|
|
||||||||
Plant |
Microbiology Program and Department of Plant Pathology, University of California, Riverside, CA 92521-0122, USA1
Author for correspondence: Allan Dodds. Fax +1 909 787 4294. e-mail dodds{at}ucr.edu
| Abstract |
|---|
|
|
|---|
| Introduction |
|---|
|
|
|---|
The genome of TMGMV has been sequenced (Solis & Garcia-Arenal, 1990
) and like other tobamoviruses encodes at least four proteins that include the 126 and 183 kDa polypeptides thought to be components of the replicase, the 28·5 kDa protein thought to be involved in cell-to-cell movement and the 17·5 kDa coat protein (CP). Subgenomic RNAs generated during replication are collinear with the genomic RNA at the 3' terminus; consequently, these RNAs contain the same 3' untranslated region (3'UTR) as the viral genome (Palukaitis & Zaitlin, 1986
). The 3'UTR of the genomic RNA of tobamoviruses, with the exception of Odontoglossum ringspot virus (ORSV) (Gultyaev et al., 1994
), consists of approximately 200 nt (Leathers et al., 1993
) with two characteristic domains. A 105 base tRNA-like domain located at the 3' terminus mimics the three-dimensional structure of a true tRNA, and immediately upstream of this domain is a 72 base domain composed of three RNA pseudoknots (Gultyaev et al., 1994
; Leathers et al., 1993
). Pseudoknots are RNA stemloop structures that typically possess base complementarity between the loop and adjacent sequences (Pleij, 1990
). The 3'UTR in tobamoviruses promotes efficient translation and increases mRNA stability (Leathers et al., 1993
).
We report here population variability among tobamoviruses of the TMGMV type which naturally infect N. glauca in southern California. Two major populations were found, based on the relative mobility of the double-stranded (ds)RNA corresponding to the CP (LMC) (Palukaitis & Zaitlin, 1986
) subgenomic ssRNA in polyacrylamide gels. In order to investigate the nature and extent of this variability among individual isolates in each population, several isolates were chosen and compared biologically and serologically. We also present the nucleotide sequences of the 3'UTR of the RNA of these isolates of TMGMV in comparison to those of other tobamoviruses such as TMV-U2 (=TMGMV) (Solis & Garcia-Arenal, 1990
), and ORSV (Gultyaev et al., 1994
). In addition, comparison with the 3'UTR of STMV RNA allows hypotheses to be drawn on helpersatellite interactions.
| Methods |
|---|
|
|
|---|
Field collection.
Immunodiffusion tests.
The Ouchterlony double-diffusion assay was used initially to detect STMV (and therefore its helper virus TMGMV) using STMV-specific rabbit polyclonal antisera (titre 5000, used at a dilution of 1:100). Immunodiffusion assays were also done using rabbit polyclonal anti-TMGMV antibodies (titre 500, used at a dilution of 1:10) to detect TMGMV directly from infected tissue and for cross-absorption tests, which were performed in agar (Van Regenmortel, 1966
).
DsRNA purification.
DsRNA was analysed from 7·0 g of infected leaf tissue by two cycles of CF-11 cellulose chromatography as previously described (Valverde & Dodds, 1986
). DsRNA analysis was used to detect several different plant viruses including TMGMV and STMV in field samples, and the type of TMGMV in experimental plants after biological purification of tobamovirus isolates. DsRNAs were purified from any given biologically purified isolate during the experiments to ensure they were free of contamination from other viruses.
Biological purification.
TMGMV isolates were biologically purified by three or four repeated single local lesion passages in N. sylvestris and 58 were obtained, each from a separate source. The purified isolates were mechanically inoculated to N. tabacum Xanthi and N. glauca; infected leaves were then preserved dried or frozen.
Virus purification and antibodies.
A representative of each of two types of TMGMV, isolates R1-22 and R1-18 (see results), was propagated in N. tabacum Xanthi. These isolates were periodically checked by dsRNA analysis to ensure their identity and purity. TMGMV virions were purified by rate zonal sucrose density-gradient centrifugation (Valverde & Dodds, 1987
). CP subunits of TMGMV were analysed by SDSPAGE (Laemmli, 1970
) in 10% polyacrylamide gel (40:1 acrylamide/bis-acrylamide). Polyclonal antiserum was raised in rabbits against each TMGMV type using purified virions as immunogen.
