J Gen Virol Email Content Delivery
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via CrossRef
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Sáenz, P.
Right arrow Articles by García, J. A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Sáenz, P.
Right arrow Articles by García, J. A.
Agricola
Right arrow Articles by Sáenz, P.
Right arrow Articles by García, J. A.
Journal of General Virology (2000), 81, 557-566.
© 2000 Society for General Microbiology


Plant

Identification of a pathogenicity determinant of Plum pox virus in the sequence encoding the C-terminal region of protein P3+6K1

Pilar Sáenz1, Maria Teresa Cervera1, Silvie Dallot2, Laurence Quiot2, Jean-Bernard Quiot2, José Luis Riechmannb,1 and Juan Antonio García1

Centro Nacional de Biotecnología (CSIC), Campus de la Universidad Autónoma de Madrid, 28049 Madrid, Spain1
Ecole Nationale Superieure Agronomique de Montpellier (ENSAM-INRA), 2 Place Viala, 34060 Montpellier Cedex 1, France2

Author for correspondence: Juan Antonio García. Fax +34 91 5854506. e-mail jagarcia{at}cnb.uam.es


   Abstract
TOP
Abstract
Introduction
Methods
Results
Discussion
References
 
A full-length genomic cDNA clone of a plum pox potyvirus (PPV) isolate belonging to the M strain (PPV-PS) has been cloned downstream from a bacteriophage T7 polymerase promoter and sequenced. Transcripts from the resulting plasmid, pGPPVPS, were infectious and, in herbaceous hosts, produced symptoms that differed from those of virus progeny of pGPPV, a full-length genomic cDNA clone of the D strain PPV-R. Viable PPV-R/-PS chimeric viruses were constructed by recombination of the cDNA clones in vitro. Analysis of plants infected with the different chimeras indicated that sequences encoding the most variable regions of the potyvirus genome, the P1 and capsid protein coding sequences, were not responsible for symptom differences between the two PPV isolates in herbaceous hosts. On the contrary, complex symptomatology determinants seem to be located in the central region of the PPV genome. The results indicate that a genomic fragment that encodes 173 aa from the C-terminal part of the P3+6K1 coding region is enough to confer, on a PPV-R background, a PS phenotype in Nicotiana clevelandii. This pathogenicity determinant also participates in symptom induction in Pisum sativum, although the region defining the PS phenotype in this host is probably restricted to 74 aa.


   Introduction
TOP
Abstract
Introduction
Methods
Results
Discussion
References
 
Plum pox virus (PPV) is a member of the large and economically important genus Potyvirus from the family Potyviridae (Simón et al., 1997Down ). The potyvirus genome consists of a single-stranded messenger-polarity RNA molecule of about 10 kb, with a VPg protein at its 5' end and a poly(A) tail at its 3' end. It is translated into a large polyprotein that is processed proteolytically by three virus-encoded proteases (Riechmann et al., 1992Down ; Revers et al., 1999Down ).

In nature, PPV causes a very damaging disease of trees of the genus Prunus. Many PPV isolates have been classified in several groups according to serological and biological properties, particularly the symptoms caused in experimental herbaceous hosts (Kerlan & Dunez, 1979Down ; Sutic et al., 1971Down ; Van Oosten, 1971Down ). The availability of genome sequence data has enabled a more reliable classification to be established. Apart from the atypical El Amar isolate (Wetzel et al., 1991Down ) and the recently characterized isolates that infect sweet and sour cherries (Crescenzi et al., 1997Down ; Nemchinov & Hadidi, 1996Down ), most PPV isolates can be classified into two major strains, M (from the isolate Marcus) and D (from the isolate Dideron) (Candresse et al., 1998Down ).

Full-length cDNA clones, from which infectious transcripts can be produced either in vitro or in vivo allowing easy manipulation of the viral genome, are very useful tools for the identification of strain- and isolate-specific pathogenicity determinants. Whereas biologically active full-length cDNA clones from the D isolates PPV-R (Riechmann et al., 1990Down ) and PPV-NAT (Maiss et al., 1992Down ) have been reported, full-length cDNA clones of PPV isolates belonging to the M strain have not been described. In this paper, we report the construction of a full-length cDNA clone of an M isolate of PPV, PPV-PS, and demonstrate the viability of M/D recombinant viruses. We have taken advantage of the different symptomatology caused in several herbaceous hosts by the virus progeny of the PPV clones to gain insight into the elements of the potyvirus genome that influence symptom development.


   Methods
TOP
Abstract
Introduction
Methods
Results
Discussion
References
 
{blacksquare} Virus and bacterial strains.
The PPV-PS isolate was obtained from M. Rankovic (Fruit Research Institute, Cacak, Yugoslavia) and maintained in Nicotiana clevelandii plants. Virus purification and RNA extraction were performed as described previously (Laín et al., 1988Down ). Escherichia coli DH5{alpha} and JM109 were used for cloning of the plasmids and CJ236 was used in site-directed mutagenesis experiments.

