J Gen Virol Try Microbiology Online
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via CrossRef
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Bodaghi, S.
Right arrow Articles by Dodds, J. A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Bodaghi, S.
Right arrow Articles by Dodds, J. A.
Agricola
Right arrow Articles by Bodaghi, S.
Right arrow Articles by Dodds, J. A.
Journal of General Virology (2000), 81, 577-586.
© 2000 Society for General Microbiology


Plant

Heterogeneity in the 3'-terminal untranslated region of tobacco mild green mosaic tobamoviruses from Nicotiana glauca resulting in variants with three or six pseudoknots

Sohrab Bodaghi1, Martin Ngon A Yassib,1 and J. Allan Dodds1

Microbiology Program and Department of Plant Pathology, University of California, Riverside, CA 92521-0122, USA1

Author for correspondence: Allan Dodds. Fax +1 909 787 4294. e-mail dodds{at}ucr.edu


   Abstract
TOP
Abstract
Introduction
Methods
Results
Discussion
References
 
Isolates of tobacco mild green mosaic tobamovirus (TMGMV) were obtained from 58 plants of Nicotiana glauca in southern California and placed in one of two groups (Small type and Large type) based on the size of the subgenomic RNA for the coat protein (CP). The CP sequence differed by no more than one amino acid for the two types, and the Small type was identical to that published for TMGMV. Thirty-six of the isolates had a double-stranded (ds)RNA profile that matched that of type TMGMV, and the nucleotide sequence of the 3' untranslated region (3'UTR) of six of these isolates was similar to the published sequence of TMGMV. Twenty-two isolates had a larger dsRNA for the CP subgenomic RNA. Six of these were sequenced and all had a repeat sequence of between 147 and 165 bases in the part of the 3'UTR that is involved in the formation of pseudoknots. These novel but common isolates are predicted to have six rather than three pseudoknots. Small types (three pseudoknots=type TMGMV) yielded twice as much virus after purification as Large types (six pseudoknots). The two groups of isolates could be distinguished in N. rustica (Large type, but not Small type gave a systemic infection), and N. clevelandii (Small type but not Large type induced systemic lethal necrosis). Almost all isolates of TMGMV used in this study were initially associated with satellite tobacco mosaic virus (STMV), and both types supported STMV experimentally.


   Introduction
TOP
Abstract
Introduction
Methods
Results
Discussion
References
 
Tobacco mild green mosaic virus (TMGMV) is a member of the tobamovirus group (Wetter, 1986Down ), which comprises rod-shaped plant viruses with undivided positive-sense, single-stranded (ss)RNA genomes. Tobacco mosaic virus (TMV) strain U1 is the type member (Palukaitis & Zaitlin, 1986Down ). TMGMV was first detected in plants of Nicotiana glauca Grah. (tree tobacco) on the Canary Islands (McKinney, 1929Down ). Similar viruses, e.g. para-tobacco mosaic virus and strain U2 of TMV, have been detected in field tobacco and vegetables in Europe and in the United States (Wetter, 1986Down ). In addition N. glauca, a wild solanaceous plant found in areas with a Mediterranean climate, has been identified as a natural host of a similar virus (TMV-U5) in southern California (Siegel & Wildman, 1954Down ), Australia (Randles et al., 1981Down ), Spain (Moya et al., 1993Down ), India and the Middle East (Randles et al., 1981Down ). These tobamoviruses are related to TMGMV and characteristically induce necrotic local lesions but no systemic infection in seedlings of N. sylvestris Spegaz. and cause mild mosaic symptoms in N. tabacum ‘Xanthi’ (Wetter, 1986Down ). These symptoms distinguish TMGMV from TMV-U1, which causes strong mosaic in both hosts (Knorr & Dawson, 1988Down ). Satellite tobacco mosaic virus (STMV) has been found associated with its helper virus TMGMV (also known as TMV-U5) in natural co-infections of N. glauca in southern California and characterized as a small spherical virus with a 1059 nucleotide (nt) ssRNA genome (Valverde & Dodds, 1986Down , 1987Down ; Valverde et al., 1991Down ; Mirkov et al., 1989Down ; Dodds, 1998Down ).

The genome of TMGMV has been sequenced (Solis & Garcia-Arenal, 1990Down ) and like other tobamoviruses encodes at least four proteins that include the 126 and 183 kDa polypeptides thought to be components of the replicase, the 28·5 kDa protein thought to be involved in cell-to-cell movement and the 17·5 kDa coat protein (CP). Subgenomic RNAs generated during replication are collinear with the genomic RNA at the 3' terminus; consequently, these RNAs contain the same 3' untranslated region (3'UTR) as the viral genome (Palukaitis & Zaitlin, 1986Down ). The 3'UTR of the genomic RNA of tobamoviruses, with the exception of Odontoglossum ringspot virus (ORSV) (Gultyaev et al., 1994Down ), consists of approximately 200 nt (Leathers et al., 1993Down ) with two characteristic domains. A 105 base tRNA-like domain located at the 3' terminus mimics the three-dimensional structure of a true tRNA, and immediately upstream of this domain is a 72 base domain composed of three RNA pseudoknots (Gultyaev et al., 1994Down ; Leathers et al., 1993Down ). Pseudoknots are RNA stem–loop structures that typically possess base complementarity between the loop and adjacent sequences (Pleij, 1990Down ). The 3'UTR in tobamoviruses promotes efficient translation and increases mRNA stability (Leathers et al., 1993Down ).

