shown in Fig. 3
, the phylogenetic trees place ALSV into a cluster with SDV, differing from the nepovirus, comovirus and fabavirus lineages.
|
| Discussion |
|---|
|
|
|---|
Como- and fabaviruses and SDV have two coat polypeptides (mol. mass 4043 kDa and 2227 kDa), and nepoviruses have a single coat polypeptide species (mol. mass 5556 kDa) (Iwanami et al., 1999
; Murphy et al., 1995
). In contrast, ALSV capsids are constructed from three polypeptides (Vp25, Vp24 and Vp20). Among plant viruses, Parsnip yellow fleck virus and Rice tungro spherical virus in the Sequiviridae contain three capsid proteins, but their genomes consist of a single molecule of ssRNA (Murphy et al., 1995
). Two tentative species of the genus Nepovirus, CRLV and AVBV, have isometric particles 2830 nm in diameter, which sediment as three components and contain two ssRNA species and three capsid proteins of molecular masses 2627 kDa, 2423 kDa and 2122 kDa (Gallitelli et al., 1984
; Jones et al., 1985
; Stace-Smith & Hansen, 1976
). Thus, the particle properties of ALSV appear to be similar to those of CRLV and AVBV. CRLV was also reported as having been isolated from apple trees (Nemeth, 1986
). CRLV is transmitted by the nematode Xiphinema americanum, but transmission of ALSV and AVBV by vectors is unknown. We tested the serological relationships between ALSV and these two viruses. However, antisera against CRLV or AVBV did not react with ALSV in either agar gel diffusion tests or immunoblot analysis. Nucleotide sequence analysis of the genomes of CRLV and AVBV will define the relationship among these three viruses.
The presence of ORF1 in ALSV RNA1 is a unique feature because of its absence from the genomes of any other viruses in the Comoviridae sequenced so far. We are investigating whether the 23K protein encoded by ORF1 is expressed in vivo. The 235K protein encoded by ORF2 of ALSV RNA1 has consensus motifs of PRO-Co, HEL, C-PRO and POL from the N terminus (Fig. 2
), in good agreement with the gene arrangements of como-, nepo- and fabaviruses and SDV. Cysteine protease may be essential for maturation of both the 235K and 108K polyproteins. Cleavage sites of viral proteases are usually characterized by a preference for certain amino acids at one or more of the positions -2 to -5 (Wellink & van Kammen, 1988
). The amino acids surrounding the experimentally determined cleavage sites (Q/G and E/G) of the 108K polyprotein are shown in Fig. 4
. A G at the -2 and +1 positions is conserved in three cleavage sites. We searched the potential cleavage sites of the 235K polyprotein based on the known dipeptides (Q/G, Q/S, Q/M, Q/A, E/G, E/S, R/A, R/G and K/A) for the cleavage sites of picorna-like viruses (Hellen et al., 1989
; Ritzenthaler et al., 1991
; Wellink & van Kammen, 1988
). The Vpg is thought to be located between the HEL and C-PRO domains by analogy with como- and nepoviruses, although we could not find the consensus sequence [E/D-X(13)-Y-X(3)-N-X(45)-R] of the Vpg of nepo-and comoviruses reported by Mayo & Fritsch (1994)
. The likely cleavage sites of the 235K polyprotein and the amino acids surrounding them are shown in Fig. 4
. Based on these cleavage sites, the molecular masses of PRO-Co, HEL, Vpg, C-PRO and POL are calculated to be 59, 65, 6, 25 and 80 kDa, respectively.
Recently, it was proposed that SDV, a tentative member of the genus Nepovirus, should be placed in a new genus within the family Comoviridae (Iwanami et al., 1999
). Phylogenetic analysis of the POL domain in this study shows that ALSV is related to SDV, but distinct from members of the genera Comovirus, Nepovirus and Fabavirus (Fig. 3
). ALSV is, however, different from SDV with regard to the number of capsid proteins and the presence of ORF1 in ALSV RNA1. In conclusion, ALSV is a new virus which should be classified into a new genus within the family Comoviridae, probably together with CRLV and AVBV.
| Acknowledgments |
|---|
This work was supported in part by a Grant-in-Aid for Green Frontier Program from the Ministry of Agriculture, Forestry and Fisheries.