{blacksquare} Synthesis and cloning of cDNA from PPV-PS RNA.
The construction of clones of the pH and pBS series, which contain partial cDNA copies of PPV-PS RNA inserted in the HindIII site (pH) or between the BamHI and SacI sites (pBS) of pUC18, has been reported previously (Cervera et al., 1993Down ). Additional clones with fragments covering the entire PPV-PS genome except its 5' end were obtained in a similar fashion. In order to clone the first 547 nt of the PPV-PS genome, a cDNA fragment was amplified by RT–PCR using the oligodeoxynucleotides 5' AAAATATAAAAACTCAACAC 3' and 5' CCAGTGGTGTACCG 3' as primers. This fragment was digested with HindIII or AccI and cloned into the pGEM3 vector (Promega) digested with HindIII and SmaI or AccI and SmaI, generating the plasmids pG5'PSH and pG5'PSA, respectively. Several independent clones were sequenced to ensure that no mutation had been introduced during the RT–PCR. Non-viral nucleotides between the transcription initiation site of the pGEM3 T7 promoter and the first nucleotide of PPV were removed by site-directed mutagenesis (Kunkel et al., 1987Down ) by using the oligodeoxynucleotide 5' TTTATATTTTCTATAGTGAG 3' (Riechmann et al., 1990Down ), to give pGG5'PSH.

The complete nucleotide sequence of the PPV-PS genome was determined by sequencing double-stranded cDNA contained in the different plasmids and single-stranded DNA subcloned into M13 recombinant phages with the Sequenase 2.0 kit (Amersham). The first 211 nt of the PPV-PS genome were determined by direct sequencing of viral RNA (Fichot & Girard, 1990Down ).

The complete clone pGPPVPS was prepared by replacing appropriate restriction fragments in pGPPV, the previously described full-length cDNA of PPV-R (Rankovic) (Riechmann et al., 1990Down ), with corresponding fragments from PPV-PS. The PPV-PS/PPV-R chimeras shown in Fig. 1Down were produced by exchange of restriction fragments as indicated in the figure. All fragments generated by PCR were sequenced. Additional details will be supplied by the authors on request.



View larger version (21K):
[in this window]
[in a new window]
 
Fig. 1. Schematic representation of the full-length cDNA pGPPVPS clone and the different R/PS PPV chimeric clones. PPV-R and PPV-PS sequences are shown as open and filled boxes, respectively. Vector sequences are indicated with black lines. Restriction sites used in the cloning are shown on the respective clones. A genetic map of PPV is shown at the top of the figure.

 
{blacksquare} In vitro transcription and inoculation of plants.
The recombinant plasmids were linearized prior to transcription by digestion either with PvuII and PstI or with PvuII alone, followed by phenol–chloroform extraction and ethanol precipitation. Capped full-length transcripts were synthesized from these templates by using the T7 Cap-Scribe kit (Boehringer Mannheim). Yield and integrity of the transcripts were analysed by agarose gel electrophoresis.

Three primary leaves per N. clevelandii plant were dusted with carborundum and inoculated mechanically with 1·5 µl of the transcription reaction mixture diluted 1:1 with 5 mM sodium phosphate buffer (pH 7·2). Crude sap from leaves of infected N. clevelandii plants (2 ml per g tissue) was used to inoculate Pisum sativum plants and N. clevelandii plants (20 µl in three leaves per plant) by hand.

Virus accumulation was assessed by Western blot and by double-antibody sandwich indirect (DASI)-ELISA with the REALISA kit (Durviz). Fragments that included the PS–R borders were amplified by RT–PCR (Titan kit; Boehringer Mannheim) preceded by immunocapture (Wetzel et al., 1992Down ) and sequenced to verify that the chimeric sequences were maintained in virus progeny.


   Results
TOP
Abstract
Introduction
Methods
Results
Discussion
References
 
Virus progeny of infectious transcripts synthesized from a PPV-PS full-length cDNA copy cause mild symptoms in N. clevelandii
cDNA cloning and partial sequencing of the PPV-PS isolate have been reported previously (Cervera et al., 1993Down ). We have now determined the complete genomic sequence of 9786 nt [excluding the 3'-terminal poly(A) sequence] of PPV-PS. PPV-PS has very low nucleotide (1·2%) and amino acid (1·9%) divergence from the other M-type isolate that has been sequenced completely, PPV-SK 68 (Palkovics et al., 1993Down ). Its level of divergence from sequenced D-type isolates (Laín et al., 1989Down ; Maiss et al., 1989Down , 1991Down ; Teycheney et al., 1989Down ) is much higher, ranging from 12·5 to 12·9% in nucleotide sequence and from 4·2 to 4·8% in amino acid sequence. There was little difference in the degree of sequence variation along the genome, except for the sequence encoding the first 270 nt of the capsid protein (CP) gene, where the PPV-PS sequence diverged from the sequence of PPV-SK 68 and the D-type isolates by 1·9 and 28·1–28·9%, respectively, corresponding to levels of amino acid divergence of 2·1% (PPV-PS vs -SK 68) and 31·9–32·4% (PPV-PS vs D-type isolates).