We report here population variability among tobamoviruses of the TMGMV type which naturally infect N. glauca in southern California. Two major populations were found, based on the relative mobility of the double-stranded (ds)RNA corresponding to the CP (LMC) (Palukaitis & Zaitlin, 1986Down ) subgenomic ssRNA in polyacrylamide gels. In order to investigate the nature and extent of this variability among individual isolates in each population, several isolates were chosen and compared biologically and serologically. We also present the nucleotide sequences of the 3'UTR of the RNA of these isolates of TMGMV in comparison to those of other tobamoviruses such as TMV-U2 (=TMGMV) (Solis & Garcia-Arenal, 1990Down ), and ORSV (Gultyaev et al., 1994Down ). In addition, comparison with the 3'UTR of STMV RNA allows hypotheses to be drawn on helper–satellite interactions.


   Methods
TOP
Abstract
Introduction
Methods
Results
Discussion
References
 
{blacksquare} Field collection.
A survey of N. glauca plants from locations in southern California [Santa Barbara County (SB), Santa Anita area (SA), Riverside County (four sites, R-1, -2, -3, -4), and San Diego County (SD)] was done during 1994–1996. Plants growing near road-sides or the coast were sampled by collecting at least 50 g of leaves from young shoots of individual plants with or without distinct symptoms of viral infection. All samples were indexed on N. glutinosa to detect tobamoviruses in general (local lesions) and on N. sylvestris to detect TMGMV in particular (local lesions). Index plants were inoculated by rubbing test plants with sap which had been obtained from field plants by grinding approximately 1 g of leaf tissue in 1 ml 0·02 M potassium phosphate buffer, pH 7·0 (inoculation buffer). The remainder of each sample was stored at -20 °C.

{blacksquare} Immunodiffusion tests.
The Ouchterlony double-diffusion assay was used initially to detect STMV (and therefore its helper virus TMGMV) using STMV-specific rabbit polyclonal antisera (titre 5000, used at a dilution of 1:100). Immunodiffusion assays were also done using rabbit polyclonal anti-TMGMV antibodies (titre 500, used at a dilution of 1:10) to detect TMGMV directly from infected tissue and for cross-absorption tests, which were performed in agar (Van Regenmortel, 1966Down ).

{blacksquare} DsRNA purification.
DsRNA was analysed from 7·0 g of infected leaf tissue by two cycles of CF-11 cellulose chromatography as previously described (Valverde & Dodds, 1986Down ). DsRNA analysis was used to detect several different plant viruses including TMGMV and STMV in field samples, and the type of TMGMV in experimental plants after biological purification of tobamovirus isolates. DsRNAs were purified from any given biologically purified isolate during the experiments to ensure they were free of contamination from other viruses.

{blacksquare} Biological purification.
TMGMV isolates were biologically purified by three or four repeated single local lesion passages in N. sylvestris and 58 were obtained, each from a separate source. The purified isolates were mechanically inoculated to N. tabacum ‘Xanthi’ and N. glauca; infected leaves were then preserved dried or frozen.

{blacksquare} Virus purification and antibodies.
A representative of each of two types of TMGMV, isolates R1-22 and R1-18 (see results), was propagated in N. tabacum ‘Xanthi’. These isolates were periodically checked by dsRNA analysis to ensure their identity and purity. TMGMV virions were purified by rate zonal sucrose density-gradient centrifugation (Valverde & Dodds, 1987Down ). CP subunits of TMGMV were analysed by SDS–PAGE (Laemmli, 1970Down ) in 10% polyacrylamide gel (40:1 acrylamide/bis-acrylamide). Polyclonal antiserum was raised in rabbits against each TMGMV type using purified virions as immunogen.

{blacksquare} Host range and symptomology.
Seedlings of up to 16 plant species were mechanically inoculated with purified virus at 50–200 µg/ml in inoculation buffer. To confirm the differences between each of the two types, two additional experiments were done using six isolates of each type from different geographical locations using the hosts that differentiated the two types initially used. Dried leaf powder of these isolates (biologically purified) was soaked for about 1 h in 1 ml of inoculation buffer. The extract was inoculated onto carborundum-dusted leaves of N. rustica, N. benthamiana and N. clevelandii (two plants per isolate). Inoculated plants were kept in a greenhouse and observed for symptom development. Sap from host-range plants was inoculated to N. sylvestris (back inoculation). Immunodiffusion and dsRNA analyses were also used to confirm TMGMV infection.

{blacksquare} Cloning and sequencing.
Viral RNA was isolated from purified virus (isolates R1-18 and R1-22) by the SDS and proteinase K method as previously described (Sambrook et al., 1989Down ). The initial cloning strategy utilized poly(A) tailing of viral ssRNA using poly(A) polymerase and [{alpha}-32P]ATP (Smith et al., 1988Down ). The oligonucleotide primer NotI(dT)18, 5' ACTGAATTCAAGCTTGCGGCCGC(T)18 3', containing 18-mer dT and over-hanging cloning sites for EcoRI, HindIII and NotI restriction enzymes, was used to prime the synthesis of first strand cDNA from the poly(A)-tailed RNA.