Host range and symptomology.
Seedlings of up to 16 plant species were mechanically inoculated with purified virus at 50200 µg/ml in inoculation buffer. To confirm the differences between each of the two types, two additional experiments were done using six isolates of each type from different geographical locations using the hosts that differentiated the two types initially used. Dried leaf powder of these isolates (biologically purified) was soaked for about 1 h in 1 ml of inoculation buffer. The extract was inoculated onto carborundum-dusted leaves of N. rustica, N. benthamiana and N. clevelandii (two plants per isolate). Inoculated plants were kept in a greenhouse and observed for symptom development. Sap from host-range plants was inoculated to N. sylvestris (back inoculation). Immunodiffusion and dsRNA analyses were also used to confirm TMGMV infection.
Cloning and sequencing.
Viral RNA was isolated from purified virus (isolates R1-18 and R1-22) by the SDS and proteinase K method as previously described (Sambrook et al., 1989
). The initial cloning strategy utilized poly(A) tailing of viral ssRNA using poly(A) polymerase and [
-32P]ATP (Smith et al., 1988
). The oligonucleotide primer NotI(dT)18, 5' ACTGAATTCAAGCTTGCGGCCGC(T)18 3', containing 18-mer dT and over-hanging cloning sites for EcoRI, HindIII and NotI restriction enzymes, was used to prime the synthesis of first strand cDNA from the poly(A)-tailed RNA.
Double-stranded cDNA was synthesized from dT-tailed first strand cDNA by touch-down PCR amplification using the primers CP5' EcoRI at the 5' end of the CP gene and primers NotI(dT)18 and NotI adaptor at the 3' end. The 5' primer was 5' ATAGAATTCGCGGCCGCTCAATATGCCTTATACAATCAATCAACTCTCCGA 3' (CP5' EcoRI), which contains an EcoRI site and the sequence of TMGMV CP gene from nt 56615690 (underlined) (Nagy & Simon, 1997
). The 3' primers were NotI(dT)18 (3 pmol) and NotI adaptor primer with sequence 5' ACTGAATTCAAGCTTGCGGCCGCT 3', containing the same restriction sites as primer NotI(dT)18 (30 pmol). The PCR amplification conditions were as follows: 95 °C/2 min denaturation; three cycles of 94 °C/1 min, 40 °C/1 min, 72 °C/1·5 min for elongation annealing followed by 27 cycles of 94 °C/1 min, 55 °C/1 min, 72 °C/1·5 min, and then 72 °C for an additional 5 min. The PCR products were digested with EcoRI and NotI, and ligated into a similarly digested plasmid [pBluescript II KS(+/-); Stratagene]. Resulting cDNA clones were screened for insert size and two clones from each type were selected and sequenced. The clones contained cDNA inserts covering the entire CP and the 3'UTR.
To confirm the sequence heterogeneity found between the first two TMGMV isolates, ten more isolates from different geographical regions (five of each type, Large and Small; see Results) were selected for sequencing. Total nucleic acid was extracted from infected plants as previously described (Routh et al., 1995
). The sequences, obtained from dT-tailed cloning of the 3' end of our TMGMV RNA and published sequences (Solis & Garcia-Arenal, 1990
) were used to design two specific primers. cDNA to Large type TMGMV RNA (3'UTR) was synthesized using AMV reverse transcriptase and a 3' end-specific primer, 5' CGTGAATTCACCGGTTGGGCCGCTACCCGCGGTTA 3' (3' end primer), which included 20 bases (underlined) complementary to the genomic RNA of TMGMV (Solis & Garcia-Arenal, 1990
) except for the C residue at the 13th position (nt 6343, see result for isolate R1-18) and EcoRI and AgeI restriction sites for cloning into the polylinker of the plasmid vector pBluescript as discussed above.