A full-length cDNA copy of the PPV-PS isolate was cloned downstream from a phage T7 RNA polymerase promoter. Capped RNA transcripts, synthesized in vitro from the resulting plasmid pGPPVPS, displayed a level of infectivity in N. clevelandii plants similar to that observed for transcripts of pGPPV, a full-length cDNA clone of the Rankovic isolate of PPV (PPV-R). Infection with the virus progeny of PPV-PS transcripts (PPV-PSc) caused a very mild chlorotic mottle, clearly distinguishable from the more severe symptoms provoked by virus progeny of PPV-R transcripts (PPV-Rc) (Fig. 2DownA). The mild symptoms of PPV-PSc-infected plants resembled those caused by several virus variants isolated from the original PPV-PS isolate, but largely differed from those of other variants, indicating the existence of several sub-isolates with different biological properties (P. Sáenz & J. A. García, unpublished results).



View larger version (100K):
[in this window]
[in a new window]
 
Fig. 2. (A) Symptoms observed in detached leaves of N. clevelandii infected with virus progeny of pGPPV (type R symptoms, at the top) and pGPPVPS (type PS, centre); a healthy leaf is shown at the bottom. The genomic map of PPV is shown below each panel. (B) Detached leaves of N. clevelandii infected with virus progeny of the chimeric clones represented below the panels. PPV-R and -PS sequences are represented in blue and red, respectively.

 
A genome fragment that includes the P3+6K1 cistron and part of the HC and CI cistrons is sufficient to confer R-type symptomatology in N. clevelandii plants
In order to map PPV genomic sequences involved in symptom determination, chimeric recombinants were constructed between the parental full-length cDNA clones, pGPPVPS and pGPPV. The first chimeras focused on the CP and P1 coding regions, the most variable regions among potyviruses (Aleman-Verdaguer et al., 1997Down ). In addition, molecular features of the CP cistron are the current discrimination criteria used to classify PPV isolates (Bousalem et al., 1994Down ). Fig. 3Down shows a schematic representation of the hybrid clones and summarizes the symptomatology produced by them. Virus progeny derived from pR/P 7677 produced R-type symptomatology, although the complete CP cistron of PPV-PS was present. Moreover, virus derived from pR/P 2212 and pR/P 2212–7677, which include P1 and P1 plus CP coding sequences, respectively, from PPV-R in the PPV-PS background, caused typical mild PS-type symptoms (Fig. 2BUp and data not shown). These results indicated that the CP and P1 cistrons are not relevant to the differences in symptomatology between PPV-R and -PS. As expected, virus derived from pP/R 2212–7677, the reciprocal clone of pR/P 2212–7677, caused R-type symptoms (Fig. 2BUp), demonstrating that the symptomatology determinants that we are analysing are confined to the 2212–7677 genomic fragment.



View larger version (30K):
[in this window]
[in a new window]
 
Fig. 3. Schematic representation of different chimeric viruses showing the type of symptoms they produce in N. clevelandii and P. sativum plants. An immunoblot analysis of protein extracts from N. clevelandii plants infected with the different chimeric viruses is shown at the bottom of the figure. Samples (3 mg tissue from each infected plant) were collected at 21 days post-inoculation and used in the assay. The immunoreaction was carried out with an antiserum raised against the coat protein (CP) of PPV-R.

 
While virus derived from pP/R 2212–5535 still caused R-type symptoms, the pP/R 2212–3628 progeny produced PS-type symptoms in N. clevelandii (Fig. 2BUp and data not shown). This result indicates that the 2212–5535 genomic fragment, which includes HC, P3+6K1 and CI sequences, contains the determinants required for inducing an R-type response in N. clevelandii, and that some of these determinants are located between nt 3628 and 5535. They are clearly not enough to specify an R response, since virus progeny of pR/P 2212–3628, which contains the 3628–5535 region from PPV-R, produced PS-type symptoms (Fig. 2BUp). On the other hand, the R/P 2212–3628 symptomatology indicates that the 2212–3628 region contains determinants that are sufficient to specify a PS phenotype, but that are not essential to confer this kind of response, since pP/R 2212–3628-derived virus, which does not contain this PS fragment, caused a PS response (Fig. 3Up).

Virus accumulation in plants infected with the different chimeras was assessed by Western blot (Fig. 3Up) and ELISA (Fig. 4DownA). Although there were small differences in the levels of accumulation of the different chimeric viruses, no correlation was observed between symptom severity and virus accumulation.



View larger version (29K):
[in this window]
[in a new window]
 
Fig. 4. Virus accumulation, estimated by DASI-ELISA, in extracts of N. clevelandii (A, B) and P. sativum (C) plants infected with virus progeny of pGPPV, pGPPVPS and the hybrid viruses described in Fig. 1Up. Constructs that led to PS-type symptoms are indicated by filled bars; those that led to R-type symptoms are indicated by open bars.