Double-stranded cDNA was synthesized from dT-tailed first strand cDNA by touch-down PCR amplification using the primers CP5' EcoRI at the 5' end of the CP gene and primers NotI(dT)18 and NotI adaptor at the 3' end. The 5' primer was 5' ATAGAATTCGCGGCCGCTCAATATGCCTTATACAATCAATCAACTCTCCGA 3' (CP5' EcoRI), which contains an EcoRI site and the sequence of TMGMV CP gene from nt 5661–5690 (underlined) (Nagy & Simon, 1997Down ). The 3' primers were NotI(dT)18 (3 pmol) and NotI adaptor primer with sequence 5' ACTGAATTCAAGCTTGCGGCCGCT 3', containing the same restriction sites as primer NotI(dT)18 (30 pmol). The PCR amplification conditions were as follows: 95 °C/2 min denaturation; three cycles of 94 °C/1 min, 40 °C/1 min, 72 °C/1·5 min for elongation annealing followed by 27 cycles of 94 °C/1 min, 55 °C/1 min, 72 °C/1·5 min, and then 72 °C for an additional 5 min. The PCR products were digested with EcoRI and NotI, and ligated into a similarly digested plasmid [pBluescript II KS(+/-); Stratagene]. Resulting cDNA clones were screened for insert size and two clones from each type were selected and sequenced. The clones contained cDNA inserts covering the entire CP and the 3'UTR.

To confirm the sequence heterogeneity found between the first two TMGMV isolates, ten more isolates from different geographical regions (five of each type, Large and Small; see Results) were selected for sequencing. Total nucleic acid was extracted from infected plants as previously described (Routh et al., 1995Down ). The sequences, obtained from dT-tailed cloning of the 3' end of our TMGMV RNA and published sequences (Solis & Garcia-Arenal, 1990Down ) were used to design two specific primers. cDNA to Large type TMGMV RNA (3'UTR) was synthesized using AMV reverse transcriptase and a 3' end-specific primer, 5' CGTGAATTCACCGGTTGGGCCGCTACCCGCGGTTA 3' (3' end primer), which included 20 bases (underlined) complementary to the genomic RNA of TMGMV (Solis & Garcia-Arenal, 1990Down ) except for the C residue at the 13th position (nt 6343, see result for isolate R1-18) and EcoRI and AgeI restriction sites for cloning into the polylinker of the plasmid vector pBluescript as discussed above.

Second strand cDNA was made using the specific primer 5' TGGACCACAACTCCGGCTAC 3' (CP3' primer), which is sense to nt 6122–6141, and AMV reverse transcriptase. cDNA clones were screened for insert size by digestion with the appropriate enzyme. Inserts of the predicted length were subjected to DNA sequencing analysis. At least two independent clones were sequenced for each isolate, the sequences of all cDNA clones were determined in both directions, and a consensus was derived. The same strategy was used to make cDNA for the Small type isolates, but these cDNAs were subjected to direct PCR sequencing (fmol sequencing system; Promega) without cloning into a vector.


   Results
TOP
Abstract
Introduction
Methods
Results
Discussion
References
 
TMGMV isolates
A total of 212 N. glauca samples was collected from seven sites in southern California. Sap extract from 68 of these samples induced local lesions on inoculated leaves of N. glutinosa and N. sylvestris which, when transferred from N. sylvestris, produced systemic mild mosaic symptoms in N. tabacum ‘Xanthi’, which are characteristic symptoms produced by TMGMV (Table 1Down). Fifty-nine of these isolates were associated initially with STMV based on immunodiffusion assays and dsRNA analysis. After biological purification 58 isolates were available for further characterization. Based on dsRNA analysis the biologically purified isolates were confirmed to be tobamoviruses and were now free of STMV and other viruses. Fig. 1Down shows the dsRNA profiles of eight TMGMV isolates purified from experimentally infected plants of either N. glauca (Fig. 1aDown) or N. tabacum ‘Xanthi’ (Fig. 1bDown). Isolates could be divided into two types depending on the size of the smallest subgenomic dsRNA (LMC, the subgenomic RNA that contains the CP open reading frame; Palukaitis & Zaitlin, 1986Down ). Four of the isolates (Fig. 1aDown, bDown; lanes 2, 3, 4 and 5) are representative of an additional 18 isolates which are not illustrated. A distinctive feature of these 22 isolates (Table 1Down) is a dsRNA identified as ‘LMC Large’ based on the mobility and therefore predicted size of the subgenomic RNA for the CP in the polyacrylamide gel. The dsRNA for the CP subgenomic RNA in this type migrates considerably slower than the equivalent subgenomic dsRNA of TMV-U1, identified as ‘LMC Small’. Four of the isolates (Fig. 1aDown, bDown; lanes 6, 7, 8 and 9) are representative of an additional 32 isolates (Table 1Down) which differ from the Large type. The difference was a Small rather than a Large dsRNA for the CP subgenomic RNA which co-electrophoresed with the corresponding dsRNA of TMV-U1. Most sites sampled contained isolates of both types (Table 1Down).