| Footnotes |
|---|
| References |
|---|
|
|
|---|
Brooks, M. & Bruening, G. (1995). A subgenomic RNA associated with cherry leafroll virus infections.Virology211, 33-41.[Medline]
Chen, X. & Bruening, G. (1992a). Nucleotide sequence and genetic map of cowpea severe mosaic virus RNA2 and comparisons with RNA2 of other comoviruses.Virology187, 682-692.[Medline]
Chen, X. & Bruening, G. (1992b). Cloned DNA copies of cowpea severe mosaic genomic RNAs: infectious transcripts and complete nucleotide sequence of RNA1.Virology191, 607-618.[Medline]
De Sequeira, O. A. & Lister, R. M. (1969). Purification and relationships of some filamentous viruses from apple.Phytopathology59, 1740-1749.[Medline]
Dessens, J. T. & Lomonossoff, G. P. (1991). Mutational analysis of the putative catalytic triad of the cowpea mosaic virus 24K protease.Virology184, 738-746.[Medline]
Fuchs, M., Pinck, M., Serghini, M. A., Ravelonandro, M., Walter, B. & Pinck, L. (1989). The nucleotide sequence of satellite RNA in grapevine fanleaf virus, strain F13.Journal of General Virology70, 955-962.
Gallitelli, D., Martelli, G. P. & Rana, G. L. (1984). Artichoke vein banding virus. CMI/AAB Descriptions of Plant Viruses, no. 285.
Gorbalenya, A. E., Donchenko, A. P., Blinov, V. M. & Koonin, E. V. (1989). Cysteine proteases of positive strand RNA viruses and chymotrypsin-like serine proteases.FEBS Letters243, 103-114.[Medline]
Gorbalenya, A. E., Koonin, E. V. & Wolf, Y. I. (1990). A new superfamily of putative NTP-binding domains encoded by genomes of small DNA and RNA viruses.FEBS Letters262, 145-148.[Medline]
Greif, C., Hemmer, O. & Fritsch, C. (1988). Nucleotide sequence of tomato black ring virus RNA-1.Journal of General Virology69, 1517-1529.
Gubler, U. & Hoffman, B. J. (1983). A simple and very efficient method for generating cDNA libraries.Gene25, 263-269.[Medline]
Hellen, C. U. T., Krausslich, H. G. & Wimmer, E. (1989). Proteolytic processing of polyproteins in the replication of RNA viruses.Biochemistry28, 9881-9890.[Medline]
Ito, T. & Yoshida, K. (1997). The etiology of apple russet ring disease. Annals of the Phytopathological Society of Japan63, 487 (Abstract).
Ito, T., Koganezawa, H. & Yoshida, K. (1992). Back-transmission of apple russet ring A virus, an isometric virus isolated from an apple tree with fruit russet ring and leaf pucker symptoms, to apple seedlings. Annals of the Phytopathological Society of Japan 58, 617 (Abstract).
Iwanami, T., Kondo, Y. & Karasev, A. (1999). Nucleotide sequence and taxonomy of satsuma dwarf virus.Journal of General Virology80, 793-797.[Abstract]
Jones, A. T., Mayo, M. A. & Henderson, S. J. (1985). Biological and biochemical properties of an isolate of cherry rasp leaf virus from red raspberry.Annals of Applied Biology106, 101-110.
Koganezawa, H., Yanase, H., Ochiai, M. & Sakuma, T. (1985). An isometric viruslike particle isolated from russet ring-diseased apple. Annals of the Phytopathological Society of Japan 51, 363 (Abstract).
Koonin, E. V. & Dolja, V. V. (1993). Evolution and taxonomy of positive-strand RNA viruses: implications of comparative analysis of amino acid sequences.Critical Reviews in Biochemistry and Molecular Biology28, 375-430.[Medline]
Koonin, E. V., Mushegian, A. R., Ryabov, E. V. & Dolja, V. V. (1991). Diverse groups of plant RNA and DNA viruses share related movement proteins that may possess chaperone-like activity.Journal of General Virology72, 2895-2903.
Laemmli, U. K. (1970). Cleavage of structural proteins during the assembly of the head of bacteriophage T4.Nature227, 680-685.[Medline]
Le Gall, O., Candresse, T., Brault, V. & Dunez, J. (1989). Nucleotide sequence of Hungarian grapevine chrome mosaic nepovirus RNA1.Nucleic Acids Research17, 7795-7807.