Second strand cDNA was made using the specific primer 5' TGGACCACAACTCCGGCTAC 3' (CP3' primer), which is sense to nt 61226141, and AMV reverse transcriptase. cDNA clones were screened for insert size by digestion with the appropriate enzyme. Inserts of the predicted length were subjected to DNA sequencing analysis. At least two independent clones were sequenced for each isolate, the sequences of all cDNA clones were determined in both directions, and a consensus was derived. The same strategy was used to make cDNA for the Small type isolates, but these cDNAs were subjected to direct PCR sequencing (fmol sequencing system; Promega) without cloning into a vector.
| Results |
|---|
|
|
|---|
|
|
In addition to the major differences between the two types, at least four Large type isolates (two from each location in SA and SD) had a minor variation in the mobility of the CP subgenomic dsRNA as compared to other isolates of the Large type (data not shown). Furthermore, additional minor dsRNA profile differences were observed among isolates including those from the same geographical location.
Symptomology in a range of hosts
To assess the possible biological significance of the two types identified by dsRNA analysis, one isolate of each type (R1-18, Large; R1-22, Small) was chosen and inoculated onto 16 different hosts. Infections were confirmed using immunodiffusion and back inoculation to a local lesion host (N. sylvestris). In addition, the presence of virus was confirmed in systemically infected tissue by dsRNA analysis.
The symptoms induced by both isolates in N. tabacum Xanthi were a very mild green mottling or mosaic in the systemically infected leaves, with barely detectable symptoms in older leaves. Both types induced abundant local lesions on inoculated leaves of N. sylvestris with no systemic infection. These results support the conclusion that both are isolates of TMGMV. Table 2
summarizes additional symptoms induced by the two isolates, which could not be distinguished in most of the hosts used.
|
In order to further investigate the effect on symptomology observed in the three plant species that were diagnostic during the preliminary experiment, two additional experiments were done. A total of twelve isolates (six of each type) from different locations was chosen and plant symptoms were compared. Both experiments yielded results that were generally similar to the first experiment, except that a range of severity in systemic symptom expression (moderate to severe) was observed, especially in N. rustica.
Mock-inoculated plants and inoculated plants of Lycopersicon esculentum cv. Rutgers, and Vigna unguiculata showed no symptoms and were negative for TMGMV infection based on back inoculation to N. sylvestris and immunodiffusion assays.
Ability of Large and Small TMGMV types to support STMV
Gradient-purified virus of TMGMV isolate R1-22 (Small) was inoculated with STMV purified from isolate R1-22 (STMV R1-22) or from isolate R1-18 (Large, STMV R1-18) to plants of N. glauca. Both isolates of STMV were detected by dsRNA analysis in doubly inoculated tobacco plants, but not in plants inoculated with TMGMV alone (Fig. 2
). The reciprocal experiment using TMGMV isolate R1-18 (Large) as the helper gave the same results. The dsRNA profiles (Fig. 2
) did not show any evidence for contamination of TMGMV Large type with TMGMV Small type, and vice versa, based on the absence of contaminant LMC dsRNAs. Neither of the STMV inocula was infectious in the absence of TMGMV. The experiment was repeated with a second set of plants and the same results were obtained.
|
|
In order to further investigate the relationship between the two isolates at the protein level, the CP gene of each was cloned and sequenced. The predicted amino acid sequence of the CP of the Small type was identical to that of TMGMV (=TMV-U2), and consisted of 158 amino acids (Solis & Garcia-Arenal, 1990
). However, there were seven point mutations at the nucleotide level (Table 4
). The CP gene of the Large type was found to have an amino acid sequence (158 amino acids) nearly identical to that of the Small type, except for the substitution of a serine residue with a glycine residue at position 143, and six other point mutations (silent) at the same or different positions as those found in the Small type when compared to the published TMGMV sequence (Table 4
).
|
U) from the 3' terminus (Fig. 3a
|
| Discussion |
|---|
|
|
|---|
A previous study of dsRNAs of tobamoviruses (Valverde et al., 1987
) indicated that the subgenomic dsRNA for the CP of California isolates of TMGMV was unusually large for a tobamovirus, and electrophoresed like that of ORSV, which is known to have an unusually large 3'UTR for a tobamovirus (Gultyaev et al., 1994
). This was not a predicted result once a sequence of a TMGMV isolate was published (Solis & Garcia-Arenal, 1990
) which indicated that the CP subgenomic RNA including the 3'UTR should be about the same size as that expected for TMV-U1.