View this table:
[in this window]
[in a new window]
 
Table 1. Isolates of TMGMV from N. glauca in southern California

 


View larger version (69K):
[in this window]
[in a new window]
 
Fig. 1. DsRNA profiles of eight field isolates of TMGMV after biological purification. (a) DsRNA extraction from N. glauca; (b) dsRNA extraction from N. tabacum. The polyacrylamide gel contained a standard laboratory California isolate of TMGMV (lane 1); isolates possessing Large type dsRNAs corresponding to the LMC (=CP) subgenomic ssRNA (lanes 2–5); isolates possessing Small type dsRNA corresponding to the LMC subgenomic RNA (lanes 6–9); standard laboratory isolate of TMV-U1 (lane 10). Relative positions of the RF (dsRNA corresponding to full-length genomic ssRNA), and LMC dsRNAs are indicated.

 
The dsRNA profiles of the original isolates prior to biological purification were complex, reflecting the fact that N. glauca in southern California can be multiply infected naturally with tobamoviruses, STMV, cucumber mosaic cucumovirus (CMV), satellite RNA of CMV, tobacco etch potyvirus and other viruses (Dodds, 1993Down ). Despite this, it was usually possible to determine the nature of the tobamovirus dsRNA for the CP subgenomic RNA based on inspection of dsRNA profiles from N. glauca prior to biological purification when followed by Northern blot analysis using a 3'-terminal TMGMV probe (data not shown). Mixed infections of both types (Large and Small) were detected in only 3 of 35 samples tested in this manner.

In addition to the major differences between the two types, at least four Large type isolates (two from each location in SA and SD) had a minor variation in the mobility of the CP subgenomic dsRNA as compared to other isolates of the Large type (data not shown). Furthermore, additional minor dsRNA profile differences were observed among isolates including those from the same geographical location.

Symptomology in a range of hosts
To assess the possible biological significance of the two types identified by dsRNA analysis, one isolate of each type (R1-18, Large; R1-22, Small) was chosen and inoculated onto 16 different hosts. Infections were confirmed using immunodiffusion and back inoculation to a local lesion host (N. sylvestris). In addition, the presence of virus was confirmed in systemically infected tissue by dsRNA analysis.

The symptoms induced by both isolates in N. tabacum ‘Xanthi’ were a very mild green mottling or mosaic in the systemically infected leaves, with barely detectable symptoms in older leaves. Both types induced abundant local lesions on inoculated leaves of N. sylvestris with no systemic infection. These results support the conclusion that both are isolates of TMGMV. Table 2Down summarizes additional symptoms induced by the two isolates, which could not be distinguished in most of the hosts used.


View this table:
[in this window]
[in a new window]
 
Table 2. Symptoms of two type isolates of TMGMV from southern California in some plant hosts

 
Distinctive symptoms were observed in N. rustica, N. clevelandii and N. benthamiana. In N. rustica, either local lesions with no systemic infection (Small type) or both local lesions and systemic infection with symptoms (Large type) were observed. The local reaction took the form of abundant necrotic lesions on inoculated leaves. The systemic symptoms induced by the Large type included necrotic spots, small deformed leaves and stunting. These symptoms were most obvious when plants were young (three to four true leaves) at the time of inoculation. The number of local lesions was consistently fewer, and the severity of the local necrosis was less with the Small type than the Large type. The lack of systemic movement of the Small type was confirmed by back inoculation to N. sylvestris, immunodiffusion assay and dsRNA analysis on upper leaves. The Small type isolate caused systemic lethal necrosis in plants of N. clevelandii at 15 days post-inoculation (p.i.), whereas the Large type caused a systemic proliferation of shoots from the apex and rugosity of leaves. Both types of isolates induced cupped leaf symptoms in N. benthamiana at 4 days p.i. and the uppermost leaves of Large type inoculated plants showed wilting symptoms at 5 days p.i. However, the corresponding leaves of Small type-inoculated plants did not show wilting symptoms until 7 days p.i. Plants of N. benthamiana were dead by 10 days p.i. when inoculated with Large type, and by 14 days p.i. when inoculated with the Small type isolate.

In order to further investigate the effect on symptomology observed in the three plant species that were diagnostic during the preliminary experiment, two additional experiments were done. A total of twelve isolates (six of each type) from different locations was chosen and plant symptoms were compared. Both experiments yielded results that were generally similar to the first experiment, except that a range of severity in systemic symptom expression (moderate to severe) was observed, especially in N. rustica.

Mock-inoculated plants and inoculated plants of Lycopersicon esculentum cv. Rutgers, and Vigna unguiculata showed no symptoms and were negative for TMGMV infection based on back inoculation to N. sylvestris and immunodiffusion assays.

Ability of Large and Small TMGMV types to support STMV
Gradient-purified virus of TMGMV isolate R1-22 (Small) was inoculated with STMV purified from isolate R1-22 (STMV R1-22) or from isolate R1-18 (Large, STMV R1-18) to plants of N. glauca. Both isolates of STMV were detected by dsRNA analysis in doubly inoculated tobacco plants, but not in plants inoculated with TMGMV alone (Fig. 2Down). The reciprocal experiment using TMGMV isolate R1-18 (Large) as the helper gave the same results. The dsRNA profiles (Fig. 2Down) did not show any evidence for contamination of TMGMV Large type with TMGMV Small type, and vice versa, based on the absence of contaminant LMC dsRNAs. Neither of the STMV inocula was infectious in the absence of TMGMV. The experiment was repeated with a second set of plants and the same results were obtained.



