|
|
||||||||
Plant |
Centro Nacional de Biotecnología (CSIC), Campus de la Universidad Autónoma de Madrid, 28049 Madrid, Spain1
Ecole Nationale Superieure Agronomique de Montpellier (ENSAM-INRA), 2 Place Viala, 34060 Montpellier Cedex 1, France2
Author for correspondence: Juan Antonio García. Fax +34 91 5854506. e-mail jagarcia{at}cnb.uam.es
| Abstract |
|---|
|
|
|---|
| Introduction |
|---|
|
|
|---|
In nature, PPV causes a very damaging disease of trees of the genus Prunus. Many PPV isolates have been classified in several groups according to serological and biological properties, particularly the symptoms caused in experimental herbaceous hosts (Kerlan & Dunez, 1979
; Sutic et al., 1971
; Van Oosten, 1971
). The availability of genome sequence data has enabled a more reliable classification to be established. Apart from the atypical El Amar isolate (Wetzel et al., 1991
) and the recently characterized isolates that infect sweet and sour cherries (Crescenzi et al., 1997
; Nemchinov & Hadidi, 1996
), most PPV isolates can be classified into two major strains, M (from the isolate Marcus) and D (from the isolate Dideron) (Candresse et al., 1998
).
Full-length cDNA clones, from which infectious transcripts can be produced either in vitro or in vivo allowing easy manipulation of the viral genome, are very useful tools for the identification of strain- and isolate-specific pathogenicity determinants. Whereas biologically active full-length cDNA clones from the D isolates PPV-R (Riechmann et al., 1990
) and PPV-NAT (Maiss et al., 1992
) have been reported, full-length cDNA clones of PPV isolates belonging to the M strain have not been described. In this paper, we report the construction of a full-length cDNA clone of an M isolate of PPV, PPV-PS, and demonstrate the viability of M/D recombinant viruses. We have taken advantage of the different symptomatology caused in several herbaceous hosts by the virus progeny of the PPV clones to gain insight into the elements of the potyvirus genome that influence symptom development.
| Methods |
|---|
|
|
|---|
Virus and bacterial strains.
and JM109 were used for cloning of the plasmids and CJ236 was used in site-directed mutagenesis experiments.
Synthesis and cloning of cDNA from PPV-PS RNA.
The construction of clones of the pH and pBS series, which contain partial cDNA copies of PPV-PS RNA inserted in the HindIII site (pH) or between the BamHI and SacI sites (pBS) of pUC18, has been reported previously (Cervera et al., 1993
). Additional clones with fragments covering the entire PPV-PS genome except its 5' end were obtained in a similar fashion. In order to clone the first 547 nt of the PPV-PS genome, a cDNA fragment was amplified by RTPCR using the oligodeoxynucleotides 5' AAAATATAAAAACTCAACAC 3' and 5' CCAGTGGTGTACCG 3' as primers. This fragment was digested with HindIII or AccI and cloned into the pGEM3 vector (Promega) digested with HindIII and SmaI or AccI and SmaI, generating the plasmids pG5'PSH and pG5'PSA, respectively. Several independent clones were sequenced to ensure that no mutation had been introduced during the RTPCR. Non-viral nucleotides between the transcription initiation site of the pGEM3 T7 promoter and the first nucleotide of PPV were removed by site-directed mutagenesis (Kunkel et al., 1987
) by using the oligodeoxynucleotide 5' TTTATATTTTCTATAGTGAG 3' (Riechmann et al., 1990
), to give pGG5'PSH.
The complete nucleotide sequence of the PPV-PS genome was determined by sequencing double-stranded cDNA contained in the different plasmids and single-stranded DNA subcloned into M13 recombinant phages with the Sequenase 2.0 kit (Amersham). The first 211 nt of the PPV-PS genome were determined by direct sequencing of viral RNA (Fichot & Girard, 1990
).