Lütcke, H. A., Chow, K. C., Mickel, F. S., Moss, K. A., Kern, H. F. & Scheele, G. A. (1987). Selection of AUG initiation codons differs in plants and animals.EMBO Journal6, 43-48.[Medline]
Margis, R. & Pinck, L. (1992). Effects of site-directed mutagenesis on the presumed catalytic triad and substrate-binding pocket of grapevine fanleaf nepovirus 24-kDa proteinase.Virology190, 884-888.[Medline]
Mayo, M. A. & Fritsch, C. (1994). A possible consensus sequence for VPg of viruses in the family Comoviridae.FEBS Letters354, 129-130.[Medline]
Murphy, F. A., Fauquet, C. M., Bishop, D. H. L., Ghabrial, S. A., Jarvis, A. W., Martelli, G. P., Mayo, M. A. & Summers, M. D. (editors) (1995). Virus Taxonomy. Sixth Report of the International Committee on Taxonomy of Viruses. Vienna & New York: Springer-Verlag.
Mushegian, A. R. (1994). The putative movement domain encoded by nepovirus RNA-2 is conserved in all sequenced nepoviruses.Archives of Virology135, 437-441.[Medline]
Nakamura, S., Honkura, R., Iwai, T., Ugaki, M. & Ohashi, T. (1996). The complete nucleotide sequence of bean yellow mosaic virus genomic RNA.Annals of the Phytopathological Society of Japan62, 472-477.
Németh, M. (1986). Virus, Mycoplasma and Rickettsia Diseases of Fruit Trees. Budapest: Académia Kiadó.
Ritzenthaler, C., Viry, M., Pinck, M., Margis, R., Fuchs, M. & Pinck, L. (1991). Complete nucleotide sequence and genetic organization of grapevine fanleaf nepovirus RNA1.Journal of General Virology72, 2357-2365.
Rott, M. E., Tremaine, J. H. & Rochon, D. M. (1991a). Nucleotide sequence of tomato ringspot virus RNA-2.Journal of General Virology72, 1505-1514.
Rott, M. E., Tremaine, J. H. & Rochon, D. M. (1991b). Comparison of the 5' and 3' termini of tomato ringspot virus RNA1 and RNA2: evidence for RNA recombination.Virology185, 468-472.[Medline]
Saitou, N. & Nei, M. (1987). The neighbor-joining method: a new method for reconstructing phylogenetic trees.Molecular Biology and Evolution4, 406-425.[Abstract]
Sambrook, J., Fritsch, E. F. & Maniatis, T. (1989). Molecular Cloning: A Laboratory Manual, 2nd edn. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory.
Sanger, F., Nicklen, S. & Coulson, A. R. (1977). DNA sequencing with chain terminating inhibitors.Proceedings of the National Academy of Sciences, USA74, 5463-5467.
Serghini, M. A., Fuchs, M., Pinck, M., Reinbolt, J., Walter, B. & Pinck, L. (1990). RNA2 of grapevine fanleaf virus: sequence analysis and coat protein cistron location.Journal of General Virology71, 1433-1441.
Stace-Smith, R. & Hansen, A. J. (1976). Cherry rasp leaf virus. CMI/AAB Descriptions of Plant Viruses, no. 159.
Thompson, J. D., Higgins, D. G. & Gibson, T. J. (1994). CLUSTAL W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice.Nucleic Acids Research22, 4673-4680.
Wellink, J. & van Kammen, A. (1988). Proteases involved in the processing of viral polyproteins.Archives of Virology98, 1-26.[Medline]
Yoshikawa, N., Sasaki, E., Kato, M. & Takahashi, T. (1992). The nucleotide sequence of apple stem grooving capillovirus genome.Virology191, 98-105.[Medline]
Received 16 August 1999;
accepted 20 October 1999.
This article has been cited by other articles:
![]() |
J. R. Thompson, G. Leone, J. L. Lindner, W. Jelkmann, and C. D. Schoen Characterization and complete nucleotide sequence of Strawberry mottle virus: a tentative member of a new family of bipartite plant picorna-like viruses J. Gen. Virol., January 1, 2002; 83(1): 229 - 239. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| INT J SYST EVOL MICROBIOL | MICROBIOLOGY | J GEN VIROL |
| J MED MICROBIOL | ALL SGM JOURNALS | |