View larger version (75K):
[in this window]
[in a new window]
 
Fig. 2. Ability of Large and Small TMGMV types to support STMV interpreted by dsRNA analysis. Plants were inoculated as follows: mock (lane 1); TMGMV R1-18 alone (lane 2); TMGMV R1-22 alone (lane 3); TMGMV R1-18 and STMV R1-18 (lane 4); TMGMV R1-22 and STMV R1-22 (lane 5); TMGMV R1-18 and STMV R1-22 (lane 6); TMGMV R1-22 and STMV R1-18 (lane 7); STMV R1-18 alone (lane 8); STMV R1-22 alone (lane 9).

 
Yield of purified virus
In order to further compare variability between these two types, yields of purified virus from tobacco were measured (Table 3Down). The yield data were evaluated using general linear model (PROC GLM) and least significant difference (LSD) procedures of SAS version 6.12. For this, the data were arranged in a one-way classification with the number of times the experiment was done for each isolate as the replication. The average yield of virus for three different isolates of Large type TMGMV was 1·79 mg virus/g tissue, as compared to a significantly higher (P<0·01) average yield of 3·53 mg virus/g tissue for three different isolates of Small type TMGMV (Table 3Down). On average Small type TMGMV produced about twice as much virus as Large type. The same trend was also observed in N. glauca in one experiment (yield of Large type was 0·87 mg virus/g tissue as compared to Small type 2·6 mg virus/g tissue).


View this table:
[in this window]
[in a new window]
 
Table 3. Purified yield of Large and Small type TMGMV from N. tabacum ‘Xanthi’ plants

 
Protein analysis and serology
In Ouchterlony immunodiffusion assays no antigenic differences were observed between Large and Small types. All 58 isolates produced one clear precipitin line, with no spur occurring between any of the isolates and either of the two type isolates using antisera prepared against both types. Furthermore, the two type isolates could not be distinguished by means of reciprocal cross-absorption tests with their respective antisera.

In order to further investigate the relationship between the two isolates at the protein level, the CP gene of each was cloned and sequenced. The predicted amino acid sequence of the CP of the Small type was identical to that of TMGMV (=TMV-U2), and consisted of 158 amino acids (Solis & Garcia-Arenal, 1990Down ). However, there were seven point mutations at the nucleotide level (Table 4Down). The CP gene of the Large type was found to have an amino acid sequence (158 amino acids) nearly identical to that of the Small type, except for the substitution of a serine residue with a glycine residue at position 143, and six other point mutations (silent) at the same or different positions as those found in the Small type when compared to the published TMGMV sequence (Table 4Down).


View this table:
[in this window]
[in a new window]
 
Table 4. Point mutations in the CP gene of TMGMV from southern California

 
Sequence analyses of the 3'UTR of the isolates
The CP subgenomic RNA of TMGMV consists of the CP ORF and a 3'UTR of 210 nucleotides in the published sequence. Since the CP gene of both types of isolates in this study was almost identical, the region most likely to be responsible for the variability in size of the CP subgenomic RNA was the 3'UTR. Using poly(A) tailing, a 200–400 bp cDNA product was obtained from both isolates which included primarily the 3'UTR of the viral genome. Sequencing of a clone of the Small type revealed a 210 nt UTR preceded by the stop codon for the coat protein gene (Fig. 3Down). The 3'-terminal sequence of the Small type isolate was nearly identical to that of the published TMGMV (=TMV-U2) sequence (Garcia-Arenal, 1988Down ), differing only at position 168 (A->U) from the 3' terminus (Fig. 3aDown; here and in the remainder of the paper numbers are applied using the 3' terminus as nucleotide number 1). However, the sequence of the Large type differed markedly from that of the Small type in the 3'UTR by having an insertional repeat of 147 bases (39–185, inclusive) between positions 186 and 332 (bold in Fig. 3bDown). This region is involved in the formation of putative pseudoknot structures in the 3'UTR of TMGMV. To better evaluate the sequence heterogeneity of TMGMV and a possible geographical distribution of that genetic diversity, ten more isolates (five Large and five Small) were selected for sequencing, representing six different sites from which samples were collected. In order to confirm that the difference between Small and Large isolates mapped to the 3'UTR and not the CP gene, RT–PCR reactions were performed on genomic RNA of five isolates of each type using total nucleic acid purified from infected plants and primers TMGMV 3'AgeI and TMGMV CP3'. The PCR products from the five Large type isolates were longer than the products from the five Small type isolates which mapped the size differences to the 3'UTR for all of these isolates.



View larger version (62K):
[in this window]
[in a new window]
 
Fig. 3. Representative sequence at the 3'UTR of TMGMV from southern California. Sequences of 3'UTR TMGMV RNA deduced from 12 independent isolates. (a) Six Small type isolates, (b) five Large type isolates with a 147 base repeat and (c) one Large type isolate with a 165 base repeat. The consensus sequence is shown. The sequences of the clones are given only when they differ from that of the consensus sequence. The insertion repeats are shown in bold. All isolates were sequenced from two cDNAs in both directions (data not shown). The stop codon (UAG) for the TMGMV coat protein ORF is underlined for reference in comparing sequences. Base numbering is 3' to 5'; base 1 is the 3'-terminal A. * Initial isolates, used for most comparisons (see Results).