The current analysis of the dsRNAs of numerous isolates of TMGMV indicates that there are two types of TMGMV prevalent in southern California. One type, which had been previously overlooked, has a subgenomic RNA for the CP gene of similar mobility to that of TMV-U1, and therefore matched the predicted genome organization of TMGMV based on a published sequence. Biological, virological and sequence analyses of several isolates of this type (Small) indicate that this conventional form of TMGMV is common in southern California, and has the expected host range for TMGMV.
In addition to this type, however, we have confirmed our earlier conclusion that there is another type (called Large in this study and the type reported in previous studies) that has a large CP subgenomic RNA (LMC), and which has a similar, but not identical host range to TMGMV. The discovery that isolates of this type had essentially the same CP sequence as TMGMV suggests that the difference in size could map to the 3'UTR, since the CP ORF is such a large portion of this CP subgenomic RNA. This conclusion was confirmed by sequence analysis which also revealed that the increase in the size of the 3'UTR was caused by interesting repeated sequences in the 3'UTR region of the genome.
A TMGMV Large type was used in most previous studies of STMV (Dodds, 1998
) but in one study a type isolate of TMV-U2 (equivalent to TMGMV-Small type) (Valverde et al., 1991
) was shown to support STMV. In this study we confirmed that a recently isolated Large and Small type TMGMV could support not only the STMV with which it was associated but also the STMV initially associated with the other type. Since only 3 of 35 field isolates tested positive for mixed infections, and all were initially positive for STMV, it is likely that both Large and Small TMGMV types can independently support STMV in natural infections.
Analysis of the 3'UTR of Large type isolates revealed two domains, each of 147 nt and almost identical in sequence, one of which is absent from Small type isolates (Fig. 3a
, b
). The repeated sequence contained that part of the tRNA-like structure corresponding to the anti-codon domain upstream of the aminoacyl acceptor domain. In addition, the repeat contained the sequence for three pseudoknotted structures predicted to form in the 3'-terminal region of TMGMV (=TMV-U2) between the 5' end of the tRNA-like structure and the 3' end of the CP gene (Fig. 3b
in Garcia-Arenal, 1988
). The repeat sequence started at position 39 and ended at position 185. An isolate from San Diego had an even longer 3'UTR than the other Large type isolates (375 nt) (Fig. 3c
). An additional 19 nt were repeated in this isolate (position 2038). This region is part of the aminoacyl acceptor domain of the tRNA-like structure. Repeats in the 3'UTR of a tobamovirus have been demonstrated in the 3'UTR of ORSV RNA (414 nt) and also in STMV RNA (418 nt) (Isomura et al., 1991
; Gultyaev et al., 1994
; Mirkov et al., 1989
) where the 3' UTR mimics that of a tobamovirus (approximately 200 nt). However, the 3'UTR of ORSV RNA contains one original and two repeated sequences and each of these three domains has two pseudoknotted structures plus the anti-codon domain of the tRNA-like structure. The 3'UTR of STMV RNA more closely resembles the type of repeat detected in TMGMV-Large type isolates since it also contains an original and one repeated sequence and each domain has three pseudoknotted structures. The 3' terminus of STMV is similar to the TMGMV homologue including the tRNA-like structure.
These reports, together with the new results for TMGMV, suggest that repeats that create pseudoknots beyond the three initially reported for TMV-U1 are tolerated in tobamoviruses. If population studies of the kind reported in the present study were done on ORSV, or indeed for other tobamoviruses, it may turn out that the degree of plasticity in the 3'UTR revealed in this study, while seeming to be quite unique for ssRNA plant viruses, may be more common than presently recognized. What might be driving this population diversity for TMGMV is not clear, but the near identity of the repeated sequences within and between isolates, together with the observation that the repeated motif need not always be the same size, suggests that there is a current dynamic to the process. STMV has six pseudoknots in the large 3'UTR of its genome and it is potentially able to interact with the genome of TMGMV because of its dependence on TMGMV as a helper virus. The sequences of the 3'UTR of STMV and TMGMV while similar (Mirkov et al., 1989
) are not identical, so it is not logical at this point to conclude that the large 3'UTR in the Large type of TMGMV is the consequence of a simple recombinant event between STMV and the Small type of TMGMV.