 
Exchange of sequences encoding part of theC-terminal region of the P3+6K1 protein converts the R-type to the PS-type phenotype
To map the smallest region of the PPV genome able to elicit PS-type symptoms, five additional chimeras in the 2212–3628 region were constructed (Fig. 5Down). The PS 2904–3628 fragment (pR/P 2904–3628), but not the 2212–2904 fragment (pR/P 2212–2904), conferred PS symptomatology to PPV-R (Fig. 2BUp). However, the R phenotype was maintained in the two chimeric viruses that contained, in the PPV-R background, the PS 2904–3409 (pR/P 2904–3409) and 3411–3628 (pR/P 3411–3628) complementary fragments, where the 2904–3628 region was divided (Fig. 2BUp). Increasing the size of the PS region of pR/P 3411–3628, in such a way that it started at nt 3109 (pR/P 3109–3628), led to the reappearance of PS symptomatology (Fig. 2BUp). No correlation between virus accumulation, estimated by Western blot (Fig. 5Down) and ELISA (Fig. 4BUp), and symptom severity was observed in plants infected with these chimeras. The 3109–3628 region of the PPV genome, which contains all the information required to transform the R-type into the PS-type symptomatology, encodes 173 aa that differ at 11 positions between PPV-R and PPV-PS (Fig. 6Down).



View larger version (30K):
[in this window]
[in a new window]
 
Fig. 5. Schematic representation of different chimeric viruses showing the type of symptoms that they produce in N. clevelandii and P. sativum plants. An immunoblot analysis of protein extracts from N. clevelandii plants infected with the different chimeric viruses is shown at the bottom of the figure. Samples (3 mg tissue from each infected plant) were collected at 21 days post-inoculation and used in the assay. The immunoreaction was carried out with an antiserum raised against the coat protein (CP) of PPV-R.

 


View larger version (34K):
[in this window]
[in a new window]
 
Fig. 6. Amino acid sequence alignment of P3+6K1 proteins from PPV-R and PPV-PS. The arrows labelled A, B and C show the borders between R and PS sequences of pR/P 2904–3628, pR/P 3109–3628 and pR/P 3411–3628, respectively. The nucleotide numbers of the junctions are shown above the amino acid sequence. Shadowing indicates the region able to confer PS-type symptoms on PPV-R in N. clevelandii.

 
The determinants governing the differences between PPV-R and PPV-PS symptomatology are similar but not identical in N. clevelandii and P. sativum
In P. sativum, PPV-R produced local necrotic lesions and systemic chlorotic spots that became necrotic. In contrast, PPV-PS only caused a systemic chlorotic mottling that did not become necrotic. As in the N. clevelandii infection, the sequences between nt 2212 and 7677 carried all the information required to define both the R- and PS-type symptomatologies (Fig. 3Up; symptoms not shown). However, in contrast to the situation in N. clevelandii, in P. sativum, not only the 2212–5535 fragment, but also a 2212–3628 fragment, was able to confer R-type symptomatology in a PS background (Fig. 3Up; symptoms not shown). This indicates that the determinants of R-type symptomatology located between positions 3628 and 5535 are important in one host (N. clevelandii), but not in the other (P. sativum). Moreover, virus derived from pR/P 3411–3628, which showed an R-type phenotype in N. clevelandii, caused PS-type symptoms in P. sativum (Fig. 5Up). Thus, in this host, it was possible to limit the genomic region required for symptom exchange to that encoding a 74 aa sequence of the P3+6K1 C-terminal region, which differs by only 4 aa between PPV-PS and PPV-R (Fig. 6Up). As in N. clevelandii plants, no correlation was observed between virus accumulation and symptom severity in P. sativum plants infected with the different chimeric viruses (Fig. 4CUp).


   Discussion
TOP
Abstract
Introduction
Methods
Results
Discussion
References
 
Full-length cDNAs from which infectious transcripts can be produced in vitro (Riechmann et al., 1990Down ) or in vivo (Maiss et al., 1992Down ) have been described for two PPV isolates, PPV-R and PPV-NAT, respectively. These two isolates belong to the D strain. In this paper, we report the construction of a full-length cDNA from the PPV-PS isolate, which belongs to the second major PPV group, the M strain. Transcripts synthesized in vitro from this clone (pGPPVPS) were infectious and, in several herbaceous hosts, their virus progeny produced clearly distinct symptoms from those produced by virus progeny of transcripts synthesized from the full-length cDNA clone of PPV-R (pGPPV). We investigated the genetic determinants of these symptomatic differences by constructing chimeric R/PS constructs. In spite of the quite large nucleotide divergence between the PPV-PS and PPV-R isolates (12·5%), all chimeric viruses that were constructed were viable, demonstrating that genetic elements of both strains are compatible and that even hybrid proteins can be functional. It is important to mention that, although the results demonstrate that our approach can be useful to study strain-specific genetic determinants, the pathogenicity determinants that we analysed are isolate-specific rather than strain-specific, since different M-type isolates cause very different symptoms in herbaceous hosts.