The complete clone pGPPVPS was prepared by replacing appropriate restriction fragments in pGPPV, the previously described full-length cDNA of PPV-R (Rankovic) (Riechmann et al., 1990
), with corresponding fragments from PPV-PS. The PPV-PS/PPV-R chimeras shown in Fig. 1
were produced by exchange of restriction fragments as indicated in the figure. All fragments generated by PCR were sequenced. Additional details will be supplied by the authors on request.
|
In vitro transcription and inoculation of plants.Three primary leaves per N. clevelandii plant were dusted with carborundum and inoculated mechanically with 1·5 µl of the transcription reaction mixture diluted 1:1 with 5 mM sodium phosphate buffer (pH 7·2). Crude sap from leaves of infected N. clevelandii plants (2 ml per g tissue) was used to inoculate Pisum sativum plants and N. clevelandii plants (20 µl in three leaves per plant) by hand.
Virus accumulation was assessed by Western blot and by double-antibody sandwich indirect (DASI)-ELISA with the REALISA kit (Durviz). Fragments that included the PSR borders were amplified by RTPCR (Titan kit; Boehringer Mannheim) preceded by immunocapture (Wetzel et al., 1992
) and sequenced to verify that the chimeric sequences were maintained in virus progeny.
| Results |
|---|
|
|
|---|
A full-length cDNA copy of the PPV-PS isolate was cloned downstream from a phage T7 RNA polymerase promoter. Capped RNA transcripts, synthesized in vitro from the resulting plasmid pGPPVPS, displayed a level of infectivity in N. clevelandii plants similar to that observed for transcripts of pGPPV, a full-length cDNA clone of the Rankovic isolate of PPV (PPV-R). Infection with the virus progeny of PPV-PS transcripts (PPV-PSc) caused a very mild chlorotic mottle, clearly distinguishable from the more severe symptoms provoked by virus progeny of PPV-R transcripts (PPV-Rc) (Fig. 2
A). The mild symptoms of PPV-PSc-infected plants resembled those caused by several virus variants isolated from the original PPV-PS isolate, but largely differed from those of other variants, indicating the existence of several sub-isolates with different biological properties (P. Sáenz & J. A. García, unpublished results).
|
|
Virus accumulation in plants infected with the different chimeras was assessed by Western blot (Fig. 3
) and ELISA (Fig. 4
A). Although there were small differences in the levels of accumulation of the different chimeric viruses, no correlation was observed between symptom severity and virus accumulation.
|
|
|
| Discussion |
|---|
|
|
|---|
Our results indicate that a genome fragment from the end of the P3+6K1 coding region is sufficient to confer a PS phenotype on a PPV-R background. The size of this pathogenicity determinant and the kind of symptoms that it induces depend on the host. In N. clevelandii, between 74 and 173 amino acids (including a maximum of 11 differences between PPV-PS and -R) near the C-terminal end of the PPV-PS P3+6K1 protein are necessary to get the mild systemic chlorotic mottle typical of pGPPVPS virus progeny. This same region from pGPPV does not define R-type symptoms in N. clevelandii when cloned in pGPPVPS. Thus, the fact that virus progeny from pR/P 22123628 and pR/P 22125535 cause PS and R symptoms, respectively, indicates that specific CI sequences are required to elicit the severe symptomatology of the PPV-R isolate in N. clevelandii. It is important to note that, although very unlikely, effects due to differences at the nucleotide level cannot be ruled out.
The differences in symptomatology between PPV-R and -PS in P. sativum appear to be defined by the same pathogenicity determinant. However, in this case, a sequence encoding 74 amino acids of the C-terminal region of P3+6K1 (containing four differences between PPV-PS and -R) is enough to elicit a PS-type response (systemic chlorotic spots without necrotic local lesions). Moreover, in this host, the pathogenicity determinants in the CI cistron are less important, since the 22123628 fragment from PPV-R, which does not include CI sequences, is enough to confer the typical phenotype of this isolate (local necrotic lesions and systemic chlorotic spots that become necrotic). It is important to remark that other genomic regions might define differences of pathogenicity between PPV-R and PPV-PS in other herbaceous hosts. In this regard, the necrotic (PPV-R)/chlorotic (PPV-PS) type of the local lesions that PPV causes in Chenopodium foetidum seems to be defined by complex determinants different from that described in this report. Thus, although R/P 22127677 (which has the central region of the genome of PPV-PS) caused chlorotic lesions in C. foetidum, the reciprocal clone, P/R 22127677, as well as most of the rest of chimeras, caused a confused pattern of chlorotic, necrotic and intermediate lesions (data not shown).