Characterization of the Large and Small type sequences in this study indicates that RNA recombination may be the possible mechanism responsible for the generation of these different sequences. RNA recombination is thought to occur when processive transcription mediated by the viral RNA-dependent RNA polymerase is interrupted (possibly by structural constraints) allowing the enzyme to switch to a second template or an alternative position on the same template where polymerization of the nascent strand continues (Lai, 1992
; Nagy & Simon, 1997
). In addition, AU-rich regions have been shown to facilitate the generation of imprecise homologous recombinants (Nagy & Simon, 1997
). Sequence comparison of all of the isolates described in the present work suggests the involvement of AU-rich sequence in this event (nt 183196 or 328343, inclusive; Fig. 3
). Furthermore, RNA recombination in vivo occurs predominantly within unpaired regions of RNA (Nagy & Simon, 1997
). In agreement with this observation, all sequence repeat domains started and ended in single strand regions as predicted by Garcia-Arenal (1988)
. We also note that there were different type of duplications indicating that not all Large type isolates derived from one recombination event. At least two have occurred (San Diego isolate versus other isolates), and possibly more that were not detected.
Both Large and Small TMGMV types are well distributed in each of the sites from which samples were collected, indicating that both forms can exist, essentially side by side, as genome variants of TMGMV. In at least three field plants of N. glauca we observed both types in a single plant but this interpretation is made difficult by the presence of dsRNAs of several other viruses that infect N. glauca. Quantification of initial mixed infections with the two types of TMGMV was minimized in the present study by the decision to biologically purify isolates by making a series of single local lesion subcultures before beginning molecular comparisons. Any isolate that began as a mixture of both types would have been segregated into one or the other type by this procedure.
Some biological differences were noted between the Large and Small types of TMGMV, and we also noted some minor differences in the dsRNA profiles of these two types which may point to genetic variation elsewhere in the genome beyond the CP subgenomic RNA. It therefore cannot be concluded that the differences in the 3'UTR are responsible for the biological difference between the two types. At this stage we do not know the biological significance of one type over the other. However, the yield of the Small type virus was consistently higher than that of Large type in tobacco. The large overlap in the host range, the minor divergence in the CP gene and the ability of both types to support STMV are good reasons to continue to name both types TMGMV.
| Footnotes |
|---|
b Present address: Plant Biology Division, The Samuel Roberts Noble Foundation, PO Box 2180, Ardmore, OK 73402, USA. ![]()
| References |
|---|
|
|
|---|
Dodds, J. A. (1998). Satellite tobacco mosaic virus. Annual Review of Phytopathology 36, 295-310.[Medline]
Garcia-Arenal, F. (1988). Sequence and structure at the genome 3' end of the U2-strain of tobacco mosaic virus, a histidine accepting tobamovirus. Virology 167, 201-206.[Medline]
Gultyaev, A. P., Batenburg, E. V. & Pleij, C. W. A. (1994). Similarities between the secondary structure of satellite tobacco mosaic virus and tobamovirus RNAs. Journal of General Virology 75, 2851-2856.
Isomura, Y., Matumoto, Y., Murayama, A., Chatani, M., Inouye, N. & Ikegami, M. (1991). Molecular cloning, sequencing and expression in Escherichia coli of the odontoglossum ringspot virus coat protein gene. Journal of General Virology 72, 2247-2249.
Knorr, D. A. & Dawson, W. O. (1988). A point mutation in the tobacco mosaic virus capsid protein gene induces hypersensitivity in N. sylvestris. Proceedings of the National Academy of Sciences, USA 85, 170-174.
Kurath, G. & Dodds, J. A. (1995). Mutation analyses of molecular cloned satellite tobacco mosaic virus during serial passage in plants: evidence for hot spots of genetic changes. RNA 1, 491-500.[Abstract]
Kurath, G., Rey, M. E. C. & Dodds, J. A. (1992). Analysis of genetic heterogeneity within the type strain of satellite tobacco mosaic virus reveals several variants and a strong bias for A to G substitution mutations. Virology 189, 233-244.[Medline]
Kurath, G., Heick, J. A. & Dodds, J. A. (1993). RNase protection analysis show high genetic diversity among field isolates of satellite tobacco mosaic virus. Virology 194, 414-418.[Medline]
Laemmli, U. K. (1970). Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature 227, 680-685.[Medline]
Lai, M. M. C. (1992). RNA recombination in animal and plant viruses. Microbiological Reviews 56, 61-79.