Our results indicate that a genome fragment from the end of the P3+6K1 coding region is sufficient to confer a PS phenotype on a PPV-R background. The size of this pathogenicity determinant and the kind of symptoms that it induces depend on the host. In N. clevelandii, between 74 and 173 amino acids (including a maximum of 11 differences between PPV-PS and -R) near the C-terminal end of the PPV-PS P3+6K1 protein are necessary to get the mild systemic chlorotic mottle typical of pGPPVPS virus progeny. This same region from pGPPV does not define R-type symptoms in N. clevelandii when cloned in pGPPVPS. Thus, the fact that virus progeny from pR/P 2212–3628 and pR/P 2212–5535 cause PS and R symptoms, respectively, indicates that specific CI sequences are required to elicit the severe symptomatology of the PPV-R isolate in N. clevelandii. It is important to note that, although very unlikely, effects due to differences at the nucleotide level cannot be ruled out.

The differences in symptomatology between PPV-R and -PS in P. sativum appear to be defined by the same pathogenicity determinant. However, in this case, a sequence encoding 74 amino acids of the C-terminal region of P3+6K1 (containing four differences between PPV-PS and -R) is enough to elicit a PS-type response (systemic chlorotic spots without necrotic local lesions). Moreover, in this host, the pathogenicity determinants in the CI cistron are less important, since the 2212–3628 fragment from PPV-R, which does not include CI sequences, is enough to confer the typical phenotype of this isolate (local necrotic lesions and systemic chlorotic spots that become necrotic). It is important to remark that other genomic regions might define differences of pathogenicity between PPV-R and PPV-PS in other herbaceous hosts. In this regard, the necrotic (PPV-R)/chlorotic (PPV-PS) type of the local lesions that PPV causes in Chenopodium foetidum seems to be defined by complex determinants different from that described in this report. Thus, although R/P 2212–7677 (which has the central region of the genome of PPV-PS) caused chlorotic lesions in C. foetidum, the reciprocal clone, P/R 2212–7677, as well as most of the rest of chimeras, caused a confused pattern of chlorotic, necrotic and intermediate lesions (data not shown).

The fact that we did not observe any correlation between symptom severity and virus accumulation seems to indicate that the differences in symptomatology are not the simple result of different replication efficiencies of PPV-R and -PS. Several regions of the potyvirus genome have been shown to be involved in symptom determination; for example, the HC coding sequence of Tobacco vein mottling virus (TVMV) (Atreya et al., 1992Down ), a genomic fragment that encodes the NIa protease and NIb replicase (Johansen et al., 1996Down ), the PPV 5' non-coding region (NCR) (Simón-Buela et al., 1997Down ) and the 3' NCR of TVMV (Rodríguez-Cerezo et al., 1991Down ). Interestingly, wilting symptoms in Tabasco pepper plants infected with Tobacco etch virus (TEV) are determined by two separate regions of the viral genome, one encoding the C-terminal part of the P3+6K1 protein and the other encoding the C-terminal end of the CI protein, the 6K2 peptide and the N-terminal region of the VPg protein (Chu et al., 1997Down ). Thus, symptoms in potyvirus-infected plants seem to be the result of a complex interaction between different virus factors with the host, rather than the effect of a single virus protein. In agreement with this assumption, differences in symptomatology between PPV-R and -PS are determined by a large genomic fragment. Interestingly, the most variable potyviral proteins, P1 and CP, do not seem to play a role, whereas, as for the wilting phenotype of the TEV-infected Tabasco pepper, the C-terminal region of the P3+6K1 protein is fundamental to the specific PPV phenotype in N. clevelandii and pea.

Little is known about the function of the P3+6K1 protein in potyvirus infection. It is required for virus replication in the infected cell (Klein et al., 1994Down ) and has been shown to interact with cytoplasmic (Rodríguez-Cerezo et al., 1993Down ) and nuclear (Langenberg & Zhang, 1997Down ) inclusions in TVMV and pea seed-borne mosaic virus-infected cells, respectively. The PPV P3+6K1 protein is processed in vitro by the NIa protease (García et al., 1992Down ). Although processing at this site does not appear to be essential for virus viability, a mutation that disturbs the cleavage affects virus competitiveness, and the mutant form is either rapidly lost or the mutation is compensated for by a second mutation in the 6K1 region that does not restore susceptibility to in vitro cleavage (Riechmann et al., 1995Down ). From these data, it has been suggested that P3+6K1 is probably the functional product and that detachment of the 6K1 portion could have a regulatory role. Supporting our conclusion that P3+6K1 is involved in symptom elicitation, it has been reported that stable mutations at the P3/6K1 cleavage site that have little effect on in vitro cleavage, and that apparently do not affect virus accumulation, cause drastic changes in the symptoms of the infected plants, either alleviating or exacerbating them (Riechmann et al., 1995Down ).