 
The results of the sequencing studies are compiled in Fig. 3Up. The sequences of the five Small types resembled the sequence of the initial Small isolate. Heterogeneities were detected at nine positions within the five new Small type isolates. An insertional repeat was found in all five Large type isolates. The consensus sequence for the two regions of the repeat is identical. Four out of five of the Large type isolates showed almost the same nucleotide sequence as the initial Large isolate analysed. Nucleotide sequence analysis of two clones derived from the SD isolate revealed that its 3'UTR was even longer than the other Large type isolates and this would explain the minor difference in dsRNA size described earlier (Fig. 3cUp). An additional 19 bases (20–38 inclusive) were repeated in this isolate, in the region of the aminoacyl acceptor domain. The repeat sequence in the SD isolate started at position 20 and ended at position 184, which was one nucleotide before the ending point (nt 185) of the other four Large isolates. Heterogeneities were detected at ten positions within eight clones from the five Large types. Heterogeneities found in one copy of the repeated sequence were not duplicated in the other [e.g. A (326) and G (179) in R2-9-6]. No heterogeneities were detected between the two clones from the SD isolate.


   Discussion
TOP
Abstract
Introduction
Methods
Results
Discussion
References
 
The population genetics of STMV has been studied in some detail and this satellite virus was found to be quite diverse (Kurath et al., 1992Down , 1993Down ; Kurath & Dodds, 1995Down ). While conducting these studies no attention was given to possible diversity amongst the helper tobamovirus isolates supporting the STMV genomes that were the target of the experiments. The present study was initiated in order to begin to evaluate the heterogeneity in the TMGMV population supporting STMV in southern California.

A previous study of dsRNAs of tobamoviruses (Valverde et al., 1987Down ) indicated that the subgenomic dsRNA for the CP of California isolates of TMGMV was unusually large for a tobamovirus, and electrophoresed like that of ORSV, which is known to have an unusually large 3'UTR for a tobamovirus (Gultyaev et al., 1994Down ). This was not a predicted result once a sequence of a TMGMV isolate was published (Solis & Garcia-Arenal, 1990Down ) which indicated that the CP subgenomic RNA including the 3'UTR should be about the same size as that expected for TMV-U1.

The current analysis of the dsRNAs of numerous isolates of TMGMV indicates that there are two types of TMGMV prevalent in southern California. One type, which had been previously overlooked, has a subgenomic RNA for the CP gene of similar mobility to that of TMV-U1, and therefore matched the predicted genome organization of TMGMV based on a published sequence. Biological, virological and sequence analyses of several isolates of this type (Small) indicate that this conventional form of TMGMV is common in southern California, and has the expected host range for TMGMV.

In addition to this type, however, we have confirmed our earlier conclusion that there is another type (called Large in this study and the type reported in previous studies) that has a large CP subgenomic RNA (LMC), and which has a similar, but not identical host range to TMGMV. The discovery that isolates of this type had essentially the same CP sequence as TMGMV suggests that the difference in size could map to the 3'UTR, since the CP ORF is such a large portion of this CP subgenomic RNA. This conclusion was confirmed by sequence analysis which also revealed that the increase in the size of the 3'UTR was caused by interesting repeated sequences in the 3'UTR region of the genome.

A TMGMV Large type was used in most previous studies of STMV (Dodds, 1998Down ) but in one study a type isolate of TMV-U2 (equivalent to TMGMV-Small type) (Valverde et al., 1991Down ) was shown to support STMV. In this study we confirmed that a recently isolated Large and Small type TMGMV could support not only the STMV with which it was associated but also the STMV initially associated with the other type. Since only 3 of 35 field isolates tested positive for mixed infections, and all were initially positive for STMV, it is likely that both Large and Small TMGMV types can independently support STMV in natural infections.

Analysis of the 3'UTR of Large type isolates revealed two domains, each of 147 nt and almost identical in sequence, one of which is absent from Small type isolates (Fig. 3aUp, bUp). The repeated sequence contained that part of the tRNA-like structure corresponding to the anti-codon domain upstream of the aminoacyl acceptor domain. In addition, the repeat contained the sequence for three pseudoknotted structures predicted to form in the 3'-terminal region of TMGMV (=TMV-U2) between the 5' end of the tRNA-like structure and the 3' end of the CP gene (Fig. 3bUp in Garcia-Arenal, 1988Down ). The repeat sequence started at position 39 and ended at position 185. An isolate from San Diego had an even longer 3'UTR than the other Large type isolates (375 nt) (Fig. 3cUp). An additional 19 nt were repeated in this isolate (position 20–38). This region is part of the aminoacyl acceptor domain of the tRNA-like structure. Repeats in the 3'UTR of a tobamovirus have been demonstrated in the 3'UTR of ORSV RNA (414 nt) and also in STMV RNA (418 nt) (Isomura et al., 1991Down ; Gultyaev et al., 1994Down ; Mirkov et al., 1989Down ) where the 3' UTR mimics that of a tobamovirus (approximately 200 nt). However, the 3'UTR of ORSV RNA contains one original and two repeated sequences and each of these three domains has two pseudoknotted structures plus the anti-codon domain of the tRNA-like structure. The 3'UTR of STMV RNA more closely resembles the type of repeat detected in TMGMV-Large type isolates since it also contains an original and one repeated sequence and each domain has three pseudoknotted structures. The 3' terminus of STMV is similar to the TMGMV homologue including the tRNA-like structure.