The fact that we did not observe any correlation between symptom severity and virus accumulation seems to indicate that the differences in symptomatology are not the simple result of different replication efficiencies of PPV-R and -PS. Several regions of the potyvirus genome have been shown to be involved in symptom determination; for example, the HC coding sequence of Tobacco vein mottling virus (TVMV) (Atreya et al., 1992
), a genomic fragment that encodes the NIa protease and NIb replicase (Johansen et al., 1996
), the PPV 5' non-coding region (NCR) (Simón-Buela et al., 1997
) and the 3' NCR of TVMV (Rodríguez-Cerezo et al., 1991
). Interestingly, wilting symptoms in Tabasco pepper plants infected with Tobacco etch virus (TEV) are determined by two separate regions of the viral genome, one encoding the C-terminal part of the P3+6K1 protein and the other encoding the C-terminal end of the CI protein, the 6K2 peptide and the N-terminal region of the VPg protein (Chu et al., 1997
). Thus, symptoms in potyvirus-infected plants seem to be the result of a complex interaction between different virus factors with the host, rather than the effect of a single virus protein. In agreement with this assumption, differences in symptomatology between PPV-R and -PS are determined by a large genomic fragment. Interestingly, the most variable potyviral proteins, P1 and CP, do not seem to play a role, whereas, as for the wilting phenotype of the TEV-infected Tabasco pepper, the C-terminal region of the P3+6K1 protein is fundamental to the specific PPV phenotype in N. clevelandii and pea.
Little is known about the function of the P3+6K1 protein in potyvirus infection. It is required for virus replication in the infected cell (Klein et al., 1994
) and has been shown to interact with cytoplasmic (Rodríguez-Cerezo et al., 1993
) and nuclear (Langenberg & Zhang, 1997
) inclusions in TVMV and pea seed-borne mosaic virus-infected cells, respectively. The PPV P3+6K1 protein is processed in vitro by the NIa protease (García et al., 1992
). Although processing at this site does not appear to be essential for virus viability, a mutation that disturbs the cleavage affects virus competitiveness, and the mutant form is either rapidly lost or the mutation is compensated for by a second mutation in the 6K1 region that does not restore susceptibility to in vitro cleavage (Riechmann et al., 1995
). From these data, it has been suggested that P3+6K1 is probably the functional product and that detachment of the 6K1 portion could have a regulatory role. Supporting our conclusion that P3+6K1 is involved in symptom elicitation, it has been reported that stable mutations at the P3/6K1 cleavage site that have little effect on in vitro cleavage, and that apparently do not affect virus accumulation, cause drastic changes in the symptoms of the infected plants, either alleviating or exacerbating them (Riechmann et al., 1995
).
There is little information on how the P3+6K1 protein may interact with plant and/or virus elements in order to elicit different symptomatologies. The TVMV P3 protein has been shown to be present predominantly in membrane-enriched fractions of extracts of infected leaves (Rodríguez-Cerezo & Shaw, 1991
). Computer analysis indicates the existence of two putative transmembrane helices in the P3 domain. In addition, the 6K1 peptide possesses a highly hydrophobic core and in this respect is very similar to the 6K2 peptide, which has been shown to direct the NIa protein to membranes (Restrepo-Hartwig & Carrington, 1994
). Thus, the P3+6K1 protein may be an integral membrane protein and proteolytic removal of the hydrophobic 6K1 domain may modulate its function. It is tempting to speculate that disturbance of cell membranes by P3+6K1 insertion may contribute to symptom induction. On the other hand, the 6K1 hydrophobic domain is flanked by hydrophilic sequences, and a mutation that removes a positive charge upstream of the hydrophobic region has been shown to be compensated for in vivo by downstream second mutations that recover the positive charge (J. L. Riechmann & J. A. García, unpublished data). This result suggests the involvement of electrostatic bonds in interactions between the C terminus of P3+6K1 and host or virus factors, which could be modulated by 6K1 cleavage and could be relevant to the development of symptoms in infected plants.