There is little information on how the P3+6K1 protein may interact with plant and/or virus elements in order to elicit different symptomatologies. The TVMV P3 protein has been shown to be present predominantly in membrane-enriched fractions of extracts of infected leaves (Rodríguez-Cerezo & Shaw, 1991Down ). Computer analysis indicates the existence of two putative transmembrane helices in the P3 domain. In addition, the 6K1 peptide possesses a highly hydrophobic core and in this respect is very similar to the 6K2 peptide, which has been shown to direct the NIa protein to membranes (Restrepo-Hartwig & Carrington, 1994Down ). Thus, the P3+6K1 protein may be an integral membrane protein and proteolytic removal of the hydrophobic 6K1 domain may modulate its function. It is tempting to speculate that disturbance of cell membranes by P3+6K1 insertion may contribute to symptom induction. On the other hand, the 6K1 hydrophobic domain is flanked by hydrophilic sequences, and a mutation that removes a positive charge upstream of the hydrophobic region has been shown to be compensated for in vivo by downstream second mutations that recover the positive charge (J. L. Riechmann & J. A. García, unpublished data). This result suggests the involvement of electrostatic bonds in interactions between the C terminus of P3+6K1 and host or virus factors, which could be modulated by 6K1 cleavage and could be relevant to the development of symptoms in infected plants.


   Acknowledgments
 
We wish to thank Elvira Domínguez for technical assistance and Juan José López Moya, Ma Rosario Fernández-Fernández and Carlos Malpica for critical reading of the manuscript. This work was supported by grants BIO98-0769 from CICYT, 06G/021/96 from Comunidad de Madrid, BIO4-CT96-0304 and BIO4-CT97-2300 from the Biotechnology Program of the European Union and HF1996-0024 from Spanish–French Picasso Program.


   Footnotes
 
The EMBL accession number of the PPV-PS sequence reported in this paper is AJ243957.

b Present address: Mendel Biotechnology, 21375 Cabot Boulevard, Hayward, CA 94545, USA. Back


   References
TOP
Abstract
Introduction
Methods
Results
Discussion
References
 
Aleman-Verdaguer, M.-E., Goudou-Urbino, C., Dubern, J., Beachy, R. N. & Fauquet, C. (1997). Analysis of the sequence diversity of the P1, HC, P3, NIb and CP genomic regions of several yam mosaic potyvirus isolates: implications for the intraspecies molecular diversity of potyviruses. Journal of General Virology 78, 1253-1264.[Abstract]

Atreya, C. D., Atreya, P. L., Thornbury, D. W. & Pirone, T. P. (1992). Site-directed mutations in the potyvirus HC-Pro gene affect helper component activity, virus accumulation, and symptom expression in infected tobacco plants. Virology 191, 106-111.[Medline]

Bousalem, M., Candresse, T., Quiot-Douine, L. & Quiot, J. B. (1994). Comparison of three methods for assessing plum pox virus variability: further evidence for the existence of two major groups of isolates. Journal of Phytopathology 142, 163-172.

Candresse, T., Cambra, M., Dallot, S., Lanneau, M., Asensio, M., Gorris, M. T., Revers, F., Macquaire, G., Olmos, A., Boscia, D., Quiot, J. B. & Dunez, J. (1998). Comparison of monoclonal antibodies and polymerase chain reaction assays for the typing of isolates belonging to the D and M serotypes of plum pox potyvirus. Phytopathology 88, 198-204.[Medline]

Cervera, M. T., Riechmann, J. L., Martín, M. T. & García, J. A. (1993). 3'-Terminal sequence of the plum pox virus PS and o6 isolates: evidence for RNA recombination within the potyvirus group. Journal of General Virology 74, 329-334.[Abstract/Free Full Text]

Chu, M., Lopez-Moya, J. J., Llave-Correas, C. & Pirone, T. P. (1997). Two separate regions in the genome of the tobacco etch virus contain determinants of the wilting response of Tabasco pepper. Molecular Plant-Microbe Interactions 10, 472-480.

Crescenzi, A., d’Aquino, L., Comes, S., Nuzzaci, M., Piazzolla, P., Boscia, D. & Hadidi, A. (1997). Characterization of the sweet cherry isolate of plum pox potyvirus. Plant Disease 81, 711-714.

Fichot, O. & Girard, M. (1990). An improved method for sequencing of RNA templates. Nucleic Acids Research 18, 6162.[Free Full Text]

García, J. A., Martín, M. T., Cervera, M. T. & Riechmann, J. L. (1992). Proteolytic processing of the plum pox potyvirus polyprotein by the NIa protease at a novel cleavage site. Virology 188, 697-703.[Medline]

Johansen, I. E., Dougherty, W. G., Keller, K. E., Wang, D. & Hampton, R. O. (1996). Multiple viral determinants affect seed transmission of pea seedborne mosaic virus in Pisum sativum. Journal of General Virology 77, 3149-3154.[Abstract/Free Full Text]

Kerlan, C. & Dunez, J. (1979). Différenciation biologique et sérologique de souches du virus de la Sharka. Annales de Phytopathologie 11, 241-250.