These reports, together with the new results for TMGMV, suggest that repeats that create pseudoknots beyond the three initially reported for TMV-U1 are tolerated in tobamoviruses. If population studies of the kind reported in the present study were done on ORSV, or indeed for other tobamoviruses, it may turn out that the degree of plasticity in the 3'UTR revealed in this study, while seeming to be quite unique for ssRNA plant viruses, may be more common than presently recognized. What might be driving this population diversity for TMGMV is not clear, but the near identity of the repeated sequences within and between isolates, together with the observation that the repeated motif need not always be the same size, suggests that there is a current dynamic to the process. STMV has six pseudoknots in the large 3'UTR of its genome and it is potentially able to interact with the genome of TMGMV because of its dependence on TMGMV as a helper virus. The sequences of the 3'UTR of STMV and TMGMV while similar (Mirkov et al., 1989Down ) are not identical, so it is not logical at this point to conclude that the large 3'UTR in the Large type of TMGMV is the consequence of a simple recombinant event between STMV and the Small type of TMGMV.

Characterization of the Large and Small type sequences in this study indicates that RNA recombination may be the possible mechanism responsible for the generation of these different sequences. RNA recombination is thought to occur when processive transcription mediated by the viral RNA-dependent RNA polymerase is interrupted (possibly by structural constraints) allowing the enzyme to switch to a second template or an alternative position on the same template where polymerization of the nascent strand continues (Lai, 1992Down ; Nagy & Simon, 1997Down ). In addition, AU-rich regions have been shown to facilitate the generation of imprecise homologous recombinants (Nagy & Simon, 1997Down ). Sequence comparison of all of the isolates described in the present work suggests the involvement of AU-rich sequence in this event (nt 183–196 or 328–343, inclusive; Fig. 3Up). Furthermore, RNA recombination in vivo occurs predominantly within unpaired regions of RNA (Nagy & Simon, 1997Down ). In agreement with this observation, all sequence repeat domains started and ended in single strand regions as predicted by Garcia-Arenal (1988)Down . We also note that there were different type of duplications indicating that not all Large type isolates derived from one recombination event. At least two have occurred (San Diego isolate versus other isolates), and possibly more that were not detected.

Both Large and Small TMGMV types are well distributed in each of the sites from which samples were collected, indicating that both forms can exist, essentially side by side, as genome variants of TMGMV. In at least three field plants of N. glauca we observed both types in a single plant but this interpretation is made difficult by the presence of dsRNAs of several other viruses that infect N. glauca. Quantification of initial mixed infections with the two types of TMGMV was minimized in the present study by the decision to biologically purify isolates by making a series of single local lesion subcultures before beginning molecular comparisons. Any isolate that began as a mixture of both types would have been segregated into one or the other type by this procedure.

Some biological differences were noted between the Large and Small types of TMGMV, and we also noted some minor differences in the dsRNA profiles of these two types which may point to genetic variation elsewhere in the genome beyond the CP subgenomic RNA. It therefore cannot be concluded that the differences in the 3'UTR are responsible for the biological difference between the two types. At this stage we do not know the biological significance of one type over the other. However, the yield of the Small type virus was consistently higher than that of Large type in tobacco. The large overlap in the host range, the minor divergence in the CP gene and the ability of both types to support STMV are good reasons to continue to name both types TMGMV.


   Footnotes
 
The GenBank accession numbers of the sequences reported in this paper are AF132907 and AF132908.

b Present address: Plant Biology Division, The Samuel Roberts Noble Foundation, PO Box 2180, Ardmore, OK 73402, USA. Back


   References
TOP
Abstract
Introduction
Methods
Results
Discussion
References
 
Dodds, J. A. (1993). DsRNA in diagnosis. In Diagnosis of Plant Virus Disease, pp. 273-294. Edited by R. E. F. Mathews. Boca Raton: CRC Press.

Dodds, J. A. (1998). Satellite tobacco mosaic virus. Annual Review of Phytopathology 36, 295-310.[Medline]

Garcia-Arenal, F. (1988). Sequence and structure at the genome 3' end of the U2-strain of tobacco mosaic virus, a histidine accepting tobamovirus. Virology 167, 201-206.[Medline]

Gultyaev, A. P., Batenburg, E. V. & Pleij, C. W. A. (1994). Similarities between the secondary structure of satellite tobacco mosaic virus and tobamovirus RNAs. Journal of General Virology 75, 2851-2856.[Abstract/Free Full Text]

Isomura, Y., Matumoto, Y., Murayama, A., Chatani, M., Inouye, N. & Ikegami, M. (1991). Molecular cloning, sequencing and expression in Escherichia coli of the odontoglossum ringspot virus coat protein gene. Journal of General Virology 72, 2247-2249.[Abstract/Free Full Text]

Knorr, D. A. & Dawson, W. O. (1988). A point mutation in the tobacco mosaic virus capsid protein gene induces hypersensitivity in N. sylvestris. Proceedings of the National Academy of Sciences, USA 85, 170-174.[Abstract/Free Full Text]