| Acknowledgments |
|---|
| Footnotes |
|---|
b Present address: Mendel Biotechnology, 21375 Cabot Boulevard, Hayward, CA 94545, USA. ![]()
| References |
|---|
|
|
|---|
Atreya, C. D., Atreya, P. L., Thornbury, D. W. & Pirone, T. P. (1992). Site-directed mutations in the potyvirus HC-Pro gene affect helper component activity, virus accumulation, and symptom expression in infected tobacco plants. Virology 191, 106-111.[Medline]
Bousalem, M., Candresse, T., Quiot-Douine, L. & Quiot, J. B. (1994). Comparison of three methods for assessing plum pox virus variability: further evidence for the existence of two major groups of isolates. Journal of Phytopathology 142, 163-172.
Candresse, T., Cambra, M., Dallot, S., Lanneau, M., Asensio, M., Gorris, M. T., Revers, F., Macquaire, G., Olmos, A., Boscia, D., Quiot, J. B. & Dunez, J. (1998). Comparison of monoclonal antibodies and polymerase chain reaction assays for the typing of isolates belonging to the D and M serotypes of plum pox potyvirus. Phytopathology 88, 198-204.[Medline]
Cervera, M. T., Riechmann, J. L., Martín, M. T. & García, J. A. (1993). 3'-Terminal sequence of the plum pox virus PS and o6 isolates: evidence for RNA recombination within the potyvirus group. Journal of General Virology 74, 329-334.
Chu, M., Lopez-Moya, J. J., Llave-Correas, C. & Pirone, T. P. (1997). Two separate regions in the genome of the tobacco etch virus contain determinants of the wilting response of Tabasco pepper. Molecular Plant-Microbe Interactions 10, 472-480.
Crescenzi, A., dAquino, L., Comes, S., Nuzzaci, M., Piazzolla, P., Boscia, D. & Hadidi, A. (1997). Characterization of the sweet cherry isolate of plum pox potyvirus. Plant Disease 81, 711-714.
Fichot, O. & Girard, M. (1990). An improved method for sequencing of RNA templates. Nucleic Acids Research 18, 6162.
García, J. A., Martín, M. T., Cervera, M. T. & Riechmann, J. L. (1992). Proteolytic processing of the plum pox potyvirus polyprotein by the NIa protease at a novel cleavage site. Virology 188, 697-703.[Medline]
Johansen, I. E., Dougherty, W. G., Keller, K. E., Wang, D. & Hampton, R. O. (1996). Multiple viral determinants affect seed transmission of pea seedborne mosaic virus in Pisum sativum. Journal of General Virology 77, 3149-3154.
Kerlan, C. & Dunez, J. (1979). Différenciation biologique et sérologique de souches du virus de la Sharka. Annales de Phytopathologie 11, 241-250.
Klein, P. G., Klein, R. R., Rodríguez-Cerezo, E., Hunt, A. G. & Shaw, J. G. (1994). Mutational analysis of the tobacco vein mottling virus genome. Virology 204, 759-769.[Medline]
Kunkel, T. A., Roberts, J. D. & Zakour, R. A. (1987). Rapid and efficient site-specific mutagenesis without phenotypic selection. Methods in Enzymology 154, 367-382.[Medline]
Laín, S., Riechmann, J. L., Méndez, E. & García, J. A. (1988). Nucleotide sequence of the 3' terminal region of plum pox potyvirus RNA. Virus Research 10, 325-342.