Klein, P. G., Klein, R. R., Rodríguez-Cerezo, E., Hunt, A. G. & Shaw, J. G. (1994). Mutational analysis of the tobacco vein mottling virus genome. Virology 204, 759-769.[Medline]

Kunkel, T. A., Roberts, J. D. & Zakour, R. A. (1987). Rapid and efficient site-specific mutagenesis without phenotypic selection. Methods in Enzymology 154, 367-382.[Medline]

Laín, S., Riechmann, J. L., Méndez, E. & García, J. A. (1988). Nucleotide sequence of the 3' terminal region of plum pox potyvirus RNA. Virus Research 10, 325-342.

Laín, S., Riechmann, J. L. & García, J. A. (1989). The complete nucleotide sequence of plum pox potyvirus RNA. Virus Research 13, 157-172.[Medline]

Langenberg, W. G. & Zhang, L. (1997). Immunocytology shows the presence of tobacco etch virus P3 protein in nuclear inclusions. Journal of Structural Biology 118, 243-247.[Medline]

Maiss, E., Timpe, U., Brisske, A., Jelkmann, W., Casper, R., Himmler, G., Mattanovich, D. & Katinger, H. W. D. (1989). The complete nucleotide sequence of plum pox virus RNA. Journal of General Virology 70, 513-524.[Abstract/Free Full Text]

Maiss, E., Ivanova, L., Breyel, E. & Adam, G. (1991). Cloning and sequencing of the S RNA from a Bulgarian isolate of tomato spotted wilt virus. Journal of General Virology 72, 461-464.[Abstract/Free Full Text]

Maiss, E., Timpe, U., Brisske-Rode, A., Lesemann, D.-E. & Casper, R. (1992). Infectious in vivo transcripts of a plum pox potyvirus full-length cDNA clone containing the cauliflower mosaic virus 35S RNA promoter. Journal of General Virology 73, 709-713.[Abstract/Free Full Text]

Nemchinov, L. & Hadidi, A. (1996). Characterization of the sour cherry strain of plum pox virus. Phytopathology 86, 575-580.

Palkovics, L., Burgyán, J. & Balázs, E. (1993). Comparative sequence analysis of four complete primary structures of plum pox virus strains. Virus Genes 7, 339-347.[Medline]

Restrepo-Hartwig, M. A. & Carrington, J. C. (1994). The tobacco etch potyvirus 6-kilodalton protein is membrane associated and involved in viral replication. Journal of Virology 68, 2388-2397.[Abstract/Free Full Text]

Revers, F., Le Gall, O., Candresse, T. & Maule, A. J. (1999). New advances in understanding the molecular biology of plant/potyvirus interactions. Molecular Plant-Microbe Interactions 12, 367-376.

Riechmann, J. L., Laín, S. & García, J. A. (1990). Infectious in vitro transcripts from a plum pox potyvirus cDNA clone. Virology 177, 710-716.[Medline]

Riechmann, J. L., Laín, S. & García, J. A. (1992). Highlights and prospects of potyvirus molecular biology. Journal of General Virology 73, 1-16.[Abstract/Free Full Text]

Riechmann, J. L., Cervera, M. T. & García, J. A. (1995). Processing of the plum pox virus polyprotein at the P3–6K1 junction is not required for virus viability. Journal of General Virology 76, 951-956.[Abstract/Free Full Text]

Rodríguez-Cerezo, E. & Shaw, J. G. (1991). Two newly detected nonstructural viral proteins in potyvirus-infected cells. Virology 185, 572-579.[Medline]

Rodríguez-Cerezo, E., Klein, P. G. & Shaw, J. G. (1991). A determinant of disease symptom severity is located in the 3'-terminal noncoding region of the RNA of a plant virus. Proceedings of the National Academy of Sciences, USA 88, 9863-9867.[Abstract/Free Full Text]

Rodríguez-Cerezo, E., Ammar, E. D., Pirone, T. P. & Shaw, J. G. (1993). Association of the non-structural P3 viral protein with cylindrical inclusions in potyvirus-infected cells. Journal of General Virology 74, 1945-1949.[Abstract/Free Full Text]

Simón, L., Sáenz, P. & García, J. A. (1997). Plum pox virus. In Filamentous Viruses of Woody Plants, pp. 75-86. Edited by P. Monnette. Trivandrum, India: Research Singspost.