Kurath, G. & Dodds, J. A. (1995). Mutation analyses of molecular cloned satellite tobacco mosaic virus during serial passage in plants: evidence for hot spots of genetic changes. RNA 1, 491-500.[Abstract]

Kurath, G., Rey, M. E. C. & Dodds, J. A. (1992). Analysis of genetic heterogeneity within the type strain of satellite tobacco mosaic virus reveals several variants and a strong bias for A to G substitution mutations. Virology 189, 233-244.[Medline]

Kurath, G., Heick, J. A. & Dodds, J. A. (1993). RNase protection analysis show high genetic diversity among field isolates of satellite tobacco mosaic virus. Virology 194, 414-418.[Medline]

Laemmli, U. K. (1970). Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature 227, 680-685.[Medline]

Lai, M. M. C. (1992). RNA recombination in animal and plant viruses. Microbiological Reviews 56, 61-79.[Abstract/Free Full Text]

Leathers, V., Tanguay, R., Kobayashi, M. & Gallie, D. R. (1993). A phylogenetically conserved sequence within viral 3' untranslated RNA pseudoknots regulates translation. Molecular and Cellular Biology 13, 5331-5347.[Abstract/Free Full Text]

McKinney, H. H. (1929). Mosaic disease in the Canary Islands, West Africa, & Gibraltar. Journal of Agriculture Research 39, 557.

Mirkov, T. E., Mathews, D. M., Du Plessis, D. H. & Dodds, J. A. (1989). Nucleotide sequence and translation of satellite tobacco mosaic virus RNA. Virology 170, 139-146.[Medline]

Moya, A., Rodriguez-Cerezo, E. & Garcia-Arenal, F. (1993). Genetic structure of natural populations of the plant virus tobacco mild green mosaic virus.Molecular Biology and Evolution 10, 449-456.

Nagy, P. D. & Simon, A. E. (1997). New insights into the mechanisms of RNA recombination. Virology 235, 1-9.[Medline]

Palukaitis, P. & Zaitlin, M. (1986). Tobacco mosaic virus: infectivity and replication. In The Plant Viruses, pp. 105-131. Edited by M. H. V. Van Regenmortel & H. Fraenkel-Conrat. New York: Plenum.

Pleij, C. W. A. (1990). Pseudoknots: a new motif in the RNA game. Trends in Biochemical Sciences 15, 143-147.[Medline]

Randles, J. W., Palukaitis, P. & Davies, C. (1981). Natural distribution, spread, and variation, in the tobacco mosaic virus infecting Nicotiana glauca in Australia. Annals of Applied Biology 98, 109-119.

Routh, G., Dodds, J. A., Fitzmaurice, L. & Mirkov, E. (1995). Characterization of deletion and frameshift mutants of satellite tobacco mosaic virus. Virology 212, 121-127.[Medline]

Sambrook, J., Fritsch, E. F. & Maniatis, T. (1989). Molecular Cloning: A Laboratory Manual, 2nd edn. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory.

Siegel, A. & Wildman, S. G. (1954). Some natural relationships among strains of tobacco mosaic virus. Phytopathology 44, 277-282.

Smith, O. P., Harris, K. F., Toler, R. W. & Summers, M. D. (1988). Molecular cloning of potato leafroll virus complementary DNA. Phytopathology 78, 1060-1066.

Solis, I. & Garcia-Arenal, F. (1990). The complete nucleotide sequence of the genomic RNA of the tobamovirus tobacco mild green mosaic virus. Virology 177, 553-558.[Medline]

Valverde, R. A. & Dodds, J. A. (1986). Evidence for a satellite RNA associated naturally with the U5 strain and experimentally with the U1 strain of tobacco mosaic virus. Journal of General Virology 67, 1875-1884.

Valverde, R. A. & Dodds, J. A. (1987). Some properties of isometric virus particles which contain satellite RNA of tobacco mosaic virus. Journal of General Virology 68, 965-972.

Valverde, R. A., Heick, J. A. & Dodds, J. A. (1991). Interaction between satellite tobacco mosaic virus, helper tobamoviruses, and their hosts. Phytopathology 81, 99-104.

Van Regenmortel, M. H. V. (1966). Plant virus serology. Advances in Virus Research 12, 207-271.[Medline]

Wetter, C. (1986). Tobacco mild green mosaic virus. In The Plant Viruses, pp. 205-219. Edited by M. H. V. Van Regenmortel & H. Fraenkel-Conrat. New York: Plenum Press.

Received 6 July 1999; accepted 10 November 1999.


This article has been cited by other articles:


Home page
J. Gen. Virol.Home page
R. Koenig, S. Barends, A. P. Gultyaev, D.-E. Lesemann, H. J. Vetten, S. Loss, and C. W. A. Pleij
Nemesia ring necrosis virus: a new tymovirus with a genomic RNA having a histidylatable tobamovirus-like 3' end
J. Gen. Virol., June 1, 2005; 86(6): 1827 - 1833.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via CrossRef
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Bodaghi, S.
Right arrow Articles by Dodds, J. A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Bodaghi, S.
Right arrow Articles by Dodds, J. A.
Agricola
Right arrow Articles by Bodaghi, S.
Right arrow Articles by Dodds, J. A.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
INT J SYST EVOL MICROBIOL MICROBIOLOGY J GEN VIROL
J MED MICROBIOL ALL SGM JOURNALS