Laín, S., Riechmann, J. L. & García, J. A. (1989). The complete nucleotide sequence of plum pox potyvirus RNA. Virus Research 13, 157-172.[Medline]
Langenberg, W. G. & Zhang, L. (1997). Immunocytology shows the presence of tobacco etch virus P3 protein in nuclear inclusions. Journal of Structural Biology 118, 243-247.[Medline]
Maiss, E., Timpe, U., Brisske, A., Jelkmann, W., Casper, R., Himmler, G., Mattanovich, D. & Katinger, H. W. D. (1989). The complete nucleotide sequence of plum pox virus RNA. Journal of General Virology 70, 513-524.
Maiss, E., Ivanova, L., Breyel, E. & Adam, G. (1991). Cloning and sequencing of the S RNA from a Bulgarian isolate of tomato spotted wilt virus. Journal of General Virology 72, 461-464.
Maiss, E., Timpe, U., Brisske-Rode, A., Lesemann, D.-E. & Casper, R. (1992). Infectious in vivo transcripts of a plum pox potyvirus full-length cDNA clone containing the cauliflower mosaic virus 35S RNA promoter. Journal of General Virology 73, 709-713.
Nemchinov, L. & Hadidi, A. (1996). Characterization of the sour cherry strain of plum pox virus. Phytopathology 86, 575-580.
Palkovics, L., Burgyán, J. & Balázs, E. (1993). Comparative sequence analysis of four complete primary structures of plum pox virus strains. Virus Genes 7, 339-347.[Medline]
Restrepo-Hartwig, M. A. & Carrington, J. C. (1994). The tobacco etch potyvirus 6-kilodalton protein is membrane associated and involved in viral replication. Journal of Virology 68, 2388-2397.
Revers, F., Le Gall, O., Candresse, T. & Maule, A. J. (1999). New advances in understanding the molecular biology of plant/potyvirus interactions. Molecular Plant-Microbe Interactions 12, 367-376.
Riechmann, J. L., Laín, S. & García, J. A. (1990). Infectious in vitro transcripts from a plum pox potyvirus cDNA clone. Virology 177, 710-716.[Medline]
Riechmann, J. L., Laín, S. & García, J. A. (1992). Highlights and prospects of potyvirus molecular biology. Journal of General Virology 73, 1-16.
Riechmann, J. L., Cervera, M. T. & García, J. A. (1995). Processing of the plum pox virus polyprotein at the P36K1 junction is not required for virus viability. Journal of General Virology 76, 951-956.
Rodríguez-Cerezo, E. & Shaw, J. G. (1991). Two newly detected nonstructural viral proteins in potyvirus-infected cells. Virology 185, 572-579.[Medline]
Rodríguez-Cerezo, E., Klein, P. G. & Shaw, J. G. (1991). A determinant of disease symptom severity is located in the 3'-terminal noncoding region of the RNA of a plant virus. Proceedings of the National Academy of Sciences, USA 88, 9863-9867.
Rodríguez-Cerezo, E., Ammar, E. D., Pirone, T. P. & Shaw, J. G. (1993). Association of the non-structural P3 viral protein with cylindrical inclusions in potyvirus-infected cells. Journal of General Virology 74, 1945-1949.
Simón, L., Sáenz, P. & García, J. A. (1997). Plum pox virus. In Filamentous Viruses of Woody Plants, pp. 75-86. Edited by P. Monnette. Trivandrum, India: Research Singspost.
Simón-Buela, L., Guo, H. S. & García, J. A. (1997). Long sequences in the 5' noncoding region of plum pox virus are not necessary for viral infectivity but contribute to viral competitiveness and pathogenesis. Virology 233, 157-162.[Medline]
Sutic, D., Jordovic, M., Rankovic, M. & Festic, H. (1971). Comparative studies of some sharka (plum pox) virus isolates. Proceedings of the VIII Symposium sur les Maladies à Virus des Arbres Frutiers. Annales de Phytopathologie Hors Séries, 185192.