Leathers, V., Tanguay, R., Kobayashi, M. & Gallie, D. R. (1993). A phylogenetically conserved sequence within viral 3' untranslated RNA pseudoknots regulates translation. Molecular and Cellular Biology 13, 5331-5347.
McKinney, H. H. (1929). Mosaic disease in the Canary Islands, West Africa, & Gibraltar. Journal of Agriculture Research 39, 557.
Mirkov, T. E., Mathews, D. M., Du Plessis, D. H. & Dodds, J. A. (1989). Nucleotide sequence and translation of satellite tobacco mosaic virus RNA. Virology 170, 139-146.[Medline]
Moya, A., Rodriguez-Cerezo, E. & Garcia-Arenal, F. (1993). Genetic structure of natural populations of the plant virus tobacco mild green mosaic virus.Molecular Biology and Evolution 10, 449-456.
Nagy, P. D. & Simon, A. E. (1997). New insights into the mechanisms of RNA recombination. Virology 235, 1-9.[Medline]
Palukaitis, P. & Zaitlin, M. (1986). Tobacco mosaic virus: infectivity and replication. In The Plant Viruses, pp. 105-131. Edited by M. H. V. Van Regenmortel & H. Fraenkel-Conrat. New York: Plenum.
Pleij, C. W. A. (1990). Pseudoknots: a new motif in the RNA game. Trends in Biochemical Sciences 15, 143-147.[Medline]
Randles, J. W., Palukaitis, P. & Davies, C. (1981). Natural distribution, spread, and variation, in the tobacco mosaic virus infecting Nicotiana glauca in Australia. Annals of Applied Biology 98, 109-119.
Routh, G., Dodds, J. A., Fitzmaurice, L. & Mirkov, E. (1995). Characterization of deletion and frameshift mutants of satellite tobacco mosaic virus. Virology 212, 121-127.[Medline]
Sambrook, J., Fritsch, E. F. & Maniatis, T. (1989). Molecular Cloning: A Laboratory Manual, 2nd edn. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory.
Siegel, A. & Wildman, S. G. (1954). Some natural relationships among strains of tobacco mosaic virus. Phytopathology 44, 277-282.
Smith, O. P., Harris, K. F., Toler, R. W. & Summers, M. D. (1988). Molecular cloning of potato leafroll virus complementary DNA. Phytopathology 78, 1060-1066.
Solis, I. & Garcia-Arenal, F. (1990). The complete nucleotide sequence of the genomic RNA of the tobamovirus tobacco mild green mosaic virus. Virology 177, 553-558.[Medline]
Valverde, R. A. & Dodds, J. A. (1986). Evidence for a satellite RNA associated naturally with the U5 strain and experimentally with the U1 strain of tobacco mosaic virus. Journal of General Virology 67, 1875-1884.
Valverde, R. A. & Dodds, J. A. (1987). Some properties of isometric virus particles which contain satellite RNA of tobacco mosaic virus. Journal of General Virology 68, 965-972.
Valverde, R. A., Heick, J. A. & Dodds, J. A. (1991). Interaction between satellite tobacco mosaic virus, helper tobamoviruses, and their hosts. Phytopathology 81, 99-104.
Van Regenmortel, M. H. V. (1966). Plant virus serology. Advances in Virus Research 12, 207-271.[Medline]
Wetter, C. (1986). Tobacco mild green mosaic virus. In The Plant Viruses, pp. 205-219. Edited by M. H. V. Van Regenmortel & H. Fraenkel-Conrat. New York: Plenum Press.
Received 6 July 1999;
accepted 10 November 1999.
This article has been cited by other articles:
![]() |
R. Koenig, S. Barends, A. P. Gultyaev, D.-E. Lesemann, H. J. Vetten, S. Loss, and C. W. A. Pleij Nemesia ring necrosis virus: a new tymovirus with a genomic RNA having a histidylatable tobamovirus-like 3' end J. Gen. Virol., June 1, 2005; 86(6): 1827 - 1833. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| INT J SYST EVOL MICROBIOL | MICROBIOLOGY | J GEN VIROL |
| J MED MICROBIOL | ALL SGM JOURNALS | |