Simón-Buela, L., Guo, H. S. & García, J. A. (1997). Long sequences in the 5' noncoding region of plum pox virus are not necessary for viral infectivity but contribute to viral competitiveness and pathogenesis. Virology 233, 157-162.[Medline]

Sutic, D., Jordovic, M., Rankovic, M. & Festic, H. (1971). Comparative studies of some sharka (plum pox) virus isolates. Proceedings of the VIII Symposium sur les Maladies à Virus des Arbres Frutiers. Annales de Phytopathologie Hors Séries, 185–192.

Teycheney, P. Y., Tavert, G., Delbos, R., Ravelonandro, M. & Dunez, J. (1989). The complete nucleotide sequence of plum pox virus RNA (strain D). Nucleic Acids Research 17, 10115-10116.[Free Full Text]

Van Oosten, H. J. (1971). Further information about the herbaceous host range of sharka (plum pox) virus. Proceedings of the VIII Symposium sur les Maladies à Virus des Arbres Frutiers. Annales de Phytopathologie Hors Séries, 195–201.

Wetzel, T., Candresse, T., Ravelonandro, M., Delbos, R. P., Mazyad, H., Aboul-Ata, A. E. & Dunez, J. (1991). Nucleotide sequence of the 3'-terminal region of the RNA of the El Amar strain of plum pox potyvirus. Journal of General Virology 72, 1741-1746.[Abstract/Free Full Text]

Wetzel, T., Candresse, T., Macquaire, G., Ravelonandro, M. & Dunez, J. (1992). A highly sensitive immunocapture polymerase chain reaction method for plum pox potyvirus detection.Journal of Virological Methods 39, 27-37.[Medline]

Received 16 August 1999; accepted 8 November 1999.


This article has been cited by other articles:


Home page
J. Gen. Virol.Home page
C. Dietrich, Q. Al Abdallah, L. Lintl, A. Pietruszka, and E. Maiss
A chimeric plum pox virus shows reduced spread and cannot compete with its parental wild-type viruses in a mixed infection
J. Gen. Virol., October 1, 2007; 88(10): 2846 - 2851.
[Abstract] [Full Text] [PDF]


Home page
J Exp BotHome page
P Diaz-Vivancos, M Rubio, V Mesonero, P. Periago, A Ros Barcelo, P Martinez-Gomez, and J. Hernandez
The apoplastic antioxidant system in Prunus: response to long-term plum pox virus infection
J. Exp. Bot., November 1, 2006; 57(14): 3813 - 3824.
[Abstract] [Full Text] [PDF]


Home page
J. Gen. Virol.Home page
A. Waltermann and E. Maiss
Detection of 6K1 as a mature protein of 6 kDa in plum pox virus-infected Nicotiana benthamiana.
J. Gen. Virol., August 1, 2006; 87(Pt 8): 2381 - 2386.
[Abstract] [Full Text] [PDF]


Home page
J. Gen. Virol.Home page
I.-R. Choi, K. M. Horken, D. C. Stenger, and R. French
An internal RNA element in the P3 cistron of Wheat streak mosaic virus revealed by synonymous mutations that affect both movement and replication
J. Gen. Virol., September 1, 2005; 86(9): 2605 - 2614.
[Abstract] [Full Text] [PDF]


Home page
J. Gen. Virol.Home page
M. Tribodet, L. Glais, C. Kerlan, and E. Jacquot
Characterization of Potato virus Y (PVY) molecular determinants involved in the vein necrosis symptom induced by PVYN isolates in infected Nicotiana tabacum cv. Xanthi
J. Gen. Virol., July 1, 2005; 86(7): 2101 - 2105.
[Abstract] [Full Text] [PDF]


Home page
J. Gen. Virol.Home page
Z. Tan, A. J. Gibbs, Y. Tomitaka, F. Sanchez, F. Ponz, and K. Ohshima
Mutations in Turnip mosaic virus genomes that have adapted to Raphanus sativus
J. Gen. Virol., February 1, 2005; 86(2): 501 - 510.
[Abstract] [Full Text] [PDF]


Home page
J. Gen. Virol.Home page
N. Suehiro, T. Natsuaki, T. Watanabe, and S. Okuda
An important determinant of the ability of Turnip mosaic virus to infect Brassica spp. and/or Raphanus sativus is in its P3 protein
J. Gen. Virol., July 1, 2004; 85(7): 2087 - 2098.
[Abstract] [Full Text] [PDF]


Home page
J. Gen. Virol.Home page
V. Paalme, E. Gammelgard, L. Jarvekulg, and J. P. T. Valkonen
In vitro recombinants of two nearly identical potyviral isolates express novel virulence and symptom phenotypes in plants
J. Gen. Virol., March 1, 2004; 85(3): 739 - 747.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via CrossRef
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Sáenz, P.
Right arrow Articles by García, J. A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Sáenz, P.
Right arrow Articles by García, J. A.
Agricola
Right arrow Articles by Sáenz, P.
Right arrow Articles by García, J. A.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
INT J SYST EVOL MICROBIOL MICROBIOLOGY J GEN VIROL
J MED MICROBIOL ALL SGM JOURNALS