Teycheney, P. Y., Tavert, G., Delbos, R., Ravelonandro, M. & Dunez, J. (1989). The complete nucleotide sequence of plum pox virus RNA (strain D). Nucleic Acids Research 17, 10115-10116.
Van Oosten, H. J. (1971). Further information about the herbaceous host range of sharka (plum pox) virus. Proceedings of the VIII Symposium sur les Maladies à Virus des Arbres Frutiers. Annales de Phytopathologie Hors Séries, 195201.
Wetzel, T., Candresse, T., Ravelonandro, M., Delbos, R. P., Mazyad, H., Aboul-Ata, A. E. & Dunez, J. (1991). Nucleotide sequence of the 3'-terminal region of the RNA of the El Amar strain of plum pox potyvirus. Journal of General Virology 72, 1741-1746.
Wetzel, T., Candresse, T., Macquaire, G., Ravelonandro, M. & Dunez, J. (1992). A highly sensitive immunocapture polymerase chain reaction method for plum pox potyvirus detection.Journal of Virological Methods 39, 27-37.[Medline]
Received 16 August 1999;
accepted 8 November 1999.
This article has been cited by other articles:
![]() |
C. Dietrich, Q. Al Abdallah, L. Lintl, A. Pietruszka, and E. Maiss A chimeric plum pox virus shows reduced spread and cannot compete with its parental wild-type viruses in a mixed infection J. Gen. Virol., October 1, 2007; 88(10): 2846 - 2851. [Abstract] [Full Text] [PDF] |
||||
![]() |
P Diaz-Vivancos, M Rubio, V Mesonero, P. Periago, A Ros Barcelo, P Martinez-Gomez, and J. Hernandez The apoplastic antioxidant system in Prunus: response to long-term plum pox virus infection J. Exp. Bot., November 1, 2006; 57(14): 3813 - 3824. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Waltermann and E. Maiss Detection of 6K1 as a mature protein of 6 kDa in plum pox virus-infected Nicotiana benthamiana. J. Gen. Virol., August 1, 2006; 87(Pt 8): 2381 - 2386. [Abstract] [Full Text] [PDF] |
||||
![]() |
I.-R. Choi, K. M. Horken, D. C. Stenger, and R. French An internal RNA element in the P3 cistron of Wheat streak mosaic virus revealed by synonymous mutations that affect both movement and replication J. Gen. Virol., September 1, 2005; 86(9): 2605 - 2614. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Tribodet, L. Glais, C. Kerlan, and E. Jacquot Characterization of Potato virus Y (PVY) molecular determinants involved in the vein necrosis symptom induced by PVYN isolates in infected Nicotiana tabacum cv. Xanthi J. Gen. Virol., July 1, 2005; 86(7): 2101 - 2105. [Abstract] [Full Text] [PDF] |
||||
![]() |
Z. Tan, A. J. Gibbs, Y. Tomitaka, F. Sanchez, F. Ponz, and K. Ohshima Mutations in Turnip mosaic virus genomes that have adapted to Raphanus sativus J. Gen. Virol., February 1, 2005; 86(2): 501 - 510. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. Suehiro, T. Natsuaki, T. Watanabe, and S. Okuda An important determinant of the ability of Turnip mosaic virus to infect Brassica spp. and/or Raphanus sativus is in its P3 protein J. Gen. Virol., July 1, 2004; 85(7): 2087 - 2098. [Abstract] [Full Text] [PDF] |
||||
![]() |
V. Paalme, E. Gammelgard, L. Jarvekulg, and J. P. T. Valkonen In vitro recombinants of two nearly identical potyviral isolates express novel virulence and symptom phenotypes in plants J. Gen. Virol., March 1, 2004; 85(3): 739 - 747. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| INT J SYST EVOL MICROBIOL | MICROBIOLOGY | J GEN VIROL |
| J MED MICROBIOL | ALL SGM JOURNALS | |